Vigs vector for silencing western flower thrips genes and application thereof

Abstract

The application discloses a VIGS vector for silencing a western flower thrips gene and application thereof, and belongs to the technical field of genetic engineering. The application constructs a VIGS vector containing a specific nucleotide fragment of a western flower thrips ACT or SNF gene, and successfully transfects the VIGS vector into Fusarium graminearum PH-1 / Tri5 by using a PEG-mediated Fusarium graminearum protoplast transfection method, and constructs a recombinant engineering bacterium. The sRNA is extracted and separated by culturing the recombinant engineering bacterium or the mycelium is used to prepare a crude extract, and the sRNA or the crude extract is sprayed on the western flower thrips, and it is found that the western flower thrips can be effectively prevented and controlled. Therefore, the western flower thrips ACT and SNF gene VIGS vector provided by the application can provide new technical support and direction for the prevention and control of the western flower thrips.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a VIGS vector for silencing a gene of Frankliniella occidentalis and application thereof. BACKGROUND

[0002] Virus-induced Gene Silencing (VIGS) is a powerful functional genomics tool, and the VIGS technology is based on the RNA interference (RNAi) mechanism of the host. When the host is infected with a virus, its RNAi system is activated to degrade viral RNA. VIGS triggers the host RNAi system by introducing a recombinant viral vector containing a target gene fragment, produces virus-derived small RNA (vsRNA), guides the RNA-induced silencing complex (RISC) to specifically degrade the mRNA of the target gene, and achieves gene silencing.

[0003] Frankliniella occidentalis is a worldwide invasive crop pest with strong reproductive ability and short life cycle. It is a highly polyphagous species with a wide range of hosts, including more than 500 species of plants such as peppers, tomatoes, cucumbers, cotton, and flowers. The sucking of larvae and adults directly damages flower and leaf tissues, leading to inhibited plant growth, reduced yield and quality, and the spread of multiple plant viruses. At present, the control of Frankliniella occidentalis is mainly based on chemical insecticides, but excessive use of chemical insecticides leads to the development of insecticide resistance in Frankliniella occidentalis. Therefore, it is extremely important to develop new sustainable RNAi pesticides. SUMMARY

[0004] The purpose of the present application is to provide a VIGS vector for silencing a gene of Frankliniella occidentalis and application thereof, to solve the problems existing in the prior art. By constructing a VIGS vector for silencing a gene of Frankliniella occidentalis and transforming it into Fusarium graminearum to construct a recombinant engineering bacterium, it is found that sRNA extracted from the recombinant engineering bacterium or crude extract prepared therefrom can significantly inhibit Frankliniella occidentalis, indicating that the VIGS vector constructed in the present application can provide new technical support and direction for the control of Frankliniella occidentalis.

[0005] To achieve the above purpose, the present application provides the following solutions.

[0006] The present application provides a VIGS vector for silencing a gene of Frankliniella occidentalis, which comprises a specific nucleotide fragment of an ACT gene or an SNF gene of Frankliniella occidentalis, wherein the specific nucleotide fragment of the ACT gene is shown as SEQ ID NO. 1, and the specific nucleotide fragment of the SNF gene is shown as SEQ ID NO. 2.

[0007] Preferably, the backbone of the VIGS vector comprises a p26-D4 vector.

[0008] The present application also provides a recombinant engineering bacterium for silencing a western flower thrips gene, wherein the recombinant engineering bacterium comprises the VIGS vector.

[0009] The present application also provides an sRNA for silencing a western flower thrips gene, wherein the sRNA is extracted and separated by culturing the recombinant engineering bacterium.

[0010] The present application also provides a crude extract for silencing a western flower thrips gene, wherein the crude extract comprises the recombinant engineering bacterium.

[0011] Preferably, the crude extract is obtained by grinding the mycelium with water after culturing the recombinant engineering bacterium.

[0012] The present application also provides an application of the VIGS vector, the recombinant engineering bacterium, the sRNA or the crude extract in any of the following:

[0013] (1) an application in preventing and controlling the western flower thrips;

[0015] (2) an application in preventing and controlling the plant pest caused by the western flower thrips;

[0016] (3) an application in preparing a biological pesticide for preventing and controlling the western flower thrips.

[0017] The present application also provides a biological pesticide for preventing and controlling the western flower thrips, wherein the biological pesticide comprises the recombinant engineering bacterium, the sRNA or the crude extract.

[0018] The present application also provides a method for silencing a western flower thrips gene, wherein the method comprises a step of contacting the sRNA or the crude extract with the western flower thrips larvae and / or adult.

[0019] The present application also provides a method for preventing and controlling the western flower thrips, wherein the method comprises a step of contacting the sRNA or the crude extract with the western flower thrips larvae and / or adult.

[0020] The present application discloses the following technical effects: The present application constructs a VIGS vector containing a specific nucleotide fragment of the western flower thrips ACT or SNF gene, and successfully transfects the VIGS vector into Fusarium graminearum PH-1 / Tri5 by using a PEG-mediated Fusarium graminearum protoplast transfection method, and constructs a recombinant engineering bacterium. The sRNA is extracted and separated by culturing the recombinant engineering bacterium, or the crude extract is prepared by using the mycelium, and the sRNA or the crude extract is sprayed on the western flower thrips, and it is found that the western flower thrips can be effectively prevented and controlled. Therefore, the VIGS vector of the western flower thrips ACT and SNF gene can provide new technical support and direction for the prevention and control of the western flower thrips. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 Schematic diagram of the p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF vectors;

[0023] Figure 2 Phenotypic comparison of PH-1 / Tri5 strains transfected with three VIGS vectors: p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF;

[0024] Figure 3 Electrophoretic detection images of sRNA extracted from PH-1 / Tri5 strain transfected with three VIGS vectors: p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF; lanes 1-4 from left to right correspond to Marker, p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF, respectively.

[0025] Figure 4 The effects of three sRNAs on the lethality and gene expression of western flower thrips larvae were investigated. A: Survival curve analysis of the lethality of western flower thrips larvae with different sRNAs during a 5-day observation period; B: Assessment of the lethality of western flower thrips larvae with different sRNAs on day 5; C: Detection of gene expression levels in western flower thrips larvae treated with different sRNAs on day 3; WFT-L represents the treatment of western flower thrips larvae.

[0026] Figure 5 The effects of three sRNAs on the mortality rate and gene expression of adult western flower thrips were investigated. A: Survival curve analysis of the mortality rate of adult western flower thrips under different sRNAs during a 5-day observation period; B: Assessment of the mortality rate of adult western flower thrips under different sRNAs on day 5; C: Detection of gene expression levels in adult western flower thrips after treatment with different sRNAs on day 3; WFT-A represents the treatment of adult western flower thrips.

[0027] Figure 6To evaluate the mortality rate of the crude extracts of the different VIGS vector strains on the western flower thrips larvae; wherein, A: on day 6, evaluate the mortality rate of the 1-fold crude extracts of the p26-D4-ACT, p26-D4-SNF VIGS vector strains on the western flower thrips larvae; B: on day 6, evaluate the mortality rate of the 100-fold crude extracts of the p26-D4-ACT, p26-D4-SNF VIGS vector strains on the western flower thrips larvae; C: on day 6, evaluate the mortality rate of the 10000-fold crude extracts of the p26-D4-ACT, p26-D4-SNF VIGS vector strains on the western flower thrips larvae. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present application will now be described in detail with reference to the drawings. The detailed description is not intended to limit the scope of the present application, but to explain certain aspects, features and embodiments of the present application.

[0029] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise stated, the inclusion of either a lower or an upper limit of a range of values is specifically asserted. The exclusion of either a lower or an upper limit of a range of values is specifically asserted. The inclusion of either a lower or an upper limit of a range of values discloses all values between the stated lower value and the stated upper value. Exclusion of either a lower or an upper limit discloses that no lower or upper limit exists to either sub-ranges believed to be within the scope of embodiments of the application or to the broader parameter range claimed.

[0030] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to the extent allowed by law. In the case of conflict between the description herein and the incorporated material, the description herein shall control.

[0031] In the description of the application specific embodiments changes can be made to the application description without departing from the scope or spirit of the application as described. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.

[0032] In this document, the terms "including" and "comprising" are used herein open-ended terms that are to be construed to cover a wide variety of circumstances. Nothing in this document is to be construed as indicating any non-claimed element essential to the practice of the application.

[0033] Example 1 A method for controlling western flower thrips using a viral induced gene silencing (VIGS) technique

[0034] 1. Experimental materials

[0035] (1) Western flower thrips: Western flower thrips larvae and adults were used as experimental objects.

[0036] (2) VIGS vector: The p26-D4 vector was used, which contains a cloning site for inserting the target gene fragment. The vector has been disclosed in the invention patent "CN202310441503.1 A fungal virus-induced gene silencing vector and its construction method and application".

[0037] (3) Target gene fragment: Western flower thrips ACT and SNF were used as target genes, and the specific gene fragment sequences are shown in SEQ ID NO. 1-2.

[0038] (4) Fungal strain: DON is a trichothecene mycotoxin produced by Fusarium fungi, which is toxic to plants and animals. The expression of Tri5 gene is closely related to the synthesis of DON toxin, which is a key enzyme for the first step of DON toxin synthesis. By knocking out the Tri5 gene, the pathogenicity of the pathogenic fungus can be significantly reduced. Therefore, the Tri5 gene knockout mutant strain PH-1 / Tri5 (the mutant strain has been disclosed in the following literature: Brown D W, McCormick S P, Alexander NJ, et al. A genetic and biochemical approach to study trichothecene diversity in Fusarium sporotrichioides and Fusarium graminearum.) was selected to mediate the VIGS vector.

[0039] (5) Culture medium: PDA medium was used for fungal culture.

[0040] 2. Construction of VIGS vector

[0041] (1) Gene fragment cloning: The target gene sequence with a coding region length of 150 bp was selected, and specific F and R primers were designed according to the sequence (Table 1). The target gene fragment was specifically amplified using PCR technology, and the amplification conditions are shown in Tables 2-3. The target fragment was recovered using an agarose gel recovery kit.

[0042] The target gene (ACT) fragment is shown in SEQ ID NO. 1:

[0043] ACACCATCACCAGAATCCAAGACGATACCAGTGGTACGACCAGAGGCATACAGGGAAAGGACAGCCTGGATGGCGACGTACATGGCGGGTGTGTTGAAGGTCTCAAACATAATCTGTGTCATCTTTTCCCTGTTGGCTTTAGGGTTCAGG.

[0044] The fragment of the target gene (SNF) is shown in SEQ ID NO. 2:

[0045] CTTCATATTTGAGCTTCGAAGTTTAATCAAAATTTGGGACTTATTAGTCTTATCAATGTCTTGATCAGTAACAGCTGCATACCCCTGGTACTGTAGATAATATGCTATAAACCTGGCATCAGTAGAAGGTACATTTTCCATACCACAAGC.

[0046] Table 1. Specific sequence amplification primers of Frankliniella occidentalis

[0047]

[0048] Table 2. PCR reaction system

[0049]

[0050] Table 3. PCR reaction program

[0051]

[0052] (2) Construction of VIGS vector: the target fragment was inserted into p26-D4 vector by homologous recombination method to obtain p26-D4-ACT and p26-D4-SNF vectors (see Figure 1 ). The recombination connection reaction system is shown in Table 4.

[0053] Table 4. Recombination connection reaction system

[0054]

[0055] After mixing according to the above reaction system, the recombination reaction was carried out under the condition of 50℃, 5min.

[0056] 3. Fungal-mediated VIGS vector transfection

[0057] The VIGS silencing vector was transfected into the knockout mutant strain PH-1 / Tri5 using the PEG-mediated Fusarium graminearum protoplast transfection method (see the invention patent "CN202310441503.1 Fungal virus-induced gene silencing vector and its construction method and application"). The correct transfectants were screened by PCR detection. PH-1 / Tri5 transfected with p26-D4-GFP vector (see Figure 1 ) was used as a control.

[0058] Table 5 Transfectant detection primers

[0059]

[0060] 4, Western flower thrips prevention and control experiment

[0061] (1) sRNA extraction: The transfected fungi were cultured (see Figure 2 for the phenotypes of the three transfectant strains p26-D4-ACT, p26-D4-SNF, and p26-D4-GFP), and sRNA was extracted using the miRcute miRNA extraction and separation kit (DP501) from Tiangen Biochemical Co., Ltd. and subjected to electrophoresis detection.

[0062] (2) Crude extract preparation: The transfected fungi were cultured, 7.5 g of mycelium was weighed, and liquid nitrogen was used for sufficient grinding before adding 100 mL of ddH2O to obtain the crude extract stock solution. The crude extract stock solution was then diluted 100-fold and 10,000-fold to obtain three different concentrations of crude extracts.

[0063] (3) Prevention and control experiment: sRNA and crude extracts of different concentrations were sprayed on western flower thrips larvae and adults to ensure that the western flower thrips larvae and adults were in contact with sRNA or crude extracts of different concentrations. The survival rate was observed and counted every day, and a certain number of western flower thrips were picked within the specified time for qPCR detection of gene expression and analysis. The qPCR detection primers are shown in Table 6, and the detection conditions are shown in Tables 7-8.

[0064] Table 6 qPCR primers

[0065]

[0066] Table 7 qPCR reaction system

[0067]

[0068] Table 8 qPCR reaction program

[0069]

[0070] The results show that sRNA can be successfully extracted from the strains transfected with different VIGS vectors (see Figure 3 ). After the western flower thrips were treated with sRNA, we observed for 5 days, drew survival curves, detected gene expression levels by real-time fluorescence quantitative detection, and evaluated mortality (see Shi B, He H, Zhao C, Lei C, Li J, Yan FM. Potential of Virus-Mediated RNAi of Insect Genes in Plants to Control Aphids.). The results showed that the sRNA produced by p26-D4-ACT and p26-D4-SNF significantly increased the mortality of western flower thrips larvae and adults, and significantly reduced the expression level of the gene, indicating that p26-D4-ACT and p26-D4-SNF can effectively control the western flower thrips (see Figure 4 and Figure 5 ).

[0071] Compared with the control (water) treatment, the treatment with different concentrations of crude extracts found that on the 6th day, the mortality of western flower thrips larvae was significantly increased under the treatment of 1-fold and 100-fold concentrations of crude extracts, and the sRNA of p26-D4-ACT still had a significant effect under the treatment of 10,000-fold (see Figure 6 ).

[0072] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A VIGS vector silencing a gene of Frankliniella occidentalis, characterized in that, The VIGS vector comprises a specific nucleotide fragment of a western flower thrips ACT gene or a SNF gene, the specific nucleotide fragment of the ACT gene being shown as SEQ ID NO. 1, and the specific nucleotide fragment of the SNF gene being shown as SEQ ID NO.

2. The skeleton of the VIGS vector is a p26-D4 vector.

2. Recombinant engineered bacteria silencing a western flower bug gene, characterized in that, The recombinant engineering bacteria comprise the VIGS vector of claim 1.

3. An sRNA silencing a western flower bug gene, characterized in that, The sRNA is obtained by culturing the recombinant engineering bacteria of claim 2.

4. A crude extract silencing a gene of Frankliniella occidentalis, characterized in that, The crude extract comprises the recombinant engineering bacteria of claim 2.

5. The crude extract of claim 4, wherein, The crude extract is obtained by grinding the mycelium with water after culturing the recombinant engineering bacteria.

6. The VIGS vector of claim 1 or the recombinant engineering bacteria of claim 2 or the sRNA of claim 3 or the crude extract of claim 4 is applied in any one of the following: (1) application in preventing and controlling western flower thrips; (2) application in preventing and controlling plant pests caused by western flower thrips; (3) application in preparing biological pesticides for preventing and controlling western flower thrips.

7. A biological pesticide for controlling western flower thrips, characterized in that, The recombinant engineering bacteria of claim 2 or the sRNA of claim 3 or the crude extract of claim 4 is included.

8. A method of silencing a gene of Frankliniella occidentalis, characterized by, The step of contacting western flower thrips larvae and / or adults with the sRNA of claim 3 or the crude extract of claim 4 is included.

9. A method of controlling Frankliniella occidentalis, characterized by, The step of contacting western flower thrips larvae and / or adults with the sRNA of claim 3 or the crude extract of claim 4 is included.

Images