Application of MC5R gene in detecting growth traits in goats

By detecting the C519T site polymorphism in the CDS region of the MC5R gene, designing specific primer pairs, and applying PCR and SNaPshot techniques, the problems of accuracy and efficiency in goat growth trait detection were solved, enabling early selection and efficient breeding.

CN120366481BActive Publication Date: 2026-04-03HUAZHONG AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology for detecting growth traits in goats. Traditional breeding is time-consuming and costly, and the accuracy of selection is difficult to guarantee.

Method used

By utilizing the nucleotide sequence of the CDS region of the MC5R gene, especially the polymorphism at the C519T site, specific primer pairs were designed. Through PCR and SNaPshot detection techniques, CC and TT genotypes were identified to predict growth traits in goats, which can be applied to molecular marker-assisted selection breeding.

Benefits of technology

This enables early selection of growth traits in goats, shortens the breeding process, improves the accuracy and efficiency of breeding, and reduces dependence on environmental conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366481B_ABST
    Figure CN120366481B_ABST
Patent Text Reader

Abstract

This invention relates to the field of modern animal husbandry technology, and more particularly to the application of the MC5R gene in detecting growth traits in goats. The invention provides the application of the MC5R gene in detecting growth traits in goats. A molecular marker associated with goat growth traits exists at position 519 bp of the MC5R gene nucleotide sequence, with a polymorphism of C / T. When the genotype of the polymorphic site contained in the molecular marker is CC, it corresponds to a relative advantage in the growth trait of the goat being tested; when the genotype of the polymorphic site contained in the molecular marker is TT, it corresponds to a relative disadvantage in the growth trait of the goat being tested. The molecular marker provided by this invention can be applied to the identification or prediction of goat growth status, and can also be applied in the field of molecular breeding. Based on the analysis of goat genotypes, it can determine the genetic potential of goats for breeding and propagation. This invention has significant implications for modern goat animal husbandry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of modern animal husbandry technology, and in particular to the application of an MC5R gene in detecting growth traits in goats. Background Technology

[0002] With rapid economic development, people have increasingly higher demands for the nutritional value, taste, and flavor of meat products. This growing demand for high-quality meat products is driving the livestock industry towards higher efficiency and sustainability. Lamb is rich in protein, and its calcium, iron, and vitamin C content is higher than that of pork and beef, making it a premium meat choice. In contrast, goats have a shorter growth cycle and lower feeding costs. Therefore, researching how to improve the growth traits of goats through selective breeding is of great significance to both the goat industry and goat breeding research.

[0003] For animal breeding, traditional breeding methods are lengthy, costly, and difficult to guarantee in terms of selection accuracy. Molecular marker-assisted selection (MAS) technology combines animal genetics with sequencing technology, significantly shortening the breeding process. The MC5R (Melanocortin 5 Receptor) gene encodes melanocortin receptor 5, which is the latest discovered member of the melanocortin receptor family; therefore, research on MC5R is relatively limited compared to other receptors. Unlike MC3R and MC4R, which are mainly distributed in the central nervous system, MC5R is widely distributed in both central and peripheral tissues. Different expression locations within the body lead to variations in expression patterns and functions. Tissue expression profiling of the mouse MC5R gene revealed that its expression level in the hypothalamus was significantly lower than that of MC3R and MC4R, but significantly higher in peripheral tissues than other melanocortin receptors. This tissue-specific expression characteristic demonstrates the functional diversity of MC5R. Currently, there are no existing technologies for using the MC5R gene to detect growth traits in goats.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an application of the MC5R gene in detecting growth traits in goats.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides the application of the MC5R gene in detecting growth traits in goats, wherein the nucleotide sequence of the CDS region of the MC5R gene is shown in SEQ ID NO. 01.

[0008] Preferably, the growth traits include at least one of six-month-old body weight, body height, body length, and chest circumference.

[0009] More preferably, the growth traits include six-month-old body weight, body height, body length, and chest circumference.

[0010] Secondly, the present invention provides a molecular marker associated with goat growth traits, the molecular marker being located at 519 bp in the CDS region of the MC5R gene, with a polymorphism of C / T.

[0011] Preferably, the genotype of the polymorphic site contained in the molecular marker is CC, which corresponds to the relative advantage of the growth trait of the goat being tested.

[0012] Preferably, the genotype of the polymorphic site contained in the molecular marker is TT, which corresponds to a relative disadvantage in the growth traits of the goat being tested.

[0013] Preferably, the primer sequences for amplifying the molecular marker are shown in SEQ ID NO.02 and SEQ ID NO.03.

[0014] Thirdly, the present invention provides specific primer pairs for molecular markers related to goat growth traits.

[0015] Preferably, the primer sequences of the specific primer pair are shown in SEQ ID NO.02 and SEQ ID NO.03.

[0016] Fourthly, the present invention provides a reagent or kit for detecting growth traits in goats, the reagent or kit containing the specific primer pairs described in the preceding third aspect.

[0017] Fifthly, the present invention provides the use of the molecular marker, the specific primer pair, or the reagent or kit in at least one of the following:

[0018] (1) Application in identifying growth traits in goats;

[0019] (2) Application in predicting growth traits in goats;

[0020] (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

[0021] Sixthly, the present invention provides a molecular breeding method for high-quality goats, comprising:

[0022] (1) Extract total DNA from the goats to be tested;

[0023] (2) Using DNA as a template, detect the genotype of the molecular marker described in any one of claims 2-4;

[0024] (3) Analyze the genotype to determine the genetic potential of goats for breeding and propagation.

[0025] Preferably, step (3) includes: performing allele detection on the amplification product and determining the genotype based on the genotyping results: the genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait of the goat to be tested; and / or, the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait of the goat to be tested. Beneficial effects

[0026] This invention provides the application of the MC5R gene in detecting growth traits in goats. A molecular marker associated with goat growth traits exists at position 519 bp of the MC5R gene nucleotide sequence, with a polymorphism of C / T. When the genotype of the polymorphic site contained in the molecular marker is CC, it corresponds to a relative advantage in the growth trait of the goat being tested; when the genotype of the polymorphic site is TT, it corresponds to a relative disadvantage in the growth trait of the goat being tested. This molecular marker provided by this invention can be applied to the identification or prediction of goat growth status, and can also be applied in the field of molecular breeding. Based on the analysis of goat genotypes, it can determine the genetic potential of goats for breeding and propagation. This invention has significant implications for modern goat animal husbandry. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0028] Figure 1 This is an agarose gel electrophoresis pattern of the CDS region sequence fragment of the goat MC5R gene in Example 1.

[0029] Figure 2 This is a SnapGene software reading result of the C519T site in the CDS region of the goat MC5R gene in Example 1; Figure 2 In the diagram, A represents the CC genotype; B represents the CT genotype; and C represents the TT genotype. Detailed Implementation

[0030] This invention has discovered molecular markers in the goat MC5R gene that are associated with goat growth traits, providing a new molecular marker for goat growth trait detection or marker-assisted breeding.

[0031] Specifically, the technical solution of the present invention is as follows:

[0032] This invention first provides the application of single nucleotide polymorphism (SNP) at a goat SNP site or a substance for detecting SNP at a goat SNP site in the detection or auxiliary detection of the goat litter size trait, wherein the SNP site is a molecular marker of the C519T site in the CDS region of the goat MC5R gene.

[0033] The molecular marker of the C519T site is that there is a C>T base mutation at position 519 bp in the sequence shown in SEQ ID NO.01.

[0034] The single nucleotide polymorphisms at the above-mentioned SNP sites in this invention are related to the body weight, body height, body length, and chest circumference of goats at six months of age.

[0035] This invention does not limit the breed of goat, and can be selected from breeds such as Chubao Blackhead Goat, Macheng Black Goat, Boer Goat, Yichang White Goat and Matou Goat.

[0036] The present invention also provides a method for detecting the lambing number trait in goats, which detects the base type at the 519bp position in the sequence shown in SEQ ID NO.01 of goats. The CC genotype has significantly higher body weight, body height, body length, and chest circumference at six months of age than the TT genotype.

[0037] The present invention also provides substances for detecting single nucleotide polymorphisms at goat SNP sites, including PCR primers for amplifying genomic DNA fragments including the SNP sites or kits containing the primers.

[0038] The present invention also provides a molecular marker in the MC5R gene associated with the number of lambs born in goats, the nucleotide sequence of which is shown in SEQ ID NO.01, wherein there is a C>T base mutation at position 519 bp in SEQ ID NO.01.

[0039] The substances described above for detecting single nucleotide polymorphisms at goat SNP sites or molecular markers associated with goat growth traits can be used in goat genetic breeding to improve the growth traits of offspring goats.

[0040] This invention provides a genetic breeding method to increase the number of lambs born in goats. The method involves determining the single nucleotide polymorphism (SNP) at the aforementioned SNP site in the core goat population and making corresponding selections based on the SNP at the goat site: In the successive generation selection of breeding goats, individuals with the CC type at the 519 bp of the sequence shown in SEQ ID NO. 01 are selected, while TT and CT type individuals are eliminated. This process gradually increases the frequency of the CC gene at this site, thereby increasing the six-month-old weight, height, body length, and chest circumference of the offspring goats.

[0041] Based on the above-mentioned scheme provided by this invention, this invention has discovered molecular markers in the goat MC5R gene associated with litter size, wherein the molecular markers contain the C519T SNP site; the haplotypes composed of the above SNP sites can serve as molecular markers for goat growth traits. This invention has verified the effects of the above SNP molecular markers on the six-month-old body weight, body height, body length, and chest circumference of goats, and can be applied to the genetic improvement of breeding goats to increase litter size, thereby improving the growth performance of offspring and increasing the market competitiveness of breeding enterprises. This invention provides a new molecular marker for marker-assisted breeding of goat litter size traits, enabling early selection of goat growth traits and shortening the breeding process; the detection method is rapid, accurate, and unaffected by environmental factors.

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0043] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0044] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0045] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0046] The sequences involved in the following embodiments include:

[0047] SEQ ID NO.01:

[0048] ATGAACTCCTCATTCCACCTGCACTTCTGGGATCTTGGGCTGAACGCCACGGAAGGCAACCTCTCGGGACTGAGTGTGAGGAACGCGTCCTCACCATGTGAGGACATGGGCATTGCGGTGGAGGTGTTCCTGGCCCTGGGCCTCATCAGCCTGCTGGAGAACATCCTGGTCATCGGGGCCATTGTGAGGAATCGGAACCTGCACATCCCCATGTACTTCTTCATGGGCAGTTTGGCGGTGGCCGACATGTTGGTGAGCTTGTCCAACTTCTGGGAGACCATCACCATCTACCTGCTCACCAACAAGCACCTGGTGATGGCCGATGCCTCCGTGCGGCACCTGGACAATGTGTTCGACTCCATGATCTGCATCTCCGTGGTGGCCTCCATGTGCAGCCTGCTGGCCATTGCTGTGGACCGCTATGTCACCATCTTCTGCGCCCTGCGCTACCAGCGCATCATGACGGGGCGGCACTCGGGGGCCATCATCGCCGGCATCTGGGCCTTCTGCACCAGCTGCGGCACGGTCTTCATCGTGTACTACGAGTCCACATACGTGGTCGTCTGCCTCATCGCCATGTTCCTCACCATGCTGCTCCTCATGGCGTCTCTGTACACCCACATGTTCCTTCTGGCTCGAACCCATGTCCGGCGCATTGCCGCCCTGCCTGGGCACAGCTCTGTGTGGCAGAGGACTGGCGTGAAGGGCGCCATCACCCTGGCCATGCTGCTGGGCGTCTTCATCGTCTGCTGGGCCCCCTTCTTCCTCCACCTCATCCTGATGATTTCGTGTCCTCAGAACCTCTACTGCTCTTGCTTCATGTCTCACTTCAACATGTACCTCATCCTCATCATGTGTAACTCTGTGATTGACCCTCTGATATACGCCTTCCGCAGCCAAGAGATGCGGAAGACCTTTAAGGAGATTGTTTGTTTTCAGGGCTTCAGAACACCCTGTAGGTTCCCGAGCAGGTACTAA。

[0049] The sequence shown in SEQ ID NO.01 is the sequence information of the CDS region of the MC5R gene of Chubao black-headed sheep, which is the DNA sequence used as the molecular marker of this invention. At the 519th base of this sequence, there is an allele mutation, that is, the base "C" is mutated into the base "T". Example 1

[0050] Obtaining SNP fragments of the goat MC5R gene and establishing a method for detecting polymorphic sites.

[0051] 1. Extraction of goat genomic DNA:

[0052] The Chubao Blackhead Goat, a breed of meat goat improved from Macheng Black Goat, was selected as the experimental animal. Samples were obtained from the breeding farm of the Animal Husbandry and Veterinary Research Institute of the Hubei Academy of Agricultural Sciences. Whole-genome DNA was extracted from the goats using a blood genomic DNA extraction kit (manufactured by Beijing Tiangen Biotech Co., Ltd.), following the kit's instructions. The concentration and quality of the obtained genomic DNA were tested, labeled, and stored at -80℃ for later use.

[0053] 2. Obtaining SNP genetic marker fragments:

[0054] (1) PCR amplification:

[0055] Primers were designed based on the goat MCR genome sequence. The primer sequence information is as follows:

[0056] Upstream primer (SEQ ID NO.02):

[0057] ATGAACTCCTCATTCCACCTGCAC(5'→3');

[0058] Downstream primer (SEQ ID NO.03):

[0059] GTTCTGACTCCTCCTAACCCACT(5'→3').

[0060] The above primers were used to amplify the genomic DNA of Chubao black-headed sheep by PCR. The reaction system is shown in Table 1.

[0061] Table 1 PCR reaction system

[0062]

[0063] The PCR reaction program was set as follows: 98℃ pre-denaturation for 45 s; 98℃ denaturation for 10 s; annealing temperature set at 62℃ for 30 s; extension at 72℃ for 25 s; fixed cycle number, 34×; final extension at 72℃ for 5 min; 12℃ for 1 min. Agarose gel electrophoresis pattern of the MC5R gene CDS region sequence fragment is shown below. Figure 1 .

[0064] Store PCR amplification products at 4°C.

[0065] (2) Purification of PCR products:

[0066] The PCR products were purified using a gel extraction kit (Shanghai Sangon Biotech Co., Ltd.). For specific steps, please refer to the instruction manual.

[0067] 3. SNaPshot method for detecting molecular markers:

[0068] Design SNaPshot extension primers for the C519T site based on the goat MC3R gene genome sequence:

[0069] Add 5U SAP and 2U ExoI to 15μL of purified PCR product, vortex to mix, incubate at 37℃ for 1h, then incubate at 75℃ for 15min to inactivate SAP and ExoI enzymes; use the SNaPshot Multiplex Kit (Applied Biosystems) to aspirate 3μL of the treated 15μL PCR product for SNaPshot detection. The PCR reaction system is 10μL, containing 5μL Reaction Mix reagent, 3μL of PCR product treated with SAP and ExoI enzymes, 0.5μL each of extension primers, and 1μL of deionized water. The PCR amplification program is 96℃ denaturation for 10s, 50℃ annealing for 5s, 60℃ extension for 30s, 25 cycles, and storage at 4℃; dilute the SNaPshot product 20-fold in the following dilution system: Hi-Di Formamide 9.25μL, GS-120LIZ. 0.25 μL of SNaPshot product and 0.5 μL of sNaPshot product were added to the reaction system, which involved denaturation at 95 °C for 5 min followed by an ice bath for 4 min. A mixture containing 350 μL of Hi-Di formamide and 50 μL of Matrix standard was prepared, denatured at 95 °C for 5 min, and rapidly cooled for 5 min. The mixture was then divided into two equal tubes, aliquoted onto an instrument plate, and the 3730XL DNA Analyzer was spectrally calibrated. The prepared samples were then subjected to capillary electrophoresis using the 3730XL DNA Analyzer, and the signals were collected. Finally, the experimental results were analyzed using SnapGene software. The results are as follows: Figure 2 As shown. Example 2

[0070] The polymorphic distribution of the molecular markers prepared in this invention was detected in a goat population.

[0071] In this embodiment, the polymorphism at the 519 bp site in the CDS region of the goat MC3R gene was detected in a black-headed sheep population. The detection results are shown in Table 2.

[0072] Table 2. Genotype and gene frequencies of the C519T locus in the MC3R gene of goats.

[0073]

[0074] Table 2 shows that the C519T locus of the MC5R gene in goats exhibits three genotypes in the Chubao black-headed sheep population: CC, CT, and TT. The homozygous T genotype is the dominant genotype, with an allele frequency of 0.61. Chi-square test indicates that the genotype distribution at this locus conforms to Hardy-Weinberg equilibrium. Example 3

[0075] The present invention relates to the correlation analysis and application of molecular markers with lambing traits in goats.

[0076] To determine whether the SNPs in the CDS region of the MC3R gene in goats are related to their growth, 561 Chubao black-headed goats were selected as experimental materials. Sample collection and related lambing information were obtained from the breeding farm of the Animal Husbandry and Veterinary Research Institute of the Hubei Academy of Agricultural Sciences. Direct sequencing was used to detect the genotypes of different individuals, and the correlation between individuals with different genotypes and their lambing traits was analyzed. The GLM program in SAS statistical analysis software was used to perform association analysis between traits of different genotypes of molecular markers. The model used was:

[0077] Model 1: Y = Population mean + Genotype + Sheep farm environmental effect + Residual;

[0078] Model 2: Y = Population mean + Additive effect + Dominant effect + Sheep farm environmental effect + Residual.

[0079] Where Y represents the phenotypic value. Additive effect = (homozygote 1 - homozygote 2) / 2, with 1, 0, and -1 representing homozygote 1, heterozygote 1, and homozygote 2, respectively; dominant effect = heterozygote - (homozygote 1 + homozygote 2) / 2, with 1, -1, and 1 representing homozygote 1, heterozygote 1, and homozygote 2, respectively. The statistical analysis results are shown in Table 3.

[0080] Table 3 Association analysis of MC3R gene SNP sites with growth traits

[0081]

[0082] The association analysis of the MC5R gene SNP locus with the growth traits of Chubao black-headed goats at 3, 6, and 12 months of age using SAS 9.4 data analysis software is shown in Table 3. The MC5R gene C519T locus has three genotypes: CC, CT, and TT. The CC genotype showed significantly higher body weight, height, body length, and chest circumference at six months of age compared to the TT genotype (P<0.05). Therefore, screening for individuals with the CC genotype at the MC5R gene C519T locus in goats aims to obtain goats with better growth traits.

[0083] Finally, it should be noted that the above embodiments are merely preferred embodiments of the present invention, used to illustrate the technical solutions of the present invention, and not to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of molecular markers related to goat growth traits in the detection, identification, and prediction of goat growth traits, characterized in that, The molecular marker is located at 519 bp in the CDS region of the MC5R gene, with a polymorphism of C / T; the nucleotide sequence of the CDS region of the MC5R gene is shown in SEQ ID NO. 01; the growth traits include six-month-old body weight, six-month-old body height, six-month-old body length, and six-month-old chest circumference; the genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait in the tested goat; the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait in the tested goat.

2. The application according to claim 1, characterized in that, The primer sequences for amplifying the molecular markers are shown in SEQ ID NO.02 and SEQ ID NO.

03.

3. A molecular breeding method for high-quality goats, characterized in that, include: (1) Extract total DNA from the goats to be tested; (2) Using DNA as a template, detect the genotype of molecular markers; (3) Analyze the genotype to determine the genetic potential of goats for breeding and propagation; Wherein, the molecular marker in step (2) is located at 519 bp in the CDS region of the MC5R gene, and the polymorphism is C / T; the nucleotide sequence of the CDS region of the MC5R gene is shown in SEQ ID NO.01; the genotype of the polymorphic site contained in the molecular marker is CC, corresponding to the relative advantage of the growth trait of the goat to be tested; the genotype of the polymorphic site contained in the molecular marker is TT, corresponding to the relative disadvantage of the growth trait of the goat to be tested; the growth traits include six-month-old body weight, six-month-old body height, six-month-old body length, and six-month-old chest circumference; Step (3) includes: performing allele detection on the amplification products and making a determination based on the genotyping results.