Primer and probe composition for detecting mycobacterium tuberculosis and mycobacterium bovis and application of primer and probe composition

By designing specific primer and probe compositions and combining dual digital PCR technology, the problem of synchronous identification and precise quantification of Mycobacterium tuberculosis and Mycobacterium bovis is solved, achieving high sensitivity and high specificity detection effects.

CN120366487APending Publication Date: 2025-07-25CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510596670.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The prior art is difficult to achieve synchronous identification and precise quantification of Mycobacterium tuberculosis and Mycobacterium bovis in the prevention and control of tuberculosis, especially when the genomic homology is higher than 99.9%, there is a lack of effective dual identification and quantitative methods.

Method used

Design and use specific primer and probe compositions, including primers and probes with nucleotide sequences of SEQ ID NO.1 to 6, and combine dual digital PCR technology to distinguish M. tuberculosis and M. bovis through fluorescent reporter groups.

Benefits of technology

Synchronous identification and quantification of high sensitivity and high specificity are achieved, which significantly improves detection efficiency and accuracy. Compared with traditional PCR methods, detection sensitivity and amplification efficiency are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366487A_ABST
    Figure CN120366487A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological detection, in particular to a primer and probe composition for detecting mycobacterium tuberculosis and mycobacterium bovis and application of the primer and probe composition. The invention provides a primer and probe composition for detecting mycobacterium tuberculosis and mycobacterium bovis, and the primer and probe composition comprises a composition 1 for detecting the mycobacterium tuberculosis and a composition 2 for detecting the mycobacterium bovis, wherein the composition 1 for detecting mycobacterium tuberculosis comprises a primer and a probe with nucleotide sequences shown as SEQ ID NO.1-3; wherein the composition 2 for detecting the mycobacterium bovis comprises a primer and a probe which have nucleotide sequences as shown in SEQ ID NO.4-6. The primer and probe composition provided by the invention is high in detection sensitivity and strong in specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly relates to a primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis, and its application. Background Art

[0002] As a zoonosis that seriously threatens global public health, the prevention and control situation of tuberculosis remains severe. According to the latest data in the "Global Tuberculosis Report 2024" released by the World Health Organization, in 2023, the number of newly diagnosed tuberculosis cases globally was approximately 10.8 million, and the number of deaths was 1.25 million. This disease has once again become the leading cause of death from a single infectious disease globally. The pathogen causing tuberculosis is the Mycobacterium tuberculosis complex (MTBC), which includes nine members such as Mycobacterium tuberculosis and Mycobacterium bovis. The genomic similarity within MTBC members is as high as 99.97% - 99.99%. This closely related characteristic poses a huge challenge for pathogen identification. In the practice of tuberculosis prevention and control, achieving precise molecular-level identification and synchronous typing of Mycobacterium tuberculosis and Mycobacterium bovis in the early diagnosis and treatment stage is not only the scientific basis for formulating precise prevention and control strategies but also the key technical support for blocking the transmission chain and improving the screening efficiency.

[0003] In the current tuberculosis molecular diagnosis technology system, when dealing with pathogens such as Mycobacterium tuberculosis and Mycobacterium bovis with a genomic homology > 99.9%, it faces the dual technical bottlenecks of synchronous identification and precise quantification. Therefore, there is an urgent need for a dual identification method that can synchronously identify and precisely quantify. Summary of the Invention

[0004] The purpose of the present invention is to provide a primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis, which has high detection sensitivity and strong specificity.

[0005] To achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides a primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis, and the primer and probe composition includes Composition 1 for detecting Mycobacterium tuberculosis and Composition 2 for detecting Mycobacterium bovis;

[0007] The Composition 1 for detecting Mycobacterium tuberculosis includes: an upstream primer Rv1972-F with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer Rv1972-R with a nucleotide sequence as shown in SEQ ID NO.2, and a probe Rv1972-P with a nucleotide sequence as described in SEQ ID NO.3;

[0008] The composition 2 for detecting Mycobacterium bovis includes: an upstream primer ΔRD15-F with a nucleotide sequence as shown in SEQ ID NO.4, a downstream primer ΔRD15-R with a nucleotide sequence as shown in SEQ ID NO.5, and a probe ΔRD15-P with a nucleotide sequence as shown in SEQ ID NO.6.

[0009] Preferably, the 5'-end of the probe Rv1972-P is labeled with a FAM fluorophore, and the 3'-end is labeled with a BHQ1 quencher group;

[0010] The fluorophore labeled at the 5'-end of the probe ΔRD15-P is VIC, and the 3'-end is labeled with a BHQ1 quencher group.

[0011] The present invention also provides the application of the primer and probe composition in the preparation of a duplex digital PCR kit for detecting Mycobacterium tuberculosis and Mycobacterium bovis.

[0012] The present invention also provides a duplex digital PCR kit for detecting Mycobacterium tuberculosis and Mycobacterium bovis, and the duplex digital PCR kit includes the primer and probe composition.

[0013] Preferably, the initial concentration of each primer is independently 8 - 12 nM; the initial concentration of each probe is independently 8 - 12 nM.

[0014] The present invention also provides a method for detecting the content of Mycobacterium tuberculosis and Mycobacterium bovis for non-diagnostic and non-therapeutic purposes, including the following steps: using the DNA of the sample to be tested as a template, performing duplex digital PCR amplification with the primer and probe composition, and judging the strain type of the sample according to the positive result of the fluorescence reporter group;

[0015] The primer and probe composition is the primer and probe composition described above;

[0016] The judgment criteria are:

[0017] When the reporter fluorophore FAM is positive, the sample is judged to be Mycobacterium tuberculosis;

[0018] When the reporter fluorophore VIC is positive, the sample is judged to be Mycobacterium bovis.

[0019] Preferably, the amplification system for the dual digital PCR amplification is as follows: 10 - 12 μl of 2×dPCRprobe Master mix, 1.0 - 1.2 μl of Rv1972-F, 1.0 - 1.2 μl of Rv1972-R, 0.6 - 0.7 μl of Rv1972-P, 1.0 - 1.2 μl of △RD15-F, 1.0 - 1.2 μl of △RD15-R, 0.8 - 0.9 μl of △RD15-P, 0.5 - 1.5 μl of DNA template, and make up to 22 μl with water.

[0020] Preferably, the initial concentrations of Rv1972-F, Rv1972-R, Rv1972-P, △RD15-F, △RD15-R, and △RD15-P are independently 8 - 12 nM.

[0021] Preferably, the amplification program for the dual digital PCR amplification is as follows: 5 min at 60°C; 15 min at 95°C; 40 cycles of 20 s at 95°C and 30 s at 58°C.

[0022] Advantages of the present invention:

[0023] The present invention provides a primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis, which has high detection sensitivity and strong specificity; the present invention can distinguish and identify Mycobacterium tuberculosis and Mycobacterium bovis through a single dual digital PCR reaction, and has broad application prospects. Compared with fluorescence quantitative PCR and conventional PCR, the present invention significantly improves the detection sensitivity, amplification efficiency, and quantitative accuracy, providing a new technical path for the precise identification at the species level of MTBC. Description of the Drawings

[0024] Figure 1 It is a sensitivity result diagram of dual digital PCR for detecting Mycobacterium tuberculosis. Lane 1 has a concentration of 2×10 4 copies / μl, lane 2 has 2×10 3 copies / μl, lane 3 has 2×10 2 copies / μl, lane 4 has a concentration of 2×10 1 copies / μl, lane 5 has 2×10 0 copies / μl, and lane 6 is the negative control;

[0025] Figure 2 It is a sensitivity result diagram of dual digital PCR for detecting Mycobacterium bovis. Lane 1 has a concentration of 2×10 4 copies / μl, lane 2 has 2×10 3 copies / μl, lane 3 has 2×10 2copies / μl, lane 4 has a concentration of 2×10 1 copies / μl, lane 5 has a concentration of 2×10 0 copies / μl, lane 6 is the negative control;

[0026] Figure 3 is the result of linear analysis. Among them, Figure A is the linear curve of Mycobacterium tuberculosis duplex digital PCR, and Figure B is the linear curve of Mycobacterium bovis duplex digital PCR;

[0027] Figure 4 is the result of the specificity test. Among them, Figure A is the result diagram of detecting Mycobacterium tuberculosis by duplex digital PCR, and Figure B is the result diagram of detecting Mycobacterium bovis by duplex digital PCR; Lane 1 is Mycobacterium tuberculosis, lane 2 is Mycobacterium bovis, lane 3 is Staphylococcus aureus, lane 4 is Haemophilus parasuis, lane 5 is Pasteurella multocida, lane 6 is Salmonella, lane 7 is Escherichia coli, lane 8 is Brucella canis, lane 9 is Brucella suis, lane 10 is Ochrobactrum anthropi, lane 11 is Brucella abortus, lane 12 is Brucella melitensis, lane 13 is the negative control;

[0028] Figure 5 is the comparison diagram of the results of detecting Mycobacterium tuberculosis by duplex digital PCR using different primers and probes. Among them, Figure A is the primer and probe composition described in Example 1, Figure B is the primers and probes disclosed in Chinese Patent CN 102286627 B, and Figure C is the primers and probes disclosed in the National Standard of the People's Republic of China GB / T 27639-2011; Lane 1 has a concentration of 1×10 4 copies / μl, lane 2 has a concentration of 1×10 3 copies / μl, lane 3 has a concentration of 1×10 2 copies / μl, lane 4 is the negative control;

[0029] Figure 6 is the comparison diagram of the results of detecting Mycobacterium bovis by duplex digital PCR using different primers and probes. Among them, Figure A is the primer and probe composition described in Example 1, Figure B is the primers and probes disclosed in Chinese Patent CN 102286627 B, and Figure C is the primers and probes disclosed in the National Standard of the People's Republic of China GB / T 27639-2011. Lane 1 has a concentration of 5×10 3 copies / μl, lane 2 has a concentration of 5×10 2 copies / μl, lane 3 has a concentration of 5×10 1 copies / μl, lane 4 is the negative control;

[0030] Figure 7This is the correlation result graph of the dual digital PCR method and the dual fluorescence PCR method. Among them, Figure A is the correlation result graph of the dual digital PCR method and the dual fluorescence PCR method for detecting Mycobacterium tuberculosis, and Figure B is the correlation result graph of the dual digital PCR method and the dual fluorescence PCR method for detecting Mycobacterium bovis. Detailed implementation mode

[0031] The present invention provides a primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis. The primer and probe composition includes Composition 1 for detecting Mycobacterium tuberculosis and Composition 2 for detecting Mycobacterium bovis;

[0032] Composition 1 for detecting Mycobacterium tuberculosis includes: an upstream primer Rv1972-F with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer Rv1972-R with a nucleotide sequence as shown in SEQ ID NO.2, and a probe Rv1972-P with a nucleotide sequence as described in SEQ ID NO.3;

[0033] Composition 2 for detecting Mycobacterium bovis includes: an upstream primer △RD15-F with a nucleotide sequence as shown in SEQ ID NO.4, a downstream primer △RD15-R with a nucleotide sequence as shown in SEQ ID NO.5, and a probe △RD15-P with a nucleotide sequence as shown in SEQ ID NO.6;

[0034] SEQ ID NO.1 is: ATGTCGGTAGCAGTGGATTC,

[0035] SEQ ID NO.2 is: ATGACGCCGTATCGGAGATCGC,

[0036] SEQ ID NO.3 is: CGCCGACATGGATGGTT,

[0037] SEQ ID NO.4 is: TCACCGTGAACCAAAGCC,

[0038] SEQ ID NO.5 is: CTCGAACGCGGCCGATTCATTG,

[0039] SEQ ID NO.6 is: CGCCACTCGGTGATCTTG.

[0040] In the present invention, the 5' end of the probe Rv1972-P is labeled with a FAM fluorescent group, and the 3' end is labeled with a BHQ1 quenching group;

[0041] The 5'-end of the probe △RD15-P is labeled with a fluorescent group VIC, and the 3'-end is labeled with a quenching group BHQ1.

[0042] The present invention also provides the application of the primer and probe composition in the preparation of a dual digital PCR kit for detecting Mycobacterium tuberculosis and Mycobacterium bovis.

[0043] The present invention also provides a dual digital PCR kit for detecting Mycobacterium tuberculosis and Mycobacterium bovis, and the dual digital PCR kit includes the primer and probe composition.

[0044] In the present invention, the initial concentration of each primer is independently 8-12 nM, preferably 9-11 nM, and more preferably 10 nM; the initial concentration of each probe is independently 8-12 nM, preferably 9-11 nM, and more preferably 10 nM.

[0045] The present invention also provides a method for detecting the content of Mycobacterium tuberculosis and Mycobacterium bovis for non-diagnostic and non-therapeutic purposes, including the following steps: using the DNA of the sample to be tested as a template, performing dual digital PCR amplification with the primer and probe composition, and judging the strain type of the sample according to the positive result of the fluorescent reporter group;

[0046] The primer and probe composition is the primer and probe composition described above;

[0047] The judgment criteria are as follows:

[0048] When the reporter fluorescent group FAM is positive, it is judged that the sample is Mycobacterium tuberculosis;

[0049] When the reporter fluorescent group VIC is positive, it is judged that the sample is Mycobacterium bovis.

[0050] In the present invention, the amplification system for the dual digital PCR amplification is: 2×dPCR probe Master mix 10-12 μl, Rv1972-F 1.0-1.2 μl, Rv1972-R 1.0-1.2 μl, Rv1972-P 0.6-0.7 μl, △RD15-F 1.0-1.2 μl, △RD15-R 1.0-1.2 μl, △RD15-P 0.8-0.9 μl, DNA template 0.5-1.5 μl, and water is added to make up to 22 μl;

[0051] Preferably, it is 11 μl of 2×dPCRprobe Mastermix, 1.1 μl of Rv1972-F, 1.1 μl of Rv1972-R, 0.66 μl of Rv1972-P, 1.1 μl of △RD15-F, 1.1 μl of △RD15-R, 0.88 μl of △RD15-P, 1 μl of DNA template, and the volume is made up to 22 μl with water;

[0052] In the present invention, the initial concentrations of Rv1972-F, Rv1972-R, Rv1972-P, △RD15-F, △RD15-R, and △RD15-P are independently 8-12 nM, preferably 9-11 nM, and more preferably 10 nM.

[0053] In the present invention, the amplification program of the duplex digital PCR is: 5 min at 60°C; 15 min at 95°C; 40 cycles of 20 s at 95°C and 30 s at 58°C; wherein the heating and cooling rate is set at 2°C / s.

[0054] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] In the present invention, Mycobacterium tuberculosis, Mycobacterium bovis, Staphylococcus aureus, Haemophilus parasuis, Pasteurella multocida, Salmonella, Escherichia coli, Brucella canis, Brucella suis, Ochrobactrum anthropi, Brucella bovis, and Brucella melitensis described in the examples are all from the National Animal Tuberculosis Reference Laboratory.

[0056] Example 1 Design of Primers and Probes

[0057] Download the complete genome sequences of Mycobacterium tuberculosis H37Rv (ACCESSION: AL123456BX842572-BX842584) and Mycobacterium bovis AF2122 / 97 (ACCESSION: LT708304) from NCBI. Using the Rv1972 sequence (SEQ ID NO.7) of H37Rv RD15 and the BQ2027_MB1999 (100 bp) and BQ2027_MB2000 (300 bp) sequences (SEQ ID NO.8) of AF2122 / 97 △RD15 as reference sequences, design digital PCR primer and probe compositions: Rv1972-F, Rv1972-R, Rv1972-P, △RD15-F, △RD15-R, △RD15-P (Table 1).

[0058] Among them, SEQ ID NO.7 is: ATGTCGGTAGCAGTGGATTCCGACGCCGAGGATGACGCCGTATCGGAGATCGCTGAGGCAGCCGGCGTGTCGCCGGCCCCAGCCAAACCATCCATGTCGGCGCCGCGGCGCATGCTGCTGTTCGGCCTGGTCGTCGTCGTCGCTTTGGCGGTGCTGTTGTGTTGCTGGGGATTTCGCGTCCAGCGGGCACGCCATGCGCAGGACCAGCGTGGTCACTTCCTGCAAGCGGCCCGGCAGTGCGCGCTGAACCTAACGACCATCGACTGGCGCAACGCCGAGGCGGATGTGCGCCGCATTCTGGACGGCGCCACAGGCGAGTTTTACAACGACTTCGCCCAGCGGTCCCAGCCCTTCGTCGAAGTACTGAGGCACGCAAAGGCCAGCACGGTCGGCACGATCACCGAGGCCGGGCTGCAGACGCAGACCGCCGACACGGCCCAGGCGCTGGTGGCGGTGTCCGTGCAAACGTCGAATGCCGGCGAAGCCGACCCGGTTCCACGAGCGTGGCGAATGCGCATCACCGTGCAGCGGGTCGGCGACCGGGTCAAGGTGTCCGACGTCGGGTTCGTGCCGTGA;

[0059] SEQ ID NO.8 is: GGCGGTGATCTCGGGGTTTCTCTTCAACGTCTTGCTGACCGACATCGGTGCCGCGGACTTTTCCGGCACCGGCTGTGCGATCTTCACCGTGAACCAAAGCCGTGGGACGGGCAGCCTCGAACGCGGCCGATTCATTGGGCCGCAAGATCACCGAGTGGCGGCAGCCCTCGAAGTGACGGCCCCTCTGCTACGTAGCTAAGCACGCGCGACCGGCGGGCTGGGGAGCCCGGTCAGCGGTCTCATAGCATTGCGAACACGGGACGTCGAGAGGGGAAGAGCTGCCATGGGTGAGGCGAACATCCGCGAGCAGGCGATCGCCACGATGCCACGGGGTGGCCCCGACGCGTCTTGGCTGGATCGTCGATTCCAGACCGACGCACTGGAGTACCTCGACCGCGAC;

[0060] Table 1 Dual digital PCR primer and probe sequences

[0061]

[0062] Example 2 Sensitivity test

[0063] Use the bacterial genomic DNA extraction kit of Xi'an Tianlong Technology Co., Ltd. to extract the DNA of Mycobacterium tuberculosis and Mycobacterium bovis. The specific steps are as follows: Take 3 mL of the bacterial culture solution into a centrifuge tube, centrifuge at 10,000 rpm for 1 min, and discard the supernatant; Add 200 μl of cell digestion solution and 20 μl of proteinase K solution to Gram-negative bacteria; Add 180 μl of lysozyme solution and 20 μl of proteinase K solution to Gram-positive bacteria. After vortexing thoroughly, incubate in a water bath at 50 °C for more than 30 min. After the water bath, centrifuge briefly, and add 200 μl of cell digestion solution to the centrifuge tube; After mixing thoroughly, add it to the pre-packaged deep well plate, and use the GeneRotex96 nucleic acid extractor for automated extraction.

[0064] At concentrations of 2×10 4 copies / μl, 2×10 3 copies / μl, 2×10 2 copies / μl, 2×10 1 copies / μl, 2×10 0Using the DNA of Mycobacterium tuberculosis and Mycobacterium bovis at copies / μl as a template, and nuclease-free water as a negative control, double digital PCR amplification was performed using the primer and probe composition described in Example 1 (Sniper digital PCR all-in-one machine, purchased from Suzhou Snailfu Medical Technology Co., Ltd.). The judgment criteria are as follows: when the reporting fluorophore FAM is positive, the sample is judged to be Mycobacterium tuberculosis; when the reporting fluorophore VIC is positive, the sample is judged to be Mycobacterium bovis; the results are as Figures 1-2 shown,

[0065] Among them, the double digital PCR amplification system is: 2×dPCR probe Master mix 11 μl, Rv1972-F 1.1 μl, Rv1972-R 1.1 μl, Rv1972-P 0.66 μl, △RD15-F 1.1 μl, △RD15-R 1.1 μl, △RD15-P 0.88 μl, DNA template 1 μl, water 4.06 μl.

[0066] The initial concentrations of Rv1972-F, Rv1972-R, Rv1972-P, △RD15-F, △RD15-R, and △RD15-P are all 10 nM;

[0067] The amplification program is: 5 min at 60°C; 15 min at 95°C; 40 cycles of amplification with 20 s at 95°C and 30 s at 58°C; among them, the heating and cooling rate is set to 2°C / s.

[0068] The results show that the sensitivity for detecting Mycobacterium tuberculosis and Mycobacterium bovis can reach 2×10 0 copies / μl;

[0069] According to the detection result data of the sensitivity test, linear analysis was performed using Graphpad Pism 10.0 software. Taking the Log10 (theoretical copy number) of Mycobacterium tuberculosis and Mycobacterium bovis samples as the abscissa and the Log10 (actual detected copy number) as the ordinate, a standard curve was plotted, as Figure 3 shown;

[0070] The results show that the digital PCR linear regression equation for Mycobacterium tuberculosis is y = 1.0311x - 0.0227, and the coefficient R 2 = 0.9992; the digital PCR linear regression equation for Mycobacterium bovis is y = 0.9895x + 0.1798, and the coefficient R 2 = 0.9987, with good sensitivity and good linear relationships for both standard curves.

[0071] Example 3 Specificity Test

[0072] Extract the DNA of Mycobacterium tuberculosis, Mycobacterium bovis, Staphylococcus aureus, Haemophilus parasuis, Pasteurella multocida, Salmonella, Escherichia coli, Brucella canis, Brucella suis, Ochrobactrum anthropi, Brucella abortus, and Brucella melitensis using the method described in Example 2. Using 2×10 4 copies / μl of bacterial DNA as a template and nuclease-free water as a negative control, perform duplex digital PCR amplification using the primer and probe composition described in Example 1 (Sniper digital PCR machine, purchased from Suzhou Snail Healthcare Technology Co., Ltd.). The results are as Figure 4 shown;

[0073] The results show that only the templates of Mycobacterium tuberculosis and Mycobacterium bovis produce positive signals, and no positive droplets are generated for the remaining Staphylococcus aureus, Haemophilus parasuis, Pasteurella multocida, Salmonella, Escherichia coli, Brucella canis, Brucella suis, Ochrobactrum anthropi, Brucella abortus, and Brucella melitensis. Therefore, the primer and probe composition described in Example 1 has good specificity.

[0074] Example 4 Repeatability Test

[0075] By using 2×10 4 copies / μl, 2×10 3 copies / μl, and 2×10 2 copies / μl of Mycobacterium tuberculosis and Mycobacterium bovis DNA as templates, perform repeated tests using the detection method described in Example 2. The results are shown in Tables 2 - 3;

[0076] Table 2 Results of the repeatability test of duplex digital PCR for the detection of Mycobacterium tuberculosis

[0077]

[0078] Table 3 Results of the repeatability test of duplex digital PCR for the detection of Mycobacterium bovis

[0079]

[0080] The results show that the standard deviations of duplex digital PCR for the detection of Mycobacterium tuberculosis are 929.72, 53.30, and 8.05, respectively, and the coefficients of variation are 3.58%, 2.61%, and 5.34%, respectively. The standard deviations of duplex digital PCR for the detection of Mycobacterium bovis are 637.45, 76.62, and 14.20, respectively. The coefficients of variation are 2.69%, 3.77%, and 7.67%, respectively.

[0081] Example 5 Primer Comparison Test

[0082] Using a concentration of 1×10 4copies / μl, 1×10 3 copies / μl, 1×10 2 copies / μl of Mycobacterium tuberculosis DNA, 5×10 3 copies / μl, 5×10 2 copies / μl, 5×10 1 copies / μl of Mycobacterium bovis DNA as templates, nuclease-free water as negative control, respectively using the primer-probe composition described in Example 1, the primers and probes for detecting Mycobacterium tuberculosis and Mycobacterium bovis in Chinese Patent CN 102286627 B, and the primers and probes for detecting Mycobacterium tuberculosis and Mycobacterium bovis in the National Standard of the People's Republic of China GB / T27639-2011 for duplex digital PCR amplification. The results are as Figures 5-6 shown;

[0083] The results show that among the three groups of primer-probes, the primer-probe described in Example 1 has the most obvious dispersion between positive droplets and negative droplets, and the boundary between positive droplets and negative droplets is clear, which can accurately identify and distinguish positive and negative droplets and reduce the possibility of misjudgment.

[0084] Comparative test of detection methods in Example 6

[0085] Respectively use 2×10 4 copies / μl, 2×10 3 copies / μl, 2×10 2 copies / μl, 2×10 1 copies / μl, 2×10 0 copies / μl of Mycobacterium tuberculosis and Mycobacterium bovis DNA for duplex fluorescence PCR test, read and compared with the duplex digital PCR data, and the results are shown in Table 4; the correlation results between the duplex digital PCR method and the duplex fluorescence PCR method are as Figure 7 shown.

[0086] Among them, the duplex fluorescence PCR amplification system is: 2×Premix Ex Tag 10 μl, Rv1972-F 0.8 μl, Rv1972-R 0.8 μl, Rv1972-P 0.4 μl, △RD15-F 0.8 μl, △RD15-R 0.8 μl, △RD15-P 0.4 μl, DNA template 1 μl, water 5 μl.

[0087] The initial concentrations of Rv1972-F, Rv1972-R, Rv1972-P, △RD15-F, △RD15-R and △RD15-P are all 10 nM;

[0088] The amplification program was as follows: 95°C for 10 min; 94°C for 15 s, 60°C for 30 s, with 40 cycles of amplification.

[0089] Table 4 Comparison test results between the dual digital PCR method and the dual fluorescence PCR method

[0090]

[0091] The results showed that the dual digital PCR could still detect, but the dual fluorescence PCR could no longer detect. Therefore, the sensitivity of the dual digital PCR was 10 times higher than that of the dual fluorescence PCR; the correlation coefficients of the dual digital PCR method and the dual fluorescence PCR method were 0.9995 for Mycobacterium tuberculosis and 0.9973 for Mycobacterium bovis, indicating a positive correlation between the two methods.

[0092] Example 7 Detection of clinical samples

[0093] Ten positive clinical milk samples of tuberculosis preserved by the China Animal Health and Epidemiology Center were centrifuged at 14,000 rpm for 3 min to remove excess grease and liquid, and the precipitate was taken; the nucleic acid of the precipitate was extracted using the Tianlong bacterial genomic DNA extraction kit and the Tianlong automatic nucleic acid extractor, and the DNA solution was aspirated and stored at -20°C for a long time; using the DNA of the sample to be tested as a template, dual digital PCR amplification and dual fluorescence PCR amplification were carried out using the primer and probe composition described in Example 1, with the DNA of Mycobacterium tuberculosis and Mycobacterium bovis as positive controls and nuclease-free water as negative controls, and the detection results are shown in Table 5;

[0094] Table 5 Detection results of clinical samples

[0095] Detection method Mycobacterium tuberculosis Mycobacterium bovis Duplex digital PCR 2 / 10 8 / 10 Duplex fluorescence PCR 2 / 10 8 / 10 Coincidence rate 100% 100%

[0096] The results showed that the accuracy of the dual digital PCR detection using the primers and probes described in Example 1 was high.

[0097] As can be seen from the above examples, the present invention provides a primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis and its application. The primer and probe composition provided by the present invention has high detection sensitivity and strong specificity.

[0098] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A primer and probe composition for detecting Mycobacterium tuberculosis and Mycobacterium bovis, characterized in that, The primer and probe composition includes Composition 1 for detecting Mycobacterium tuberculosis and Composition 2 for detecting Mycobacterium bovis; Composition 1 for detecting Mycobacterium tuberculosis includes: upstream primer Rv1972-F with a nucleotide sequence as shown in SEQ ID NO.1, downstream primer Rv1972-R with a nucleotide sequence as shown in SEQ ID NO.2, and probe Rv1972-P with a nucleotide sequence as described in SEQ ID NO.3; Composition 2 for detecting Mycobacterium bovis includes: upstream primer △RD15-F with a nucleotide sequence as shown in SEQ ID NO.4, downstream primer △RD15-R with a nucleotide sequence as shown in SEQ ID NO.5, and probe △RD15-P with a nucleotide sequence as shown in SEQ ID NO.

6.

2. The primer and probe composition according to claim 1, characterized in that, The 5'-end of the probe Rv1972-P is labeled with a FAM fluorophore, and the 3'-end is labeled with a BHQ1 quencher; The 5'-end of the probe △RD15-P is labeled with a VIC fluorophore, and the 3'-end is labeled with a BHQ1 quencher.

3. Use of the primer and probe composition according to claim 1 or 2 in the preparation of a dual digital PCR kit for detecting Mycobacterium tuberculosis and Mycobacterium bovis.

4. A dual digital PCR kit for detecting Mycobacterium tuberculosis and Mycobacterium bovis, characterized in that, The dual digital PCR kit includes the primer and probe composition according to claim 1 or 2.

5. The kit according to claim 4, wherein The initial concentration of each primer is independently 8 - 12 nM; the initial concentration of each probe is independently 8 - 12 nM.

6. A method for detecting the content of Mycobacterium tuberculosis and Mycobacterium bovis for non-diagnostic and non-therapeutic purposes, characterized in that, It includes the following steps: using the DNA of the sample to be tested as a template, performing dual digital PCR amplification with the primer and probe composition, and judging the strain type of the sample according to the positive result of the fluorescent reporter group; The primer and probe composition is the primer and probe composition according to claim 1 or 2; The judgment criteria are as follows: When the reporter fluorophore FAM is positive, it is judged that the sample is Mycobacterium tuberculosis; When the reporter fluorophore VIC is positive, it is judged that the sample is Mycobacterium bovis.

7. The method according to claim 6, characterized in that The amplification system for the dual digital PCR amplification is: 2×dPCR probe Master mix 10 - 12 μl, Rv1972-F 1.0 - 1.2 μl, Rv1972-R 1.0 - 1.2 μl, Rv1972-P 0.6 - 0.7 μl, △RD15-F 1.0 - 1.2 μl, △RD15-R 1.0 - 1.2 μl, △RD15-P 0.8 - 0.9 μl, DNA template 0.5 - 1.5 μl, and water is added to make up to 22 μl.

8. The method according to claim 7, wherein The initial concentrations of Rv1972-F, Rv1972-R, Rv1972-P, △RD15-F, △RD15-R, and △RD15-P are independently 8 - 12 nM.

9. The method according to claim 8, wherein The amplification program for the dual digital PCR amplification: 5 min at 60°C; 15 min at 95°C; 40 cycles of 20 s at 95°C and 30 s at 58°C.

Citation Information

Patent Citations

  • Simultaneous identification method for mycobacterium bovis and human mycobacterium tuberculosis and reagent kit thereof

    CN102286627B