Primer group, kit and detection method for mink coronavirus detection

Abstract

The invention discloses a primer group, a kit and a detection method for detecting mink coronavirus, and belongs to the technical field of virus detection. According to the invention, 1b fragment and N fragment genome sequences of mink coronavirus are selected as target regions, and genome sequence conserved regions are selected for designing two groups of detection primers through multiple sequence alignment. Specific reaction conditions of the two groups of detection primers are respectively optimized, and the sensitivity of the two groups of detection primers is verified through experiments. 135 high-throughput sequencing positive samples are selected, the two sets of detection primers in the method are used for sample detection, and the result is consistent with the high-throughput sequencing result. The RT-qPCR detection method based on SYBR-Green disclosed by the invention can be used for detecting and quantifying the mink coronavirus.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and particularly relates to a primer set, a kit and a detection method for detecting mink coronavirus. Background Art

[0002] Mink coronavirus (MCoV) belongs to the Coronaviridae family and has a typical envelope structure. Its surface spike protein (S protein) can infect the host by binding to the host cell receptor, mainly causing digestive system diseases in minks. Especially for young minks, the morbidity rate is as high as 90%, and the clinical manifestations are severe diarrhea, vomiting, dehydration and a sharp drop in body weight. In a densely populated breeding environment, the virus contaminates the environment and feed through feces and spreads through the respiratory tract, causing serious economic losses to the mink breeding industry.

[0003] At present, the detection of mink coronavirus mainly relies on conventional methods. However, with the application of high-throughput sequencing technology, it is found that there are a large number of gene locus variations in the genomes of different strains, resulting in challenges to the sensitivity and specificity of existing detection methods and making it difficult to achieve accurate detection. In addition, existing detection technologies are only limited to qualitative analysis, and a reliable quantitative detection method has not been established, which cannot meet the needs of accurate assessment of virus load, dynamic monitoring of the epidemic situation and evaluation of prevention and control effects.

[0004] Therefore, there is an urgent need to develop a new detection method with sensitivity, specificity and quantitative analysis ability to solve the technical bottleneck in the current detection of mink coronavirus and provide key technical support for the prevention and control of diseases in the mink breeding industry. Summary of the Invention

[0005] The object of the present invention is to provide a primer set for detecting mink coronavirus, and the primer set includes: Primer MCoV-F-1b, whose nucleotide sequence is as shown in SEQ ID NO.1; Primer MCoV-R-1b, whose nucleotide sequence is as shown in SEQ ID NO.2; Primer MCoV-F-N, whose nucleotide sequence is as shown in SEQ ID NO.3; Primer MCoV-R-N, whose nucleotide sequence is as shown in SEQ ID NO.4.

[0006] The target product length of the 1b fragment detection primer set is 156bp, and the target product length of the N fragment detection primer set is 96bp.

[0007] The nucleotide sequence of the primer MCoV-F-1b is as shown in SEQ ID NO.1: 5’-GCCATGATATTAGGTTCAAAACACG-3’; The nucleotide sequence of the primer MCoV-R-1b is shown in SEQ ID NO. 2: 5’-AGTACCATCACCAGAAGTTGTACC-3’; The nucleotide sequence of the primer MCoV-F-N is shown in SEQ ID NO. 3: 5’-TCTAGCTCAAATGGGTTTTGCTC-3’; The nucleotide sequence of the primer MCoV-R-N is shown in SEQ ID NO. 4: 5’-AACAGGTCTTTCARTAGACTTAGCC-3’.

[0008] The second object of the present invention is to provide a detection kit, and the kit contains the above-mentioned detection primer set.

[0009] Furthermore, it contains an enzyme mixture containing SYBR Green, enzyme-free water, a positive control and a negative control. Among them, the enzyme mixture containing SYBR Green is purchased from Aikrui Biotechnology Co., Ltd., and its reagent model is AG11701.

[0010] The third object of the present invention is to provide a method for detecting mink coronavirus using the above primer set, including the following steps: (1) Design primers for the recombinant plasmid of the 1b fragment and N fragment of mink coronavirus to ensure that the recombinant plasmid primers can amplify the complete target gene.

[0011] (2) Perform PCR on the positive samples of mink coronavirus in the high-throughput sequencing results using the plasmid primers to amplify the complete target gene.

[0012] (3) Use agarose gel electrophoresis to determine that the fragment length conforms to the target gene length.

[0013] (4) Purify the PCR product in (2) whose fragment length is determined to conform to the target, and use the DiaSpin column PCR product purification kit to purify the PCR product; (5) Ligate the purified product in (4) with the vector; (6) Transform the ligation product into DH5α competent cells; (7) Pick monoclonal colonies and culture the small shaking bacterial solution in a shaker at 37°C overnight for 12 - 16 h; (8) Perform PCR identification on the bacterial solution, and send the positive bacterial solution to Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0014] (9) Extract the plasmid, measure the plasmid concentration, and store the plasmid in a refrigerator at -20°C for later use.

[0015] Furthermore, the primers for the 1b fragment recombinant plasmid in step (1) are P-1b-F and P-1b-R; the primers for the N fragment recombinant plasmid are P-N-F and P-N-R.

[0016] The nucleotide sequence of primer P-1b-F is shown in SEQ ID NO. 5: 5’-GATCGTGCATTGCCTAATATG-3’, and the nucleotide sequence of primer P-1b-R is shown in SEQ ID NO. 6: 5’-ACGCTGCAATGCTTTAACA-3’. The nucleotide sequence of primer P-N-F is shown in SEQ ID NO. 7: 5’-AGAAGCAACTCTAGGTCTAGG-3’, and the nucleotide sequence of primer P-N-R is shown in SEQ ID NO. 8: 5’-CAGTGTAATTCTCAGCTGTAGC-3’. The target length of the 1b fragment recombinant plasmid is 309bp, and the target length of the N fragment recombinant plasmid is 610bp; Furthermore, in step (2), the PCR reagent used is 2×Rapid Taq Master Mix from Novoprotein Scientific Inc. Furthermore, the DiaSpin column PCR product purification kit in step (4) is from Sangon Biotech (Shanghai) Co., Ltd. Furthermore, in step (5), the T-vector PCR product rapid ligation kit from Sangon Biotech (Shanghai) Co., Ltd. is used for vector ligation. Furthermore, the DH5α competent cells in step (6) are purchased from Tiangen Biotech (Beijing) Co., Ltd. Furthermore, the result of colony PCR identification in step (8) is as attached Figure 2 , and the sequencing result is consistent with the original sequence upon comparison. Furthermore, in step (9), the plasmid extraction uses the plasmid mini-prep kit from Tiangen Biotech (Beijing) Co., Ltd.

[0017] The third object of the present invention is to optimize the specific reaction conditions of SYBR-Green RT-qPCR for the RT-qPCR primer sets containing the 1b fragment and the N fragment, including primer concentration and annealing temperature.

[0018] The fourth object of the present invention is to conduct a sensitivity test on the two groups of RT-qPCR primers for the 1b fragment and the N fragment.

[0019] The fifth object of the present invention is to provide 2 kinds of RT-qPCR standard curves, including the RT-qPCR standard curve for the 1b fragment of mink coronavirus and the RT-qPCR standard curve for the N fragment.

[0020] Furthermore, the standard curve was established based on the detection results of 10-fold serial dilutions of the recombinant plasmid. The copy number of the plasmid standard was used as the abscissa, and the cycle number was used as the ordinate to plot the standard curve, and the correlation coefficient R was calculated. 2 And the standard curve equation. The RT-qPCR standard curve equation for the 1b fragment of mink coronavirus was y = -3.3328x + 39.43, R 2 = 0.9913; for the N fragment of mink coronavirus, the RT-qPCR standard curve equation was y = -3.4256x + 40.068, R 2 = 0.9982. R 2 Both are greater than 0.99, and the standard curves of RT-qPCR for the 1b fragment and the N fragment both have good linear relationships.

[0021] The sixth object of the present invention is to provide a method for detecting and quantifying mink coronavirus based on the 1b fragment primer and the standard curve, which includes the following steps: (1) Extract viral RNA from the sample; (2) Reverse transcribe the RNA into cDNA; (3) Perform SYBR-Green RT-qPCR using the cDNA as a template to obtain the CT value of the sample; (4) Substitute the CT value into the 1b fragment standard curve equation y = -3.3328x + 39.43 to calculate the virus copy number.

[0022] Furthermore, for the extraction of viral RNA in step (1), the total RNA extraction kit from Bioer Technology was used.

[0023] Furthermore, for the reverse transcription in step (2), the Evo M-MLV reverse transcription reagent premix from Aikerui Biotech was used. The reverse transcription system included: 4 μL of 5×Evo M-MLV RT Master Mix, 4 μL of RNA, and 12 μL of enzyme-free water. The reverse transcription reaction conditions were: 37 °C for 15 minutes, 85 °C for 5 seconds, and cycling at 4 °C.

[0024] Further, for the qPCR premix reagent in step (3), the SYBR Green ProTaq HS Premix qPCR kit from Aikerui Biotech Co., Ltd. is used. The reaction components include: 10 μL of 2×SYBR Green Pro Taq HS Premix, 0.8 μL of primer MCoV-F-1b (10 μM), 0.8 μL of primer MCoV-R-1b (10 μM), 2 μL of cDNA, and 6.4 μL of nuclease-free water. The qPCR reaction conditions are: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds, for 40 cycles; dissociation curve analysis (Dissociation Curve).

[0025] Further, when performing qPCR detection in step (3), each sample is subjected to 3 technical replicates. And a negative control is set, and the negative control is nuclease-free water.

[0026] Further, in step (3), the CT value of the sample takes the average of 3 replicates as the final result.

[0027] The seventh object of the present invention is to provide a method for detecting and quantifying mink coronavirus based on N fragment primers and a standard curve, comprising the following steps: (1) Extract the viral RNA in the sample; (2) Reverse transcribe the RNA into cDNA; (3) Perform SYBR-Green RT-qPCR using the cDNA as a template to obtain the CT value; (4) Substitute the CT value into the N fragment standard curve equation y = -3.4256x + 40.068 to calculate the viral copy number.

[0028] Further, for the extraction of viral RNA in step (1), the total RNA extraction kit from Bioer Technology Co., Ltd. is used; Further, for the reverse transcription reagent in step (2), the Evo M-MLV reverse transcription reagent premix from Aikerui Biotech Co., Ltd. is used. The reverse transcription system includes: 4 μL of 5×Evo M-MLV RT Master Mix, 4 μL of RNA, and 12 μL of nuclease-free water; the reverse transcription reaction conditions are: 37°C for 15 minutes, 85°C for 5 seconds, and cycling at 4°C.

[0029] Furthermore, the qPCR premix reagent in step (3) uses the SYBR Green ProTaq HS premixed qPCR kit from Aikrui Biotech Co., Ltd. The reaction components include: 10 μL of 2×SYBR Green Pro Taq HS Premix, 0.4 μL of primer MCoV-F-1b (10 μM), 0.4 μL of primer MCoV-R-1b (10 μM), 2 μL of cDNA, and 7.2 μL of enzyme-free water; the qPCR reaction conditions are: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds, for 40 cycles; dissociation curve analysis (Dissociation Curve); Furthermore, when performing qPCR detection in step (3), each sample is subjected to 3 technical replicates; and a negative control is set, with the negative control being enzyme-free water; Furthermore, in step (3), the CT value of the sample is taken as the final result with the average of 3 replicates. Description of the Drawings

[0030] Figure 1 is the electrophoresis diagram of the PCR amplification result of the target gene; Figure 2 is the electrophoresis diagram of the PCR amplification result of the bacterial solution; Figure 3 is the standard curve diagram of 1b fragment RT-qPCR; Figure 4 is the standard curve diagram of N fragment RT-qPCR; Figure 5 is the amplification curve diagram of the optimized primer concentration of the 1b fragment; Figure 6 is the amplification curve diagram of the optimized primer concentration of the N fragment; Figure 7 is the amplification curve diagram of the 1b fragment RT-qPCR at an annealing temperature of 58°C; Figure 8 is the amplification curve diagram of the 1b fragment RT-qPCR at an annealing temperature of 59°C; Figure 9 is the amplification curve diagram of the 1b fragment RT-qPCR at an annealing temperature of 60°C; Figure 10 is the amplification curve diagram of the 1b fragment RT-qPCR at an annealing temperature of 61°C; Figure 11 is the amplification curve diagram of the 1b fragment RT-qPCR at an annealing temperature of 62°C; Figure 12 is the amplification curve diagram of the N fragment RT-qPCR at an annealing temperature of 58°C; Figure 13It is the amplification curve graph of the annealing temperature of the N fragment RT-qPCR at 59°C; Figure 14 It is the amplification curve graph of the annealing temperature of the N fragment RT-qPCR at 60°C; Figure 15 It is the amplification curve graph of the annealing temperature of the N fragment RT-qPCR at 61°C; Figure 16 It is the amplification curve graph of the annealing temperature of the N fragment RT-qPCR at 62°C; Figure 17 It is the sensitivity amplification curve graph of the 1b fragment RT-qPCR; Figure 18 It is the sensitivity amplification curve graph of the N fragment RT-qPCR. Detailed implementation mode

[0031] The present invention is illustrated by the following examples.

[0032] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0033] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0034] Example 1 Design of primers for detecting the 1b fragment and N fragment of mink coronavirus and design of plasmid primers Download the existing full-length sequence of mink coronavirus (accession number PQ182544.1) from NCBI and compare it with the mink coronavirus sequence obtained from our previous high-throughput sequencing. Select a conserved region in the 1b fragment and N fragment respectively, and design primers based on it as the subsequent RT-qPCR detection primers. Design plasmid primers at the genomic positions outside both ends of the detection primers to ensure that the plasmid primers can amplify the complete target fragment. The primer sequences are shown in Table 1 below: Table 1: The nucleotide sequence of the conserved region of the 1b fragment is shown below: GATCGTGCATTGCCTAATATGATTAGAATGGCATCTGCCATGATATTAGGTTCAAAACACGTTGGATGTTGTACCCATAGTGACAGATTTTATCGGCTTTCTAACGAGTTGGCACAAGTTCTTACAGAGGTTGTACACTGTACAGGTGGTTTTTATATAAAACCTGGTGGTACAACTTCTGGTGATGGTACTACAGCTTATGCCAACTCTGCATTCAACATATTTCAGGCTGTTTCTGCAAATGTCAATAGACTTTTAAGTGTAGATTCTAACACCTGTAACAATTACAATGTTAAAGCATTGCAGCGT (SEQ ID NO.9).

[0035] The nucleotide sequence of the conserved region of the N fragment is shown below: AGAAGCAACTCTAGGTCTAGGTCTAGAGGAAGGTCTAAGTCTAACACAAGGTCTAATGATAATCAATCTTCAAGTCAAGATATAGCCACTGCTGTTGCTGCTGCTCTAGCTCAAATGGGTTTTGCTCCAAAAGAAACACAGAAGAATAAGTCTCGCTCTAAATCTAGAGATAGGGCTAAGTCTARTGAAAGACCTGTTCCTAAGAATGAAAACAAGCACTCATGGAAGAAAACACCTGGCAAAGGAGATGTTGAAACCATGTTTGGAAAACGCAGTGCCAATCATAATTTTGGTGATGCAGAATTAGTGAAGGATGGTAGTTCACATAAAAACTACCCTCAGTTGGCTGAAATGGTTCCTTCCACAGGTGCATTAGTGTTTGGTGGAAAGTGGGAAGCTACTGAGTCTGGTGATGATGTTATTGTCACTGTTAAYTACAGTTACAAACTACCAAAGAATGACCCTAAAACTACAGCTTTTGTTGGTCAGATTGGTGCATATRCCARACCTTCACAAGTGGCTAAAGAACAAAGATCTCGTTCTAAATCKCGYGAGAGATCAGCCACACCTGTGCCAACACCTGTGAGTGCTACAGCTGAGAATTACACTG (SEQ ID NO.10).

[0036] Example 2 Synthesis of Recombinant Plasmids of Two Fragments Select the mink coronavirus positive samples from the previous high-throughput sequencing and extract the viral RNA. Reverse transcribe the RNA into cDNA. Using the cDNA as a template, perform PCR with the plasmid primers of the two fragments respectively to amplify the target gene.

[0037] Furthermore, the components of the PCR reaction are: 25 μL of 2× Rapid Taq Master Mix, 2 μL of the upstream primer, 2 μL of the downstream primer, 2 μL of cDNA, and 19 μL of enzyme-free water. The amplification conditions are: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 15 seconds, 54°C for 15 seconds, 72°C for 15 seconds, for 32 cycles; final extension at 72°C for 5 minutes.

[0038] Perform agarose gel electrophoresis to determine that the size of the PCR product conforms to the length of the target gene. The electrophoresis results are asFigure 1 As shown, the sizes of the PCR products of the 1b fragment and the N fragment both conform to the length of the target gene. The length of the target gene of the 1b fragment is 309 bp, and the length of the target gene of the N fragment is 610 bp.

[0039] Use the DiaSpin column PCR product purification kit to purify the PCR product. The specific steps are as follows: (1) Add 3 volumes of buffer B3 to the PCR product and mix well by shaking. (2) Transfer the liquid to the adsorption column, centrifuge at 8000×g for 30 s, discard the liquid and retain the column. (3) Add 500 μL of washing solution to the column, centrifuge at 9000×g for 30 s, discard the liquid and retain the column. (4) Repeat the previous step once. (5) Place the column in a new collection tube and centrifuge it empty at 9000×g for 1 minute. (6) After empty centrifugation, place the column in a new centrifuge tube, pipette 30 μL of elution buffer onto the center of the adsorption membrane, let it stand at room temperature for 1 minute, and centrifuge at 9000×g for 1 minute.

[0040] Ligate the purified PCR product with the vector. The components of the ligation reaction are: 1 μL of T vector, 5 μL of 2× ligation buffer, 1 μL of 50% PEG 4000, 1 μL of T4 DNA ligase, and 2 μL of the target fragment. The reaction conditions are: ligate at 22 °C for 10 minutes.

[0041] Transform the ligation product into DH5α competent cells. The specific steps are as follows: Take a sterile 1.5 ml EP tube and add 50 μL of DH5α competent cells and 6 μL of the ligation product. (1) Incubate on ice for 30 minutes. (2) Heat shock at 42 °C for 90 s. (3) Incubate on ice again for 2 minutes. (4) Add 800 μl of LB liquid medium without resistance. (5) Culture in a shaker at 37 °C for 1.5 hours. (6) Centrifuge at 4000 rpm for 3 minutes and discard the supernatant. (7) Mix the remaining liquid at the bottom of the EP tube and spread it on the ampicillin-resistant plate, streak it in zones, and after spreading, incubate the plate upside down in the incubator for 12 to 16 hours.

[0042] Pick monoclonal colonies and shake the bacteria to amplify the plasmid. The specific steps are as follows: (1) Prepare shaking tubes, and add 3 ml of LB liquid medium with ampicillin resistance to each tube. (2)Use a 10 μL pipette tip to pick a monoclonal colony and transfer it together with the tip into a shaking culture tube. (3)Fix it with a rubber band and place it in a shaker at 37 °C for 12 to 16 hours.

[0043] Perform PCR identification on the bacterial solution. The electrophoresis results of the bacterial solution PCR identification are as Figure 2 shown. Send the positive bacterial solution to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. After the sequencing results are correctly aligned with the original sequence, extract the plasmid.

[0044] Use the plasmid miniprep kit from Tiangen Biotech Company for plasmid extraction. The specific steps are as follows: (1)Take 1 - 5 mL of overnight cultured bacterial solution and add it to a centrifuge tube. Centrifuge at 12,000 rpm for 1 minute and aspirate the supernatant as much as possible.

[0045] (2)Add 150 μL of Solution P1 to the centrifuge tube containing the bacterial cell pellet and use a pipette or vortex oscillator to thoroughly suspend the bacterial cell pellet.

[0046] (3)Add 150 μL of Solution P2 to the centrifuge tube and gently invert it 6 - 8 times to fully lyse the bacterial cells.

[0047] (4)Add 150 μL of Solution P4 to the centrifuge tube and immediately gently invert it 6 - 8 times to mix well. At this time, a white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 7 minutes, and a precipitate will form at the bottom of the centrifuge tube.

[0048] (5)Add 60 μL of endotoxin - removing solution ER to the filtrate and invert it up and down to mix well. The solution will show a uniform and transparent yellow color.

[0049] (6)Add 0.3 times the volume of isopropanol to the mixed solution, invert it up and down to mix well, and then transfer it to the adsorption column CP4.

[0050] (7)Centrifuge at 12,000 rpm for 1 minute at room temperature, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube.

[0051] (8)Add 600 μL of buffer ED to the adsorption column CP4, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube.

[0052] (9)Add 700 μL of wash buffer PW to the adsorption column CP4, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube.

[0053] (10)Repeat the previous step (11)Place the adsorption column back into the collection tube. Centrifuge at 12,000 rpm for 2 minutes to remove the residual wash buffer in the adsorption column.

[0054] (12) Place the adsorption column CP4 in a clean centrifuge tube, suspend and add 50 - 100 μL of wash buffer TB dropwise to the middle part of the adsorption membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12000 rpm for 1 minute to collect the plasmid solution into the centrifuge tube.

[0055] Example 3 Optimization of primer concentrations for the 1b fragment and N fragment in the SYBR-Green RT-qPCR reaction of mink coronavirus In the SYBR-Green RT-qPCR reaction, primer concentration optimization was carried out using four concentration gradients of 0.1 μmol / L, 0.2 μmol / L, 0.3 μmol / L, and 0.4 μmol / L. Using 10 7 copies / μL copy number of the standard plasmid containing the 1b gene sequence and the standard plasmid containing the N gene sequence were used as templates respectively. MCoV-F-1b and MCoV-R-1b were the detection primers for the 1b fragment, and MCoV-F-N and MCoV-R-N were the detection primers for the N fragment. The primer concentration with the minimum Ct value and the highest fluorescence intensity was taken as the optimal primer concentration. The specific operation steps were as follows: Add 10 μL of 2×SYBR Green Pro Taq HSPremix to the reaction tube, 2 μL of plasmid, and add 0.2 μL of upstream and downstream primers (10 μM) respectively under the condition of primer concentration of 0.1 μmol / L, add 0.4 μL of upstream and downstream primers (10 μM) respectively under the condition of primer concentration of 0.2 μmol / L, add 0.6 μL of upstream and downstream primers (10 μM) respectively under the condition of primer concentration of 0.3 μmol / L, add 0.8 μL of upstream and downstream primers (10 μM) respectively under the condition of primer concentration of 0.4 μmol / L, and finally supplement with enzyme-free water to a total reaction system of 20 μL. Each loading well was subjected to 3 technical replicates. The reaction conditions were: qPCR reaction conditions were: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds, for 40 cycles; dissociation curve analysis (Dissociation Curve).

[0056] The amplification results of the optimization of the RT-qPCR primer concentration for the 1b fragment are as Figure 5 shown. It can be seen that the optimal primer concentration for the RT-qPCR of the 1b fragment is 0.4 μmol / L. The amplification results of the optimization of the RT-qPCR primer concentration for the N fragment are as Figure 6 shown. It can be seen that the optimal primer concentration for the RT-qPCR of the N fragment is 0.2 μmol / L.

[0057] Example 4 Optimization of annealing temperature in the SYBR-Green RT-qPCR reaction of mink coronavirus Based on the optimization of primer concentration, the annealing temperature was optimized. In the SYBR-Green RT-qPCR reaction, five temperature gradients of 58°C, 59°C, 60°C, 61°C, and 62°C were used to optimize the annealing temperature. Using 10 7 copies / μL copy number of the standard plasmid containing the 1b gene sequence and the standard plasmid containing the N gene sequence were used as templates respectively. MCoV-F-1b and MCoV-R-1b were the primers for detecting the 1b fragment, and MCoV-F-N and MCoV-R-N were the primers for detecting the N fragment. The annealing temperature with the minimum Ct value and the highest fluorescence intensity was taken as the optimal annealing temperature. The specific operation steps were as follows: Add 10 μL of 2×SYBR Green Pro Taq HS Premix, 2 μL of plasmid, 0.8 μL of each upstream and downstream primer for the 1b fragment RT-qPCR reaction, 0.4 μL of each upstream and downstream primer for the N fragment RT-qPCR reaction, and finally add nuclease-free water to make up a total reaction system of 20 μL. Each sample well was subjected to 3 technical replicates. The reaction conditions were: qPCR reaction conditions were: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 58°C / 59°C / 60°C / 61°C / 62°C for 30 seconds, 40 cycles; dissociation curve analysis (DissociationCurve).

[0058] The amplification results of the annealing temperature optimization of the 1b fragment RT-qPCR are as shown in Figure 7 、 8 、9, 10, 11. It can be seen that the optimal annealing temperature of the 1b fragment RT-qPCR is 60°C. The amplification results of the annealing temperature optimization of the N fragment RT-qPCR are as shown in Figure 12 、 13 、14, 15, 16. It can be seen that the optimal annealing temperature of the N fragment RT-qPCR is 60°C.

[0059] The optimization results of the SYBR-Green RT-qPCR reaction conditions of mink coronavirus are shown in Table 2 below: Table 2: Example 5 Sensitivity test of 1b fragment and N fragment RT-qPCR The concentration of the recombinant plasmid was detected by a NanoDrop 2000 ultraviolet spectrophotometer. The concentration of the 1b fragment recombinant plasmid was 60.7 ng / μL, and the concentration of the N fragment recombinant plasmid was 86.2 ng / μL.

[0060] The calculation formula for the copy number concentration is as follows: Recombinant plasmid copy number (copies / μL) = (plasmid DNA concentration (ng / μL) × 6.02×1023 ) / (number of bases of recombinant plasmid × 660) Calculated, the copy number of the recombinant plasmid of the 1b fragment is 1.79 × 10 11 copies / μL, and the concentration of the recombinant plasmid of the N fragment is 1.29 × 10 11 copies / μL. The recombinant plasmids of the 1b and N fragments of mink coronavirus were respectively diluted 10-fold in a serial dilution (10 11 -10 1 copies / μL), and RT-qPCR was performed using the recombinant plasmids at each dilution as templates to observe the sensitivity of the RT-qPCR detection methods for the 1b and N fragments of mink coronavirus.

[0061] As Figure 17 shown, the RT-qPCR for the 1b fragment of mink coronavirus can detect 1.79 × 10 1 copies / μL; as Figure 18 shown, the RT-qPCR for the N fragment of mink coronavirus can detect 1.29 × 10 1 copies / μL. It shows that the RT-qPCR detection sensitivity for the 1b and N fragments of mink coronavirus is relatively high.

[0062] Example 6 Establishment of the RT-qPCR standard curve for the 1b fragment The recombinant plasmid of the 1b fragment of mink coronavirus was diluted 10-fold in a serial dilution, and with 1.79×10 10 copies / μL, 1.79× 10 9 copies / μL, 1.79×10 8 copies / μL, 1.79×10 7 copies / μL, 1.79×10 6 copies / μL, 1.79×10 5 copies / μL, 1.79 × 10 4 copies / μL, 1.79 × 10 3 copies / μL, 1.79 ×10 2The recombinant plasmids at nine dilution ratios of copies / μL were used as templates. The reaction components were: 10 μL of 2×SYBR Green ProTaq HS Premix, 2 μL of recombinant plasmid, 0.8 μL of upstream primer MCoV-F-1b, 0.8 μL of downstream primer MCoV-R-1b, and 6.4 μL of enzyme-free water. The reaction conditions were: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds, for 40 cycles; dissociation curve analysis. Each sample was subjected to 3 technical replicates. Based on the detection results at each dilution ratio, with the copy number of the plasmid standard as the abscissa and the CT value as the ordinate, a standard curve was plotted as shown in Figure 3 , y = -3.3328x +39.43, R 2 = 0.9913.

[0063] Example 7 Establishment of the RT-qPCR Standard Curve for the N Fragment The recombinant plasmid of the N fragment of the mink coronavirus was serially diluted 10-fold. Using 1.29×10 10 copies / μL, 1.29×10 9 copies / μL, 1.29×10 8 copies / μL, 1.29×10 7 copies / μL, 1.29×10 6 copies / μL, 1.29×10 5 copies / μL, 1.29×10 4 copies / μL, 1.29×10 3 copies / μL, 1.29×10 2 copies / μL of the recombinant plasmids at nine dilution ratios as templates, the reaction components were: 10 μL of 2×SYBR Green Pro Taq HS Premix, 2 μL of recombinant plasmid, 0.4 μL of upstream primer MCoV-F-N, 0.4 μL of downstream primer MCoV-R-N, and 7.2 μL of enzyme-free water. The reaction conditions were: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 5 seconds, 60°C for 30 seconds, for 40 cycles; dissociation curve analysis. Each sample was subjected to 3 technical replicates. Based on the detection results at each dilution ratio, with the copy number of the plasmid standard as the abscissa and the CT value as the ordinate, a standard curve was plotted as shown in Figure 4 , y = -3.4256x +40.068, R 2 = 0.9982.

[0064] R2 > 0.99, and the standard curves of RT-qPCR for both the 1b fragment and the N fragment have good linear relationships.

[0065] Example 8 Identification of Mink Coronavirus Positive Samples in High-Throughput Sequencing Results by RT-qPCR Select 135 high-throughput sequencing positive samples, and use the 1b fragment detection primers MCoV-F-1b, MCoV-R-1b and the reaction components and reaction conditions in Example 6 for detection. At the same time, use the N fragment detection primers MCoV-F-N, MCoV-R-N and the reaction components and reaction conditions in Example 7 for detection. The results show that all 135 samples are positive under the detection of the two groups of primers for the 1b fragment and the N fragment, which is consistent with the high-throughput sequencing results. It shows that the two groups of detection primers in the present invention have a high positive detection rate and good detection effect.

Claims

1. A primer set for detecting mink coronavirus, characterized in that, The primer set includes: Primer MCoV-F-1b, whose nucleotide sequence is as shown in SEQ ID NO.1; Primer MCoV-R-1b, whose nucleotide sequence is as shown in SEQ ID NO.2; Primer MCoV-F-N, whose nucleotide sequence is as shown in SEQ ID NO.3; Primer MCoV-R-N, whose nucleotide sequence is as shown in SEQ ID NO.

4.

2. A detection kit, characterized in that, The kit contains the detection primer set described in claim 1.

3. The kit according to claim 2, wherein The kit further includes: an enzyme mixture containing SYBR Green, enzyme-free water, a positive control, and a negative control.

4. A method for detecting mink coronavirus using the primer set according to claim 1, characterized in that, It includes the following steps: (1) Extract the RNA of mink coronavirus and perform reverse transcription to synthesize cDNA; (2) Obtain the target genes of the 1b fragment and N fragment of mink coronavirus by PCR amplification and construct recombinant plasmids respectively; (3) For the detection results of 10-fold serial dilution of the recombinant plasmids, with the copy number of plasmid standard as the abscissa and the CT value as the ordinate, draw the RT-qPCR standard curves of the 1b fragment and N fragment; (4) Detect the sample to be tested to obtain the CT value, substitute the CT value into the corresponding standard curve equation, and calculate the specific copy number of mink coronavirus in the sample.

5. The method according to claim 4, characterized in that The specific steps for constructing the recombinant plasmid in step (2) are as follows: (1) Perform PCR amplification with the primers for the recombinant plasmids of the 1b fragment and N fragment to obtain the complete target genes of the 1b fragment and N fragment; The primers for the recombinant plasmid of the 1b fragment are primer P-1b-F and primer P-1b-R, and the primers for the recombinant plasmid of the N fragment are primer P-N-F and primer P-N-R; The nucleotide sequence of the primer P-1b-F is as shown in SEQ ID NO.5; The nucleotide sequence of the primer P-1b-R is as shown in SEQ ID NO.6; The nucleotide sequence of the primer P-N-F is as shown in SEQ ID NO.7; The nucleotide sequence of the primer P-N-R is as shown in SEQ ID NO.8; (2) Purify the PCR product; (3) Ligate the purified product with the vector; (4) Transform the ligation product into DH5α competent cells and screen for positive clones.

6. The method according to claim 4, wherein The primer concentration is: 0.1 μmol / L - 0.4 μmol / L, and the annealing temperature is: 58°C - 62°C.

7. The method according to claim 4, wherein The steps for establishing the RT-qPCR standard curve in step (3) are as follows: (1) serially dilute the recombinant plasmid 10-fold to 10 10 , 10 9 , 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 ; (2) Perform RT-qPCR detection with each dilution of the plasmid as the template and record the corresponding CT value; (3) With the copy number of plasmid standard as the abscissa and the CT value as the ordinate, draw the standard curve.

Images