Anti-FAP single-domain antibody, Fc fusion protein, immunoconjugate and application thereof

Abstract

The invention discloses an anti-FAP single-domain antibody, an Fc fusion protein, an immunoconjugate and application of the anti-FAP single-domain antibody and the Fc fusion protein. According to the invention, an anti-FAP antigen specific single-domain antibody library is constructed, high-specificity and high-activity anti-FAP single-domain antibodies F80-3C4 and F80-4G3 are screened from the anti-FAP antigen specific single-domain antibody library, the amino acid sequence of the single-domain antibody F80-3C4 is shown as SEQ ID NO.4, and the amino acid sequence of the single-domain antibody F80-4G3 is shown as SEQ ID NO.9. The method comprises the following steps: further fusing a single-domain antibody with an Fc protein to obtain an Fc fusion protein; in addition, the immunoconjugate is obtained by conjugating the single-domain antibody and the Fc fusion protein with a functional molecule. The anti-FAP single-domain antibody, the Fc fusion protein and the immunoconjugate provided by the invention can effectively inhibit the growth of tumors, and can also be applied to preparation of drugs for immunizing FAP-related diseases including treatment of tumors or reagents for diagnosing tumors.

Description

[0001] This invention patent application is a divisional application of the invention patent application with the application number "202110701457.5", the application date of "June 23, 2021", and the invention title of "Anti-FAP single-domain antibody, Fc fusion protein, immunoconjugate and their applications". Technical Field

[0002] The present invention relates to single-domain antibodies, in particular to anti-FAP single-domain antibodies, Fc fusion proteins constructed with such single-domain antibodies and Fc proteins, immunoconjugates, and their applications in the diagnosis or treatment of tumors, belonging to the field of anti-FAP single-domain antibodies and their applications. Background Art

[0003] Fibroblast Activation Protein (FAP) exists in tumor stromal fibroblasts and acts on the cell surface. It is a membrane serine peptidase and a member of the type II serine protease family, having dipeptidyl peptidase and collagenase activities, and having dual functions in tumor growth. The proteolytic enzyme activity of FAP can enhance the invasiveness of tumor cells to the extracellular matrix, and can also promote tumor growth and proliferation. Therefore, molecular imaging targeting FAP, as well as pathological diagnosis as a tumor stromal marker, tumor gene therapy or immunotherapy, will become possible.

[0004] Active FAP is a 170 kDa homodimer, including two N-terminal glycosylated subunits of 97 kDa. It is a type II transmembrane glycoprotein with a large C-terminal extracellular region. FAP has 5 potential N-glycosylation sites, 13 cysteine residues, 3 highly conserved serine protease catalytic regions, a hydrophobic transmembrane fragment and a small cytoplasmic tail region (6 amino acids). FAP is expressed in the cell membranes and cytoplasm of stromal fibroblasts of more than 90% of epithelial tumors, including colon cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer. It can also transiently stay in some normal fetal mesenchymal tissues, continuously exist in the activated stroma of epithelial tumors and some sarcomas, and can also be expressed in gastric cancer stroma, some bone and soft tissue sarcoma cells, granulation tissue of wound healing, damaged stroma of idiopathic pulmonary fibrosis, pancreatic cells, and prostate cancer. FAP-positive cells are close to the endothelial cells of tumor capillaries and surround tumor nodules, but are usually not expressed in normal adult tissues, benign and pre-cancerous epithelial lesions.

[0005] Studies suggest that FAP has a tumor growth promoting effect. Experiments on human breast cancer cell lines of FAP by Goodman et al. showed that the cell lines (MDA-MB-435 and MDA-MB-436) normally expressed FAP. Breast cancer cells with high FAP expression were less dependent on exogenous serum growth factors and could obtain independence from normal growth regulation. Independence from normal growth regulation is an important feature distinguishing malignant cells from normal cells. The research group led by Huang et al. demonstrated that the human breast cancer cell line MDA-MB-231 lacked normal expression, and the tumor growth of the high-expression mouse tumor model was faster and had more blood vessels. It was also found that the growth rate of cells expressing FAP was the same as that of cells not expressing FAP. This indicates that FAP can only significantly promote tumor growth in the microenvironment of the mammary fat pad in vivo. This study first demonstrated the angiogenic function of FAP, that is, FAP at least partially promotes angiogenesis in breast cancer. These findings suggest that FAP expression is beneficial to altering the microenvironment of breast cancer cells. Prior art also found that when neovascularization occurred in the rat cornea, many biochemical factors in the corneal stroma changed. FAP corneal cells appeared in the stroma, and these newly emerged cells grew together with the endothelial cells of the new blood vessels, which again demonstrated the vascular function of FAP.

[0006] Nowadays, the large molecular weight of antibody drugs is considered one of the main factors preventing them from exerting their drug effects. To improve the penetration of antibodies into tumors, people now mostly genetically modify the antibody form to make its molecular weight smaller or only retain its scFV structure. Single-chain fragments (single-chain antibodies) are usually quickly cleared from the blood circulation, mostly due to their low molecular weight (molecular weight < 60 kDa, glomerular filtration threshold). Therefore, the serum half-life of single-chain antibodies is usually less than 10 minutes. So the overall performance of these molecules is still not optimal. In addition, most antibody fragments of smaller size lack the complete fragment crystallizable (Fc) domain and thus cannot induce antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC), the two main mechanisms involved in eliminating tumor tissue after antigen binding.

[0007] In 1993, Hamers-Casterman et al. from the Free University of Brussels first reported that in camel blood, in addition to the traditional IgG antibodies, there is another type of antibody. Different from the molecular structure of the traditional mammalian antibody IgG, this antibody lacks both the light chain of the traditional antibody and the CH1 region of the heavy chain constant region, and is called heavy chain antibody (HcAb). The variable region of the heavy chain antibody is composed of the variable region of the antibody heavy chain, which is similar to the Fab of the traditional antibody. This variable region can specifically bind to antigens, so the heavy chain antibody can exert the same efficacy as the traditional antibody. The smallest unit antigen-binding fragment containing only a single domain is called single-domain antibody (sdAbs). Single-domain antibodies usually consist of only 110 - 130 amino acids, with a molecular weight of only 12 - 15 kDa, which is much smaller than the traditional macromolecular antibody (150 - 160 kDa) and its Fab fragment (about 50 kDa), but can have a specific antigen affinity similar to or higher than that of the traditional antibody. The inherent characteristics of single-domain antibodies, such as small molecular weight, stable physical and chemical properties, high affinity, and easy recombinant expression and preparation, have attracted much attention since their discovery.

[0008] Although single-domain antibodies provide a new breakthrough for antibody research, there are still some problems. For example, the half-life of single-domain antibodies is short. Although it is suitable for molecular imaging, if used as a drug for treatment, it may lead to premature systemic metabolism.

[0009] The deletion of FAP indirectly inhibits the proliferation of tumor cells, accelerates the accumulation of collagen, reduces the myofibroblast component, and decreases the intratumoral vascular density. Therefore, FAP is an important target for tumor targeted therapy. If a highly specific anti-FAP single-domain antibody is obtained, it can effectively inhibit tumor growth by targeting and blocking the stromal and vascular supply of the tumor. Summary of the Invention

[0010] One of the objectives of the present invention is to provide a group of anti-FAP single-domain antibodies and their encoding genes;

[0011] Another objective of the present invention is to provide an Fc fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein and its encoding gene;

[0012] A third objective of the present invention is to provide an immunoconjugate obtained by conjugating the anti-FAP single-domain antibody described above with a functional molecule, or an immunoconjugate obtained by conjugating the Fc fusion protein described above with a functional molecule;

[0013] A fourth objective of the present invention is to provide the application of the anti-FAP single-domain antibody, Fc fusion protein, and immunoconjugate described above in the preparation of reagents or drugs for detecting or treating tumors.

[0014] The present invention first provides anti-FAP single-domain antibodies, and the anti-FAP single-domain antibodies are single-domain antibody F80-3C4 or single-domain antibody F80-4G3; wherein, the amino acid sequence of single-domain antibody F80-3C4 includes three complementary determining regions, and the amino acid sequences of the three complementary determining regions are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively;

[0015] As a preferred specific embodiment of the present invention, the amino acid sequence of single-domain antibody F80-3C4 is selected from any one of the amino acid sequences in (1)-(3): (1) the amino acid sequence shown as SEQ ID NO.4; or (2) a protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown as SEQ ID NO.4, and this protein mutant has the same function as the protein before mutation; or (3) an amino acid sequence having at least 75% identity with the amino acid sequence shown as SEQ ID NO.4.

[0016] The amino acid sequence of single-domain antibody F80-4G3 includes three complementary determining regions, and the amino acid sequences of the three complementary determining regions are shown as SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 respectively.

[0017] As a preferred specific embodiment of the present invention, the amino acid sequence of single-domain antibody F80-4G3 is selected from any one of the amino acid sequences in (1)-(3): (1) the amino acid sequence shown as SEQ ID NO.9; or (2) a protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown as SEQ ID NO.9, and this protein mutant has the same function as the protein before mutation; or (3) an amino acid sequence having at least 75% identity with the amino acid sequence shown as SEQ ID NO.9.

[0018] The present invention further provides the coding gene of the single-domain antibody, wherein, the nucleotide sequence of the coding gene of single-domain antibody F80-3C4 is selected from any one of (1)-(3):

[0019] (1) The polynucleotide sequence shown in SEQ ID NO.5; or (2) A polynucleotide sequence that can hybridize with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.5 under stringent hybridization conditions; or (3) A polynucleotide sequence having at least 75% identity or more with the polynucleotide sequence shown in SEQ ID NO.5; preferably, a polynucleotide sequence having at least 80% identity or more with the polynucleotide sequence shown in SEQ ID NO.5; more preferably, a polynucleotide sequence having at least 85% identity or more with the polynucleotide sequence shown in SEQ ID NO.5; even more preferably, a polynucleotide sequence having at least 95% identity or more with the polynucleotide sequence shown in SEQ ID NO.5; most preferably, a polynucleotide sequence having 99% identity or more with the polynucleotide sequence shown in SEQ ID NO.5;

[0020] The nucleotide sequence of the encoding gene of the single domain antibody F80-4G3 is selected from any one of (1)-(3) below:

[0021] (1) The polynucleotide sequence shown in SEQ ID NO.10; or (2) A polynucleotide sequence that can hybridize with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.10 under stringent hybridization conditions; or (3) A polynucleotide sequence having at least 75% identity or more with the polynucleotide sequence shown in SEQ ID NO.10; preferably, a polynucleotide sequence having at least 80% identity or more with the polynucleotide sequence shown in SEQ ID NO.10; more preferably, a polynucleotide sequence having at least 85% identity or more with the polynucleotide sequence shown in SEQ ID NO.10; even more preferably, a polynucleotide sequence having at least 95% identity or more with the polynucleotide sequence shown in SEQ ID NO.10; most preferably, a polynucleotide sequence having 99% identity or more with the polynucleotide sequence shown in SEQ ID NO.10.

[0022] The present invention further provides an Fc fusion protein obtained by fusing the anti-FAP single domain antibody described above with Fc; wherein, the Fc gene sequence can be an Fc gene sequence derived from IgG, IgA, IgM or from human IgG1, IgG2, IgG3 or IgG4.

[0023] As a preferred specific embodiment of the present invention, the amino acid sequence of the fusion protein obtained by fusing the anti-FAP single domain antibody F80-3C4 with Fc is selected from any one of the following amino acid sequences (1)-(3):

[0024] (1) The amino acid sequence shown in SEQ ID NO.11; (2) A protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.11, and this protein mutant has the same function as the protein before mutation; (3) An amino acid sequence having at least 75% identity with the amino acid sequence shown in SEQ ID NO.11.

[0025] As a preferred specific embodiment of the present invention, the amino acid sequence of the fusion protein obtained by fusing the anti-FAP single domain antibody F80-4G3 with Fc is selected from any one of the following amino acid sequences (1)-(3):

[0026] (1) The amino acid sequence shown in SEQ ID NO.13; (2) A protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.13, and this protein mutant has the same function as the protein before mutation; (3) An amino acid sequence having at least 75% identity with the amino acid sequence shown in SEQ ID NO.13.

[0027] The present invention also provides the coding gene of the Fc fusion protein.

[0028] As a preferred specific embodiment of the present invention, the nucleotide sequence of the coding gene of the fusion protein obtained by fusing the anti-FAP single domain antibody F80-3C4 with Fc is selected from any one of (1)-(3):

[0029] (1) The polynucleotide sequence shown in SEQ ID NO.12;

[0030] Or (2) A polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.12 under stringent hybridization conditions;

[0031] Or (3) A polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO.12; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO.12; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO.12; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO.12; most preferably, a polynucleotide sequence having at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.12.

[0032] As a preferred specific embodiment of the present invention, the nucleotide sequence of the coding gene of the fusion protein obtained by fusing the anti-FAP single-domain antibody F80-4G3 with Fc is selected from any one of (1)-(3):

[0033] (1) The polynucleotide sequence shown in SEQ ID NO.14;

[0034] Or (2) a polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.14 under stringent hybridization conditions;

[0035] Or (3) a polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO.14; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO.14; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO.14; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO.14; most preferably, a polynucleotide sequence having at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.14.

[0036] The present invention also provides an expression vector containing the coding gene of the single-domain antibody, and an expression vector containing the coding gene of the Fc fusion protein; the expression vector can be a prokaryotic expression vector, a eukaryotic expression vector or other expression vectors.

[0037] The present invention also discloses a recombinant host cell containing the above expression vector. Among them, the host cell is a prokaryotic expression cell, a eukaryotic expression cell, a fungal cell or a yeast cell, and the eukaryotic expression cell is preferably a CHO cell.

[0038] In addition, an immunoconjugate can also be obtained by conjugating an anti-FAP single-domain antibody, a fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein with a functional molecule; wherein, the functional molecule includes but is not limited to one or more of a small molecule drug, a cytotoxic agent, a bioactive protein, a radioisotope or a fluorescent dye.

[0039] The obtained immunoconjugate can be used to prepare a reagent for tumor molecular imaging diagnosis or a drug for treating tumors; or the obtained immunoconjugate is used to prepare a drug for diagnosing or treating FAP-related diseases.

[0040] As used herein, the term "fluorescent dye" refers to a compound that emits visible or infrared light after excitation by electromagnetic radiation of a shorter and appropriate wavelength. The fluorescent dyes are selected from xanthines, acridines, oxazines, cyanines, styryl dyes, Evans blue, coumarins, porphyrins, metal ligand-complexes, fluorescent proteins, nanocrystals, perylenes, boron dipyrromethene and phthalocyanines, as well as conjugates and combinations of dyes of these classes.

[0041] As used herein, "radioisotope" is an element that emits α, β, and / or γ radiation. For example, an anti-FAP single domain antibody, an Fc fusion protein or an immunoconjugate is labeled with 64 Cu, 67 Ga, 68 Ga, 89 Zr, 18 F, 86 Y, 90 Y, 111 In, 99m Tc, 125 I, 124 I and other radioisotopes to obtain molecular imaging diagnostic agents for PET (positron emission tomography) or SPECT; or an anti-single domain antibody, an Fc fusion protein or an immunoconjugate is labeled with 90 Y, 177 Lu, 125 I, 131 I, 211 At, 111 In, 152 Sm, 166 Ho, 186 Re, 188 Re, 67 Cu, 212 Pb, 225 Ac, 213 Bi, 212 Bi, 223 Ra, 227 Th and other radioisotopes to obtain therapeutic agents for FAP-related diseases.

[0042] In addition, the radioisotope can directly label the immunoconjugate formed by the anti-FAP single-domain antibody or the Fc fusion protein; it can also indirectly label the anti-FAP single-domain antibody and the Fc fusion protein through a chelating agent, and the chelating agent includes but is not limited to 1,4,7,10-tetraazacyclododecane-N,N’,N,N’-tetraacetic acid (DOTA), ethylenediaminetetraacetic acid (EDTA), 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA), N-N”-bis[2-hydroxy-5-(carboxyethyl)benzyl]diethylamine-N,N”-diacetic acid (HBED-CC), 2-(4,7-bis(carboxymethyl)-1,4,7-triazanon-1-yl)glutaric acid (NODAGA), 2-(4,7,10-tris(carboxymethyl)-1,4,7,10-tetraazacyclododecan-1-yl)glutaric acid (DOTAGA), triethylenetetramine (TETA), iminodiacetic acid, diethylenetriamine-N,N,N’,N’,N”-pentaacetic acid (DTPA), bis-(carboxymethylimidazole)glycine, 6-hydrazinopyridine-3-carboxylic acid (HYNIC), N’-{5-[acetyl(hydroxy)amino]pentyl}-N-[5-({4-[(5-aminopentyl)(hydroxy)amino]-4-oxobutanoyl}amino)pentyl]N-hydroxysuccinamide (DFO), and any one or several of the like.

[0043] The present invention further provides the use of the anti-FAP single-domain antibody, the coding gene of the anti-FAP single-domain antibody, the Fc fusion protein obtained by fusing the anti-FAP single-domain antibody with the Fc protein, and the immunoconjugate in the preparation of reagents or drugs for diagnosing or treating FAP-related diseases.

[0044] Preferably, the FAP-related diseases include but are not limited to cancer, chronic inflammation, atherosclerosis, fibrosis, tissue remodeling or scar disease; preferably, the cancer is selected from breast cancer, pancreatic cancer, small intestine cancer, colon cancer, rectal cancer, lung cancer, head and neck cancer, ovarian cancer, hepatocellular carcinoma, esophageal cancer, hypopharyngeal cancer, nasopharyngeal cancer, laryngeal cancer, myeloma cells, bladder cancer, cholangiocarcinoma, clear cell renal cell carcinoma, neuroendocrine tumors, oncogenic osteomalacia, sarcoma, CUP (cancer of unknown primary), thymic cancer, glioma, glioblastoma, astrocytoma, cervical cancer or prostate cancer, etc.

[0045] Furthermore, the present invention provides a pharmaceutical composition for treating tumors, which is composed of an anti-FAP single-domain antibody and a pharmaceutically acceptable carrier and / or excipient; or is composed of an Fc fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein and a pharmaceutically acceptable carrier and / or excipient; or is composed of an immunoconjugate obtained by conjugating an anti-FAP single-domain antibody with a functional molecule and a pharmaceutically acceptable carrier and / or excipient; or is composed of an immunoconjugate obtained by conjugating an Fc fusion protein with a functional molecule and a pharmaceutically acceptable carrier and / or excipient.

[0046] The present invention further provides a detection kit for diagnosing or treating FAP-related diseases, which detection kit contains any one or more of the aforementioned anti-FAP single-domain antibody, a fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein, an immunoconjugate obtained by conjugating an anti-FAP single-domain antibody with a functional molecule, or an immunoconjugate obtained by conjugating an Fc fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein with a functional molecule.

[0047] Term Definitions Related to the Present Invention

[0048] As used herein, the term "single-domain antibody (sdAb)" refers to a fragment containing a single variable domain in an antibody, also known as a Nanobody. Like a complete antibody, it can selectively bind to a specific antigen. Compared with the mass of a complete antibody of 150-160 kDa, a single-domain antibody is much smaller, approximately only 12-15 kDa. The first single-domain antibody was artificially engineered from the heavy-chain antibody of a camel and is called the "VHH segment".

[0049] As used herein, the term "identity" of a sequence can be used interchangeably with "sameness" and refers to the degree of similarity between sequences determined by a sequence alignment software such as BLAST. Methods and software for sequence alignment are well known to those skilled in the art. A modified nucleotide sequence can be obtained by substitution, deletion, and / or addition of one or several (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or more) amino acids or bases to a known sequence. For example, by conventional means (such as conservative substitution, etc.), one or more of the amino acid or nucleotide sequences shown in SEQ ID NOs: 1-198 of the present invention can be modified to obtain sequences having a sequence identity greater than 80%, greater than 85%, greater than 90%, greater than 95% or greater than 99% and having substantially the same performance, which are all within the protection scope of the present invention. Preferably, the present invention obtains sequence identity by conservative substitution, but is not limited to conservative substitution.

[0050] As used herein, the term "complementary" refers to two nucleotide sequences that include anti-parallel nucleotide sequences, which can pair with each other after forming hydrogen bonds between complementary base residues of the anti-parallel nucleotide sequences. It is known in the art that when the sequences are viewed in the 5' to 3' direction, the nucleotide sequences of two complementary strands are reverse complementary to each other. It is also known in the art that two sequences that can hybridize with each other under a given set of conditions do not necessarily have to be 100% completely complementary.

[0051] The term "amino acid sequence" refers to the order in which amino acids are linked together to form a peptide chain (or polypeptide), and the amino acid sequence can only be read in one direction. There are more than 100 different types of amino acids, 20 of which are commonly used. The present invention does not exclude the presence of other substances on the amino acid chain, such as modifications by sugars, lipids, etc., and the present invention is not limited to the 20 commonly used amino acids.

[0052] The term "nucleotide sequence" refers to the arrangement order of bases in DNA or RNA, i.e., the arrangement order of A, T, G, C in DNA, or the arrangement order of A, U, G, C in mRNA, and also includes the arrangement order of bases in rRNA, tRNA, and mRNA. It should be understood that the antibody genes claimed in the present invention, in addition to DNA sequences, also cover RNA (rRNA, tRNA, mRNA) and their complementary sequences.

[0053] The substitutions described in the present invention may be conservative substitutions, i.e., replacing a specific amino acid residue with a residue having similar physicochemical characteristics. Non-limiting examples of conservative substitutions include substitutions between amino acid residues containing aliphatic groups (e.g., mutual substitutions between Ile, Val, Leu, or Ala), substitutions between polar residues (e.g., mutual substitutions between Lys and Arg, Glu and Asp, Gln and Asn), etc. Mutants resulting from amino acid deletion, substitution, insertion, and / or addition can be prepared by performing, for example, site-directed mutagenesis, which is a well-known technique, on the DNA encoding the wild-type protein (see, for example, Nucleic Acid Research, Vol. 10, No. 20, p. 6487-6500, 1982, which is incorporated herein by reference in its entirety).

[0054] The term "stringent hybridization conditions" means conditions of low ionic strength and high temperature known in the art. Typically, under stringent conditions, a probe hybridizes to its target sequence with a detectable level that is higher (e.g., at least 2-fold above background) than to other sequences. Stringent hybridization conditions are sequence-dependent and will vary in different environmental conditions, with longer sequences hybridizing specifically at higher temperatures. A target sequence that is 100% complementary to the probe can be identified by controlling the stringency of hybridization or the wash conditions. Exhaustive guidance for nucleic acid hybridization can be found in the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays, 1993). More specifically, the stringent conditions are typically selected to be about 5 - 10 °C below the thermal melting point (Tm) of the specific sequence at a specified ionic strength and pH. The Tm is the temperature at which 50% of the probe complementary to the target hybridizes to the target sequence at equilibrium (at a specified ionic strength, pH, and nucleic acid concentration) (since the target sequence is present in excess, 50% of the probe is occupied at equilibrium at the Tm). Stringent conditions can be those in which the salt concentration is less than about 1.0 M sodium ion concentration at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ion concentration (or other salts), and the temperature is at least about 30 °C for short probes (including, but not limited to, 10 to 50 nucleotides), and at least about 60 °C for long probes (including, but not limited to, greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least twice the background hybridization, or 10-fold background hybridization as the case may be. Illustrative stringent hybridization conditions can be as follows: 50% formamide, 5×SSC, and 1% SDS, incubated at 42 °C; or 5×SSC, 1% SDS, incubated at 65 °C, washed in 0.2×SSC and washed in 0.1% SDS at 65 °C. The wash can be carried out for 5, 15, 30, 60, 120 minutes or longer.

[0055] In this specification, "one or more amino acids" refers to amino acids that can be deleted, substituted, inserted, and / or added to the extent possible by site-directed mutagenesis methods. Without limitation, it is preferably 20 or less, 15 or less, 10 or less, or 7 or less, and more preferably 5 or less. For site-directed mutagenesis methods, for example, in addition to the desired mutation, i.e., specific discrepancies, a synthetic oligonucleotide primer complementary to the single-stranded phage DNA to be mutated can be used as follows. That is, a strand complementary to the phage is synthesized using the above synthetic oligonucleotide as a primer, and the resulting double-stranded DNA is used to transform a host cell. The culture of the transformed bacteria is spread on agar, and plaques are formed from single cells containing the phage. Then, the plaques hybridizing with the probe are collected, cultured, and the DNA is recovered. Moreover, methods for deleting, substituting, inserting, and / or adding one or more amino acids to the amino acid sequence of a bioactive peptide such as an enzyme while maintaining its activity, in addition to the above site-directed mutagenesis, also include methods of treating genes with mutagenic sources and methods of selectively cleaving genes, then deleting, substituting, inserting, or adding selected nucleotides, and then ligating them.

[0056] The term "Expression vectors" refers to vectors that can express a target gene by adding expression elements (such as promoters, RBS, terminators, etc.) on the basis of the basic framework of a cloning vector. An expression vector consists of four parts: a target gene, a promoter, a terminator, and a marker gene. The present invention includes, but is not limited to, prokaryotic cell expression vectors, eukaryotic cell expression vectors, or other cell expression vectors.

[0057] The term "Framework region", i.e., the framework area, has a very large variation in the amino acid sequence of approximately 110 at the near N-terminus of the H and L chains of immunoglobulins, and the amino acid sequences of other parts are relatively constant. Based on this, the light and heavy chains can be divided into variable regions (V) and constant regions (C). The variable region contains hypervariable regions (HVR) or complementarity-determining regions (CDR) and FR framework regions.

[0058] The terms "mutation" and "mutant" have their common meanings here, referring to genetic, naturally occurring, or introduced changes in nucleic acid or polypeptide sequences, and their meanings are the same as those commonly known to those skilled in the art.

[0059] The term "host cell" or "recombinant host cell" means a cell containing the polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide can be maintained as a non-integrated vector such as a plasmid or can be integrated into the host genome. Brief Description of the Drawings

[0060] Figure 1 Electrophoresis diagram of the first-round PCR amplification of the heavy chain of the common antibody and the VH gene of the heavy-chain antibody HH ; Marker is 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp; 1 and 2 are the products obtained by PCR using different primer combinations; 1 has an amplified fragment of the heavy chain gene of the common antibody larger than 750bp and an amplified fragment of the VH gene of the heavy-chain antibody smaller than 750bp; 2 is only an amplified fragment of the VH gene of the heavy-chain antibody of about 500bp HH amplified fragment.

[0061] Figure 2 It is the diagram of the FAPphage PCR amplification product; Marker (2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp), and the PCR amplicon is about 400bp.

[0062] Figure 3 It is the SDS-PAGE electrophoresis diagram of the collected solution of the extracted protein "SN1" (wells 1, 2, and 4 are F80-3C4, F80-4G3, and Marker respectively).

[0063] Figure 4 It is the SDS-PAGE electrophoresis diagram of the collected solution of the extracted protein "SN2" (F80-3C4, F80-4G3, and Marker).

[0064] Figure 5 SDS-PAGE identification of the flow-through solution, washing solution, elution solution 1, and elution solution 2 purified by the magnetic bead method (F80-3C4, F80-4G3).

[0065] Figure 6 Test results of the binding ability of the Anti-FAP single-domain antibody to the FAP antigen.

[0066] Figure 7 Electrophoresis results of the prokaryotic expression of the FAP-Fc fusion protein.

[0067] Figure 8 SDS-PAGE reducing gel electrophoresis results of the FAP-Fc fusion protein.

[0068] Figure 9 SEC-HPLC detection results of F80-3C4-Fc.

[0069] Figure 10 SEC-HPLC detection results of F80-4G3-Fc.

[0070] Figure 11 Results of affinity determination of FAP-Fc fusion protein biochip

[0071] Figure 12 143B tumor-bearing mice were intravenously administered once with 89 Zr-F803C4-Fc, 89 MIP images of small animal PET / CT scans after Zr-F804G3-Fc

[0072] Figure 13 Distribution maps of radioactivity uptake values in ROI of animal tissues at each scanning time point

[0073] Figure 14 A375 tumor-bearing mice were intravenously administered once with 89 Zr-F803C4-Fc, 89 MIP images of small animal PET / CT scans after Zr-F804G3-Fc

[0074] Figure 15 Distribution maps of radioactivity uptake values in ROI of animal tissues at each scanning time point

[0075] Figure 16 A549 tumor-bearing mice were intravenously administered once with 89 Zr-F803C4-Fc, 89 MIP images of small animal PET / CT scans after Zr-F804G3-Fc

[0076] Figure 17 Distribution maps of radioactivity uptake values in ROI of animal tissues at each scanning time point

[0077] Figure 18 Graph of tumor size change over time

[0078] Figure 19 Graph of mouse body weight change over time Detailed implementation manners

[0079] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and forms of the present invention can be made without departing from the spirit and scope of the present invention, and such modifications and substitutions fall within the protection scope of the present invention.

[0080] Example 1 Construction of a single-domain antibody library specific to FAP antigen

[0081] 1. Immunize alpacas with FAP antigen

[0082] Select adult healthy alpacas and inject the FAP antigen subcutaneously at multiple points on the back of the neck, with a total dose of 2 mg (FAP Protein, Human, Recombinant (ECD, His Tag), Beijing Sino Biological Inc., Catalog No. 10464-H07H). Add an equal volume of Freund's adjuvant to the antigen and immunize 6 times, with an immunization interval of 14 - 21 days. Collect serum before and after immunization, and use the ELISA method to measure the immunization titer of the antigen. When the titer reaches more than 10,000 times, collect 70 ml of whole blood, isolate PBMC cells, add Trizol and mix well, then store at -80 °C for later use.

[0083] 2. RNA Extraction

[0084] Take 1 ml of the separated PBMC cells, add 0.2 ml of chloroform, and mix by shaking. Add 200 μL of chloroform, shake vigorously for 15 s, and let stand at room temperature for 3 min; centrifuge at 12,000 rpm at 4 °C for 15 min; carefully take out the centrifuge tube, aspirate the supernatant and transfer it to a new 1.5 mL Eppendorf tube, add an equal volume of isopropanol, invert up and down to mix well, and let stand at room temperature for 10 min; centrifuge at 12,000 rpm at 4 °C for 10 min; carefully discard the supernatant with a pipette tip, add 75% ethanol along the wall of the tube, and carefully resuspend the precipitate (or gently flick the bottom of the tube with your hand); centrifuge at 7,500 rpm at 4 °C for 5 min; carefully pour out the supernatant, spin for another 1 min, and aspirate the supernatant; open the lid and let stand at room temperature for 10 - 15 min until the ethanol has completely evaporated; add 30 μL of RNase-free water to dissolve the RNA, and immediately reverse transcribe the RNA into cDNA.

[0085] 3. Obtain the Variable Region - V of the Anti-FAP Heavy Chain Antibody HH Gene Fragment (Single Domain Antibody Gene)

[0086] According to the cDNA synthesis kit (PrimeScript TMUsing the instruction manual of the II 1st Strand cDNA Synthesis Kit (Catalog No. 6210A, TAKARA), the extracted RNA was reverse transcribed into cDNA. Prepare the following reaction mixture in a centrifuge tube: 1 μl of Random 6mers (50 μM), 1 μl of dNTP Mixture (10 mM each), template RNA: less than 5 μg, RNase Free ddH2O Up to 10 μl. Incubate the mixture at 65 °C for 5 min and then quickly cool on ice. Prepare the following reverse transcription reaction solution in the above centrifuge tube with a total volume of 20 μl. Use 10 μl of the above denatured reaction solution, 4 μl of 5×PrimeScript II Buffer, 0.5 μl of RNase Inhibitor (40 U / μl), 1 μl of PrimeScript II RTase (200 U / μl), and add RNase Free dH2O to a total volume of 20 μl. Perform the reverse transcription reaction under the following conditions: 30 °C for 10 min, 42 °C for 30 - 60 min, 95 °C for 5 min, and then cool on ice.

[0087] Using the cDNA as a template, PCR amplification of the heavy chain V HH gene fragments was performed with two sets of primers respectively. In the first PCR amplification, those greater than 750 bp were common heavy chain gene fragments, and those between 750 - 500 bp were single domain antibody gene fragments. Gel extraction and recovery of the heavy chain antibody V HH gene fragments (single domain antibody genes), and using this as a template, PCR amplification was performed with V HH specific primers to obtain the target gene (~500 bp). HH

[0088] Table 1 PCR primer sequences

[0089]

[0090]

[0091] The first round of PCR (1): 10 pmol of YT1, 10 pmol of YT1BN, 10 pmol of YT2, 10 pmol of YT1BN.

[0092] The upstream and downstream primers for the second round of PCR are YTV8 and YTV9, each at 10 pmol.

[0093] The first round of PCR amplification:

[0094] 5 μl of 10×PCR buffer, 5 μl of dNTPs, 1.5 μl of forward primer, 1.5 μl of reverse primer, 3.5 μl of template, 0.5 μl of Blend Taq enzyme, 33 μl of ddH2O. The PCR conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min; 25 cycles were carried out, and then held at 4°C for 10 min.

[0095] Figure 1 For the first-round PCR amplification of the common heavy chain of antibodies and the V gene of the heavy chain antibody HH Electrophoresis map of gene amplification.

[0096] Second-round PCR amplification:

[0097] 5 μl of 10×PCR buffer, 5 μl of dNTPs, 1.5 μl of forward primer, 1.5 μl of reverse primer, 3.5 μl of template (the recovered product of the first round), 0.5 μl of Blend Taq enzyme, 33 μl of ddH2O. The PCR conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min; 15 cycles were carried out, and then held at 4°C for 10 min.

[0098] 4. Ligation and transformation

[0099] Digest the PCR product and the pHEN6 vector with the restriction endonuclease SfiI at 37°C overnight. Purify and recover the fragments using a universal recovery kit (Tiangen, product number: DP214). Mix the recovered fragments and the vector at a ratio of 3:1, add T4 DNA ligase (NEB, M0202L), mix well and centrifuge briefly, then place in a 16°C constant-temperature metal bath for overnight ligation. Purify and recover the ligation product using a universal recovery kit. For the ligation product of the V HH fragment and the pHEN6 vector, electrotransform it into TG1 competent cells, spread on plates, and verify the antibody insertion rate by colony PCR. Spread the electrotransformed bacterial solution on LB / Amp plates and incubate at 37°C for 14 hours. Count the colonies and calculate the library capacity the next day. Use 2 mL / plate of 2YT medium to scrape the colonies. After mixing all the colonies evenly, add glycerol and store as 20% glycerol bacteria. Store at -80°C in 1 ml / vial.

[0100] 5. Anti-FAPV HH Preparation of phage library (single-domain antibody library)

[0101] Take 1 ml of the seed bacterial library and add it to 200 ml of 2YT medium (containing a final concentration of 50 μg / ml Amp + 1% glucose), and culture at 37°C until OD 600After it is 0.8 - 1, add M13KO7 helper phage at a ratio of 1:20 for infection. After culturing for 1 hour, replace with fresh 2YT medium (containing Amp at a final concentration of 100 μg / ml + Kana at 50 μg / ml), and culture overnight in a shaker at 37°C. Collect the bacterial solution into a sterile centrifuge tube, centrifuge to collect the supernatant, then add 1 / 5 volume of 20% PEG - 2.5M NaCl, mix well, incubate on ice for 1 hour, centrifuge at 12,000 rpm for 30 min, discard the supernatant, dissolve the precipitate in 3 ml of sterile 15% glycerol - PBS solution, and store the phage library at -80°C.

[0102] Example 2 Screening of Anti - FAP Single - Domain Antibody

[0103] 1. Screening for FAP - Specific Single - Domain Antibodies

[0104] Coat the FAP protein onto the immunotube with the coating solution for the first - round screening at 25 μg / ml. (The coating concentration for the second - round screening is 10 μg / ml) Discard the coating solution, block the whole tube with the blocking solution, add the phage solution after 1 hour at room temperature, wash the tube 20 times with PBST, and then wash 5 times with PBS. Elute with 500 μl of the elution solution and add the neutralizing solution for neutralization. Take 2 μl of the eluted phage for titer determination, and culture the remaining phage solution for expansion.

[0105] Determining the titer is convenient for the next - round screening. The screening results are shown in Table 2.

[0106] Table 2 Screening of Anti - FAP Specific Single - Domain Antibodies

[0107]

[0108] Using the coated FAP protein as the target, perform 3 - round screening from the total phage antibody library by the solid - phase screening method, detect the phage titer eluted in each round. As can be seen from Table 2, as the number of screening rounds increases, the coating concentration decreases step by step, but the phage titer eluted increases, indicating that FAP - specific phages are enriched.

[0109] 2. Construction of Anti - FAP Single - Domain Antibody Expression Plasmid

[0110] Use the following sequences as primers:

[0111] 5 - nano - BbsI—GAAGAAGAAGACAACAGGCCSVKGTGMAGCTGGWGGAKTCT (SEQ ID NO.20);

[0112] 3 - nano - BamHI——GAAGATCTCCGGATCCTGAGGAGACGGTGACCTGGGT (SEQ ID

[0113] NO. 21);

[0114] Using the phage screening elution product as a template, the specific Anti-FAP single domain antibody gene was obtained by PCR amplification ( Figure 2 as shown in the FAPphage PCR amplification product figure). The PCR product and the pSJF2 vector were treated with the restriction enzymes BbsI and BamHI respectively, and the ligated fragments were electrotransformed into TG1 competent cells by T4 DNA ligase to obtain a plasmid capable of highly expressing the single domain antibody in Escherichia coli.

[0115] 3. Screening of Anti-FAP single domain antibody positive clones

[0116] A total of 94 single colonies were randomly picked from the recombinant monoclonal colony agar plate and inoculated into a 96-well deep-well culture plate containing 2YT liquid medium with Amp. After culturing for 4 hours, IPTG was added to the deep-well culture plate to a final concentration of 1 mM for induction. After culturing overnight, the bacterial supernatant expressing the protein was harvested, and the FAP antigen was coated for ELISA determination. The concentration of the coated FAP antigen protein was 1 μg / ml, 100 μl / well, and incubated overnight at 4°C. The supernatant after overnight induction was added, and Anti-myc (HRP) was used as the secondary antibody, and incubated at 37°C for 1 h. After washing, TMB was added for color development, 2M H2SO4 was added to terminate the reaction, and the OD value of the sample at a wavelength of 450 nm was measured with an enzyme-linked immunosorbent assay reader. The Anti-FAP positive wells were selected, and DNA sequencing was performed to identify the gene sequences of the anti-FAP single domain antibody clones, and a series of single domain antibody gene sequences were obtained. Through the analysis and typing of the amino acids encoded by the sequences, single domain antibodies of multiple gene subtypes were obtained, and finally, the highly specific and highly active anti-FAP single domain antibodies F80-3C4 and F80-4G3 were screened; among them, the amino acid sequence of the single domain antibody F80-3C4 includes 3 complementarity-determining regions (CDRs), and the amino acid sequences of the 3 complementarity-determining regions are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; the amino acid sequence of the single domain antibody F80-3C4 is shown as SEQ ID NO.4, and the nucleotide sequence of its encoding gene is shown as SEQ ID NO.5; the amino acid sequence of the single domain antibody F80-4G3 includes 3 complementarity-determining regions (CDRs), and the amino acid sequences of the 3 complementarity-determining regions are shown as SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 respectively; the amino acid sequence of the single domain antibody F80-4G3 is shown as SEQ ID NO.9, and the nucleotide sequence of its encoding gene is shown as SEQ ID NO.10.

[0117] 4. Expression and purification of Anti-FAP single domain antibody

[0118] Inoculate the strain containing the target gene by streaking on a culture plate containing ampicillin and incubate overnight at 32°C. Pick a single colony and inoculate it into 4 mL of 2YT medium containing ampicillin and incubate overnight. Inoculate the overnight culture into 100 mL of 2YT medium containing ampicillin at a ratio of 1:100 and culture for 2 - 3 hours. When the OD 600 value is 0.4 - 0.6, add IPTG for induction and continue to culture overnight. Centrifuge the overnight culture to discard the supernatant and collect the cells. Resuspend the cells in Sucrose Buffer and centrifuge to collect the supernatant, denoted as "SN1". Resuspend the cells in Shock Buffer, incubate on ice and then centrifuge to collect the supernatant, denoted as "SN2".

[0119] Take an appropriate amount of magnetic beads (Beaver, product number: 70501 - 100) into a centrifuge tube, perform magnetic separation and discard the supernatant. Remove the centrifuge tube from the magnetic stand, add Binding Buffer, perform magnetic separation and discard the supernatant. Add the prepared magnetic beads to the "SN1" and / or "SN2" liquid containing the target protein. Place the centrifuge tube on a mixer and rotate and mix at room temperature. Place the centrifuge tube on the magnetic stand for magnetic separation, transfer the supernatant to a new centrifuge tube for subsequent detection. Remove the centrifuge tube from the magnetic stand, add Washing Buffer, invert the centrifuge tube several times to resuspend the magnetic beads; perform magnetic separation and transfer the supernatant to a new centrifuge tube for subsequent detection. Remove the centrifuge tube from the magnetic stand, add Elution Buffer, invert the centrifuge tube several times to resuspend the magnetic beads; perform magnetic separation and transfer the supernatant to a new centrifuge tube for subsequent detection.

[0120] Figure 3 SDS - PAGE electrophoresis diagram of the collected solution "SN1" for protein extraction; Figure 4 SDS - PAGE electrophoresis diagram of the collected solution "SN2" for protein extraction; Figure 5 SDS - PAGE identification results of the flow - through solution, washing solution, eluate 1 and eluate 2 purified by the magnetic bead method.

[0121] Example 3 Confirmation of the binding ability of the purified Anti - FAP single - domain antibody to the FAP antigen

[0122] Dilute the FAP-his antigen with 0.05M NaHCO3 (pH 9.6) coating solution to 1 μg / ml, 100 μl / well, and coat at 4 °C overnight. Block the 96-well plate with 4% PBSM at 37 °C for 1 hour. Add purified Anti-FAP single-domain antibody at different dilution concentrations and incubate at 37 °C for 1 hour. Wash the plate three times with 0.05% PBST. Add the secondary antibody Anti-cmyc-antibody-HRP diluted 1:3000, 100 μl / well, and incubate at 37 °C for 1 hour. Wash the plate three times with 0.05% PBST. Add 100 μl of TMB and let it develop color in the dark at room temperature for 10 minutes. Add 50 μl of 2M H2SO4 to terminate the reaction. Measure the OD value of the sample at 450 nm wavelength with an enzyme-linked immunosorbent assay (ELISA) reader.

[0123] Figure 6 Results of the binding ability test between Anti-FAP single-domain antibody and FAP antigen.

[0124] Example 4 Construction and expression of FAP-Fc fusion protein

[0125] I. Construction and expression of FAP-Fc fusion protein

[0126] 1. Construction steps:

[0127] Gene synthesis of F80-3C4-Fc (Human IgG4-Fc(S228P)) (amino acid sequence shown in SEQ ID NO.11, nucleotide sequence of the encoding gene shown in SEQ ID NO.12), F80-4G3-Fc (Human IgG4-Fc(S228P)) (amino acid sequence shown in SEQ ID NO.13, nucleotide sequence of the encoding gene shown in SEQ ID NO.14), add NotI restriction enzyme site at the 5' end and XbaI restriction enzyme site at the 3' end. Digest F80-3C4-Fc, F80-4G3-Fc, and pCDA3.4 vector with NotI / XbaI respectively, ligate and transform Escherichia coli. Randomly select 4 colonies for colony PCR identification. Use CMV-F (CGCAAATGGGCGGTAGGCGTG(SEQ ID NO.22)) / SEQ-R (AGCGTAAAAGGAGCAACATAGT(SEQ ID NO.23)) primers for colony PCR. PCR conditions are 95 °C, 3 min; 95 °C, 30 S, 55 °C, 30 S, 72 °C, 40 S, 30 CYS; 72 °C, 10 min; 4 °C, save.

[0128] Electrophoresis results are shown in Figure 7 . Select these clones for gene sequencing, and the sequencing is correct.

[0129] 2. Expression of FAP-Fc fusion protein

[0130] Transient transfection and expression in HEK293 cells: When the cells grow to 2.5 - 3.0 x 10^6 cells / ml, perform transient transfection and expression of 100 ml of cultured cells. Dilute 50 μg of F80-3C4-Fc and F80-4G3-Fc expression plasmids with the culture medium, add 200 μl of transfection reagent, mix well, add it to the cultured cells, mix well, incubate at 37°C for 15 minutes, then place it in a shaker for culture for one week. Collect the supernatant and centrifuge at 8000 rpm for 5 min.

[0131] 3. Purification of FAP-Fc fusion protein

[0132] Purification method: Purification by Protein A affinity chromatography column

[0133] (1) Equilibrate the chromatography column: 1xPBS, flow rate 1 ml / min, 20 ml 1);

[0134] (2) Load the sample: Flow rate 1 ml / min;

[0135] (3) Wash away impurities: 1xPBS, flow rate 1 ml / min, 20 ml;

[0136] (4) Elute: Citrate buffer (pH 3.4), 1 ml / min, collect in fractions, about 500 μl per tube. A total of 10 tubes are collected, and the absorbance value at 280 nm is read using a NanoDrop instrument;

[0137] (5) Dialyze: Absorb the high-concentration protein into a dialysis bag and dialyze it in a beaker containing 1xPBS.

[0138] Table 3 Protein concentration and expression level after purification

[0139] Sample Name Concentration (mg / ml) Expression Level (mg / L) F80-3C4-Fc 4.19 109.6 F80-4G3-Fc 4.15 153.5

[0140] 4. Quality detection

[0141] Quality detection is shown in the results of SDS-PAGE electrophoresis and SEC-HPLC:

[0142] (1) The results of SDS-PAGE reducing gel electrophoresis are as Figure 8 shown. The molecular weight of F80-3C4-Fc is close to the theoretical value of 38278.11 Daltons, and the molecular weight of F80-4G3-Fc is close to the theoretical value of 38232.19 Daltons. The electrophoresis purity is over 95%.

[0143] (2) Purity detection (SEC-HPLC): Purity detection is shown in Figure 9 and Figure 10 . From Figure 9The results showed that the purity of F80-3C4-Fc at 280 nm was 95.614% as detected by SEC-HPLC. From Figure 10 the results, the purity of F80-4G3-Fc at 280 nm was 76.04% as detected by SEC-HPLC.

[0144] II. Affinity determination of biochip

[0145] 1. Chip preparation

[0146] The mouse anti-human IgG (Fc) antibody was diluted to 25 μg / mL with a fixation reagent (10 mM sodium acetate, pH 5.0). First, the surface of the CM5 chip was activated with 400 mM EDC and 100 mM NHS at a flow rate of 10 μL / min for 420 s. Second, the 25 μg / mL mouse anti-human IgG (Fc) antibody was injected into the experimental channel (FC2) at a flow rate of 10 μL / min for about 420 s, and the fixed amount was about 9000 to 14000 RU. Finally, the chip was blocked with 1 M ethanolamine at a flow rate of 10 μL / min for 420 s. The reference channel (FC1) was operated in the same way as the test channel (FC2). (Refer to the instruction manual of the Human IgG (Fc) Capture Kit of GE, 《22-0648-88AD》).

[0147] 2. Capturing ligand

[0148] FAP-Fc was diluted to 9 μg / mL with the running reagent and injected into the experimental channel (FC2) at a flow rate of 10 μL / min in sequence to capture about 800 RU. F804G3-Fc and F803C4-Fc were diluted to 1 μg / mL with the running reagent and injected into the experimental channel (FC2) at a flow rate of 10 μL / min in sequence to capture about 90 RU. The reference channel (FC1) did not need to capture the ligand.

[0149] F80-4G3 and F80-3C4 were serially diluted 2-fold from a starting concentration of 25 nM to 0.195 nM with the running reagent, and FAP-His was serially diluted 2-fold from a starting concentration of 50 nM to 0.391 nM with the running reagent. The diluted samples were injected into the experimental channel and the reference channel at a flow rate of 30 μL / min in sequence, with a binding time of 120 s and a dissociation time of 280 s. The binding and dissociation steps were both carried out in the running reagent. After each concentration analysis, the chip needed to be regenerated with 3 M magnesium chloride at a flow rate of 20 μL / min for 30 s to remove the ligand and the undissociated analyte.

[0150] The detection results are shown in Table 4 and Figure 11 .

[0151] Table 4 Affinity determination results

[0152]

[0153] According to the detection results, the affinities of Biacore 8K for detecting FAP-Fc with F80-4G3 and F80-3C4 are 0.393 nM and 0.654 nM respectively, and the affinities of FAP-His for F804G3-Fc and F803C4-Fc are 0.307 nM and 0.547 nM respectively.

[0154] Example 5 Antibody Modification, Labeling, Performance Detection and In Vivo Tumor Inhibition Assay

[0155] 1. Modification and Labeling of Antibodies

[0156] 1.1 89 Preparation of Zr-F803C4-Fc

[0157] Antibody modification: Take the antibody F803C4-Fc (4.17 mg / mL, 76 KDa), adjust the pH to 9 with 1M Na2CO3; add the DFO solution (10 mg / mL, in DMSO) according to the molar ratio of F803C4-Fc:DFO = 1:10; react at 37 °C for 70 min to obtain the crude modified product; purify the crude product with a PD-10 column, add 2.5 mL of acetate buffer (0.2M, pH = 7.2), collect the effluent to obtain DFO-F803C4-Fc.

[0158] Radioactive labeling: Adjust the pH of the zirconium oxalate solution to 7.0 with acetate buffer (0.2M, pH = 7.2) and Na2CO3 (1M); add the purified DFO-F803C4-Fc above, react at room temperature for 60 min (specific activity about 2 mCi / mg); purify the crude reaction product with a PD-10 column, add 3 mL of normal saline, collect the effluent to obtain 89Zr-F803C4-Fc. The Radio-iTLC detection results show that the radiochemical purity is 100%.

[0159] 89 The preparation method of Zr-F804G3-Fc refers to 89 Zr-F803C4-Fc.

[0160] 1.2 177 Preparation of Lu-F803C4-Fc

[0161] Antibody modification: Take antibody F803C4-Fc (10.87 mg / mL, 76 KDa), adjust the pH to 9 with 1 M Na2CO3; add DOTA solution (20 mg / mL) according to the molar ratio F803C4-Fc:DOTA = 1:10; react at 37 °C for 70 min to obtain the crude modified product; purify the crude product with a PD-10 column, add 2.5 mL of acetate buffer (0.2 M, pH = 7.2), collect the eluate to obtain DOTA-F803C4-Fc.

[0162] Radioactive labeling: Take an appropriate amount of 177 LuCl3 and add it to DOTA-F803C4-Fc, with a specific activity of about 2 mCi / mg; react at 37 °C for 60 min; purify the crude reaction product with a PD-10 column, add 3 mL of normal saline, collect the eluate to obtain 177 Lu-F803C4-Fc. The Radio-iTLC detection result shows that the radiochemical purity is 100%.

[0163] 2. In vitro stability experiment of the labeled antibody

[0164] 89 After Zr-F803C4-Fc was stored at 2 - 8 °C in 0.15 M acetic acid / sodium acetate buffer (pH = 7.2) for 21 h and 25 h, the Radio-iTLC detection results showed that the radiochemical purity was 100% in both cases.

[0165] 89 After Zr-F804G3-Fc was stored at 2 - 8 °C in 0.15 M acetic acid / sodium acetate buffer (pH = 7.2) for 21 h and 25 h, the Radio-iTLC detection results showed that the radiochemical purity was 100% in both cases.

[0166] 3. PET / CT scan of the labeled antibody

[0167] Experimental protocol: Three groups of mice models were respectively given the imaging agent 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc for dynamic PET scanning for 1 h, and whole-body small animal PET scanning was performed at 4 h, 24 h, 48 h, 72 h, 96 h, 168 h, and 216 h after administration. Keep the animals still, and CT scans were completed before / after the small animal PET scan. Before the scan, isoflurane was used to anesthetize the animals through an anesthesia machine for respiratory anesthesia. The anesthetized animals were placed on the small animal PET / CT bed. During the scan, the animals continued to inhale isoflurane to maintain the anesthetic effect. Each bed was scanned statically for 10 - 30 min, the scanning energy window: 350 - 650 Kev, and the scanning time was recorded.

[0168] After the small animal PET / CT scan is completed, image reconstruction is performed. The PMOD software is used to process the images and data. Organs such as the heart, whole brain, and muscle are outlined as regions of interest, and the radioactivity concentration (i.e., the radioactivity value per unit volume) of the regions of interest (ROI) is obtained. Then, the activity at each time point is corrected for decay.

[0169] 3.1 143B model

[0170] After a single intravenous administration of 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to 143B tumor-bearing mice, the MIP images of the small animal PET / CT scan are shown in Figure 12 , and the %ID / g values of the regions of interest at each scan time point are shown in Figure 13 .

[0171] It can be seen from Figure 12 and Figure 13 that after a single intravenous administration of 89 Zr-F803C4-Fc, the radioactive substance is mainly distributed in the liver and heart, followed by the spleen, kidney, and lung, then the stomach, bone joints, and tumor, and the intestine, bladder, brain, tibia, and muscle have relatively low distribution. The radioactivity uptake value of the tumor first increases and then decreases with time and reaches the peak at 48 h, which is 7.82.

[0172] After a single intravenous administration of 89 Zr-F804G3-Fc, the radioactive substance is mainly distributed in the liver and heart, followed by the spleen, kidney, and lung, then the stomach, bone joints, and tumor, and the intestine, bladder, brain, tibia, and muscle have relatively low distribution. The radioactivity uptake value of the tumor first increases and then decreases with time and reaches the peak at 24 h, which is 6.25.

[0173] 3.2 A375 model

[0174] After a single intravenous administration of 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to A375 tumor-bearing mice, the MIP images of the small animal PET / CT scan are shown in Figure 14 , and the %ID / g values of the regions of interest at each scan time point are shown in Figure 15 .

[0175] It can be seen from Figure 14 and 15 that after a single intravenous administration of 89 Zr-F803C4-Fc, the radioactive substance is mainly distributed in the liver and heart, followed by the lung, spleen, and kidney, then the stomach, bone joints, and tumor, and the intestine, brain, tibia, and muscle have relatively low distribution. The radioactivity uptake value of the tumor first increases and then decreases with time and reaches the peak at 96 h, which is 5.13.

[0176] After single intravenous administration 89 of Zr-F804G3-Fc, the radioactive substance was mainly distributed in the liver and heart, followed by the lungs, spleen and kidneys, then the stomach, bones and joints, and tumors, and the distribution in the intestines, brain, tibia and muscles was relatively low. The radioactivity uptake value of the tumor first increased and then decreased with time and reached the peak at 72 h, which was 2.93.

[0177] 3.3 A549 model (FAP negative)

[0178] After single intravenous administration of 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to A549 tumor-bearing mice, the MIP images of small animal PET / CT scans are shown in Figure 16 , and the %ID / g values of the regions of interest at each time point of the scan are shown in Figure 17 .

[0179] It can be seen from Figure 16 and Figure 17 that after single intravenous administration of 89 Zr-F803C4-Fc, the radioactive substance was mainly distributed in the liver and heart, followed by the spleen, kidneys and lungs, then the stomach, bones and joints, and tumors, and the distribution in the intestines, brain, tibia and muscles was relatively low. The radioactivity uptake value of the tumor first increased and then decreased with time and reached the peak at 48 h, which was 4.25.

[0180] After single intravenous administration of 89 Zr-F804G3-Fc, the radioactive substance was mainly distributed in the liver and heart, followed by the lungs, spleen and kidneys, then the stomach and bones and joints, and the distribution in tumors, intestines, brain, tibia and muscles was relatively low. The radioactivity uptake value of the tumor first increased and then decreased with time and reached the peak at 24 h, which was 2.83.

[0181] 4. Efficacy and safety tests of the labeled antibody

[0182] 4.1 Experimental protocol

[0183] After single intravenous injection of approximately 400 μCi 177 Lu-F803C4-Fc to HT1080 tumor-bearing mice, the tumor size and body weight were detected. 177 The solvent of Lu-test substance was normal saline, and the diluent for animal administration was normal saline. The control groups were normal saline (the administration volume was the same as that of the experimental group) and 177 LuCl3 (400 μCi). The body weight was weighed and the tumor size was measured before administration. After administration, the body weight and tumor size of the enrolled experimental animals were detected every day.

[0184] The number of mice in each group was as follows: 177There were 8 mice in the Lu-F803C4-Fc experimental group, 4 mice in the normal saline control group, and 177 8 mice in the LuCl3 control group, with an equal number of males and females. During the animal feeding period, they had free access to food and water. The environmental conditions were set at a room temperature of 20°C to 26°C, a relative humidity of 40% to 70%, and a 12-hour light-dark cycle.

[0185] 4.2 Experimental results

[0186] The tumor size changed over time as Figure 18 shown, and the body weight of the mice changed over time as Figure 19 shown.

[0187] According to the experimental results, there were no significant differences in the tumor volumes among the groups before treatment. After treatment, 177 the average tumor volume in the Lu-F803C4-Fc group was less than 1500 mm 3 (1093.16 ± 382.49 mm 3 ) until the 29th day, while the average tumor volume in the normal saline group gradually increased and finally reached 2829.02 ± 1165.54 mm 3 . 177 The tumor growth curve trend in the LuCl3 group was the same as that in the normal saline group. Compared with the normal saline group and 177 the LuCl3 group, 177 the Lu-F803C4-Fc group could significantly inhibit tumor growth. 177 No adverse reactions such as rapid weight loss, diarrhea, hair loss, etc. were observed in the Lu-F803C4-Fc group, indicating that 177 Lu-F803C4-Fc had good safety.

Claims

1. Anti-FAP single domain antibody, characterized in that, The single-domain antibody is single-domain antibody F80-4G3; the amino acid sequence of the single-domain antibody F80-4G3 includes three complementary determining regions, and the amino acid sequences of the three complementary determining regions are shown as SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 respectively.

2. The anti-FAP single domain antibody according to claim 1, characterized in that, The amino acid sequence of the single-domain antibody F80-4G3 is selected from any one of the amino acid sequences in (1)-(3): (1) The amino acid sequence shown as SEQ ID NO.9; or (2) a protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown as SEQ ID NO.9, and this protein mutant has the same function as the protein before mutation; or (3) an amino acid sequence having at least 75% identity with the amino acid sequence shown as SEQ ID NO.

9.

3. The coding gene of the single-domain antibody according to claim 1 or 2, characterized in that, The nucleotide sequence of the coding gene of the single-domain antibody F80-4G3 is selected from any one of (1)-(3): (1) The polynucleotide sequence shown as SEQ ID NO.10; or (2) a polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown as SEQ ID NO.10 under stringent hybridization conditions; or (3) a polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown as SEQ ID NO.10; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown as SEQ ID NO.10; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown as SEQ ID NO.10; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown as SEQ ID NO.10; most preferably, a polynucleotide sequence having more than 99% identity with the polynucleotide sequence shown as SEQ ID NO.

10.

4. An Fc fusion protein obtained by fusing the anti-FAP single-domain antibody of claim 1 or 2 with an Fc protein.

5. The Fc fusion protein according to claim 4, wherein The amino acid sequence of the Fc fusion protein is selected from any one of the following amino acid sequences in (1)-(3): (1) The amino acid sequence shown as SEQ ID NO.13; or (2) a protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown as SEQ ID NO.13, and this protein mutant has the same function as the protein before mutation; or (3) an amino acid sequence having at least 75% identity with the amino acid sequence shown as SEQ ID NO.

13.

6. The coding gene of the Fc fusion protein of claim 5; preferably, the nucleotide sequence of the coding gene is selected from any one of (1)-(3): (1) The polynucleotide sequence shown as SEQ ID NO.14; or (2) a polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown as SEQ ID NO.14 under stringent hybridization conditions; Or a polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO. 14; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO. 14; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO. 14; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO. 14; most preferably, a polynucleotide sequence having at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.

14.

7. An expression vector containing the coding gene according to claim 3 or 6.

8. An immunoconjugate, characterized in that, An immunoconjugate obtained by conjugating the anti-FAP single-domain antibody according to claim 1 or 2 with a functional molecule, or an immunoconjugate obtained by conjugating the Fc fusion protein according to claim 4 or 5 with a functional molecule; wherein, the functional molecule includes but is not limited to one or more of small molecule drugs, cytotoxic drugs, bioactive proteins, radioisotopes or fluorescent dyes.

9. A pharmaceutical composition, characterized in that, Comprising any one or more of the anti-FAP single-domain antibody according to claim 1 or 2, the Fc fusion protein according to claim 4 or 5, or the immunoconjugate according to claim 8, and a pharmaceutically acceptable carrier and / or excipient.

10. Use of the anti-FAP single-domain antibody according to claim 1 or 2, the coding gene according to claim 3 or 6, the Fc fusion protein according to claim 4 or 5, the immunoconjugate according to claim 8, or the pharmaceutical composition according to claim 9 in the preparation of a reagent or drug for diagnosing or treating FAP-related diseases; preferably, the FAP-related diseases include but are not limited to cancer, chronic inflammation, atherosclerosis, fibrosis, tissue remodeling or scar disease.

Images