Good-quality and high-yield sulfur gorgeous fungus and application thereof

By optimizing the cultivation conditions and culture medium, a sulfonylus 2023V48 was provided, which solved the problem of immature cultivation technology of sulfurous bacteria, achieved efficient mycelial growth and high yield, and was suitable for industrial production of highly active ingredients.

CN120384004APending Publication Date: 2025-07-29黑龙江省农业科学院牡丹江分院 +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510527774.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-25
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

In the prior art, the germplasm resources of sulfur bacteria are scarce, the cultivation technology is immature, the cultivation cycle is long, and the properties are uneven, making it difficult to achieve efficient industrial production.

Method used

A sulfide cyst 2023V48 is provided to improve the growth rate of mycelium and fruiting body yield by optimizing the cultivation medium and culture conditions, and produce highly active ingredients such as laccase through liquid fermentation.

Benefits of technology

It has achieved rapid infection of culture materials, rapid bacterial growth and high yield of sulfur sulfide fungi, which is suitable for industrial production, and improves cultivation efficiency and product value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384004A_ABST
    Figure CN120384004A_ABST
Patent Text Reader

Abstract

The invention discloses a strain of high-quality and high-yield sulfur gorgeous fungus and application thereof, and belongs to the technical field of microorganisms. According to the present invention, the Erioporus sulphureus 2023V48 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.41575, and the preservation date is October 18, 2024, and the Erioporus sulphureus 2023V48 can be used for preparing the Erioporus sulphureus strain. The mycelial growth speed of the sulfur gorgeous fungus 2023V48 is high, culture materials can be rapidly infected, the spawn running speed is high, the fruiting body yield after fruiting is high, the content of active ingredients in mycelium fermentation liquor is high, the laccase activity is high, the sulfur gorgeous fungus 2023V48 is suitable for industrial production, the commodity performance is higher, and the application value is higher.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly to a high-quality and high-yield Laetiporus sulphureus and its application. Background Art

[0002] Laetiporus sulphureus, also known as Sulphur Polypore or Sulphur-colored Polypore, is the original variety of Sulphur Polypore and belongs to the class Hymenomycetes, order Aphyllophorales, family Polyporaceae in the subphylum Basidiomycotina of the phylum Eumycota in taxonomy. Sulphur Polypore grows on the dead wood of oak trees in a humid environment. Its fruit body is warm in nature and sweet in taste, and it is an edible and medicinal mushroom that can be used both as food and medicine. The fruit body contains various active ingredients such as polysaccharides, amino acids, and sterol compounds. Regular consumption can play an important regulatory role in the human body, such as regulating the body, tonifying qi and blood, and inhibiting tumors, and can be used as an important drug for treating endocrine diseases such as breast cancer, prostate cancer, and Addison's disease.

[0003] Sulphur Polypore has both edible and medicinal values and has been favored by people who pay attention to health in recent years. However, at present, the main source of the fruit body of Sulphur Polypore is wild collection, and the collection time, location, and quantity are all limited. Therefore, in recent years, many scientific research workers have carried out the collection and domestication cultivation of wild germplasm resources of Sulphur Polypore, and artificial cultivation of Sulphur Polypore has been achieved. However, there are few reports on the breeding of excellent varieties of Sulphur Polypore and the research on cultivation techniques. In actual production, there are still problems such as lack of germplasm resources, immature cultivation techniques, long cultivation cycle, and uneven traits. Summary of the Invention

[0004] The purpose of the present invention is to provide a high-quality and high-yield Laetiporus sulphureus and its application to solve the problems existing in the above-mentioned prior art. The mycelium of Laetiporus sulphureus 2023V48 of the present invention has a fast growth rate, can quickly infect the culture medium, has a fast spawn-running speed, a high yield of fruit bodies after fruiting, a high content of active ingredients in its mycelium fermentation broth, and a high laccase activity, is suitable for industrial production, has stronger commercial performance, and higher application value.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides a Laetiporus sulphureus 2023V48, which is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 41575, and the preservation date is October 18, 2024.

[0007] The present invention also provides the application of the above-mentioned Laetiporus sulphureus 2023V48, and the application is any one of the following:

[0008] (1) Producing mycelium raw materials;

[0009] (2) Producing polysaccharides;

[0010] (3) Producing flavonoids;

[0011] (4) Producing triterpenoids;

[0012] (5) Producing polyphenols;

[0013] (6) Producing ergosterol;

[0014] (7) Producing highly active laccase;

[0015] (8) Producing health products or functional foods.

[0016] The present invention also provides a cultivation medium for producing the mycelium raw materials of the above-mentioned Laetiporus sulphureus 2023V48, and the cultivation medium is made of raw materials with the following concentrations: 180 - 240 g·L of potato -1 、18 - 22 g·L of corn flour -1 、0.4 - 0.8 g·L of FeSO4 -1 、1.2 - 1.6 g·L of NaCl -1 、1.8 - 2.2 g·L of wheat bran -1 and 18 - 20 g·L of agar -1 , and the pH is 5.0 - 6.0.

[0017] The present invention also provides the application of the above cultivation medium in producing the mycelium raw materials of the above-mentioned Laetiporus sulphureus 2023V48.

[0018] The present invention also provides a cultivation method for producing the mycelium raw materials of the above-mentioned Laetiporus sulphureus 2023V48. Inoculate the fungal blocks of the Laetiporus sulphureus 2023V48 on the above cultivation medium and culture them in the dark at 25 - 28°C.

[0019] The present invention also provides the mycelium raw materials of Laetiporus sulphureus 2023V48 obtained by the above cultivation method.

[0020] The present invention also provides a cultivation method for the fruiting bodies of the above-mentioned Laetiporus sulphureus 2023V48. Inoculate the Laetiporus sulphureus 2023V48 in the cultivation substrate and culture it in the dark at 22°C - 30°C for 30 days. After the mycelium fills the cultivation substrate, transfer it to the conditions of a temperature of 22°C - 28°C, a relative humidity of 80% - 90% and a light intensity of 800 Lx - 1000 Lx for cultivation to obtain the fruiting bodies.

[0021] The present invention also provides the fruiting bodies of Laetiporus sulphureus 2023V48 obtained by the above cultivation method.

[0022] The present invention also provides a method for producing highly active laccase. Inoculate the above Laetiporus sulphureus 2023V48 into a liquid medium and culture it at 25 - 28 °C for 7 - 11 days.

[0023] Further, the liquid medium is made from raw materials with the following concentrations: potato 180 - 240 g·L -1 , fructose 18 - 22 g·L -1 , yeast extract 2 - 4 g·L -1 , KH2PO4 2 - 3 g·L -1 and MgSO4·7H2O 1.2 - 1.6 g·L -1 .

[0024] The present invention discloses the following technical effects:

[0025] The present invention provides an edible and medicinal mushroom - Laetiporus sulphureus strain 2023V48. This strain has the advantages of fast colonization, strong growth, and fast mycelial growth rate during the mycelium culture stage; during the cultivation and management stage, the mycelium of Laetiporus sulphureus can quickly infect the culture material, with a fast spawn-running speed and a high yield of fruiting bodies after fruiting; in terms of liquid fermentation culture, Laetiporus sulphureus can secrete various nutritional components, and the laccase produced has high activity, which can be used for industrial production of laccase or other active components of edible and medicinal mushrooms. It has good commerciality and high development value, providing a new microbial resource for the industrial cultivation of Laetiporus sulphureus and the research and development of Laetiporus sulphureus-related products. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0027] Figure 1 It is the morphological diagram of the wild fruiting body of strain 2023V48;

[0028] Figure 2 It is the morphological diagram of the mycelium of strain 2023V48;

[0029] Figure 3 It is the phylogenetic tree of strain 2023V48;

[0030] Figure 4Results diagram of the effects of different carbon sources on the mycelial growth of strain 2023V48; among them, A1 is maltose; A2 is soluble starch; A3 is corn flour; A4 is sucrose; A5 is glucose; A6 is fructose; A7 is the control;

[0031] Figure 5 Results diagram of the effects of different nitrogen sources on the mycelial growth of strain 2023V48; among them, B1 is beef extract; B2 is ammonium sulfate; B3 is yeast extract; B4 is soybean powder; B5 is peptone; B6 is wheat bran; B7 is the control;

[0032] Figure 6 Results diagram of the effects of different inorganic salts on the mycelial growth of strain 2023V48; among them, C1 is CuSO4; C2 is FeSO4; C3 is ZnO; C4 is NaCl; C5 is KH2PO4; C6 is MgSO4·7H2O; C7 is the control;

[0033] Figure 7 Results diagram of the effects of different initial pH values on the mycelial growth of strain 2023V48; among them, D1 is pH = 4; D2 is pH = 5; D3 is pH = 6; D4 is pH = 7; D5 is pH = 8; D6 is pH = 9; D7 is pH = 10;

[0034] Figure 8 Results diagram of the effects of different temperatures on the mycelial growth of strain 2023V48; among them, E1 is 16°C; E2 is 19°C; E3 is 22°C; E4 is 25°C; E5 is 28°C; E6 is 31°C;

[0035] Figure 9 Diagram of the mycelial growth under combinations in the orthogonal experiment; among them, F1 - F9 are orthogonal experiment combinations;

[0036] Figure 10 Curve diagram of the change in mycelial biomass in the fermentation broth of different strains at different culture times;

[0037] Figure 11 Results diagram of the determination of nutrient components in the fermentation broth of different strains after 15 days of liquid fermentation;

[0038] Figure 12 Curve diagram of the change in laccase activity in the fermentation broth of different strains at different culture times;

[0039] Figure 13 Diagram of the primordium morphology of strain 2023V48 cultivated artificially in Example 4;

[0040] Figure 14 Diagram of the primordium fruit body morphology of strain 2023V48 cultivated artificially in Example 4. Detailed implementation method

[0041] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be construed as a limitation on the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0042] It should be understood that the terms used in the present invention are only for describing particular embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0043] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0044] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0045] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0046] The names and formulations of the culture media involved in the embodiments of the present invention are as follows:

[0047] PDA medium: 200 g of potatoes, 20 g of glucose, 18 g of agar powder, 1000 mL of ultrapure water, pH natural.

[0048] Basal medium: 200 g of potatoes, 20.0 g of glucose, 1.0 g of KH2PO4, 0.5 g of MgSO4·7H2O, 2.0 g of peptone, 18.0 g of agar, 1000 mL of ultrapure water, pH natural.

[0049] Carbon source basal medium: 200 g of potatoes, 1.0 g of KH2PO4, 0.5 g of MgSO4·7H2O, 2.0 g of peptone, 18.0 g of agar, 1000 mL of ultrapure water, pH natural.

[0050] Nitrogen source basal medium: 200 g of potatoes, 20.0 g of glucose, 1.0 g of KH2PO4, 0.5 g of MgSO4·7H2O, 18.0 g of agar, 1000 mL of ultrapure water, pH natural.

[0051] Inorganic salt basal medium: 200 g of potatoes, 20.0 g of glucose, 2.0 g of peptone, 18.0 g of agar, 1000 mL of ultrapure water, pH natural.

[0052] Orthogonal experiment basal medium: 200 g of potatoes, 18.0 g of agar, 1000 mL of ultrapure water, pH natural.

[0053] Cultivation substrate formula: 40% of oak sawdust, 40% of broadleaf sawdust, 17% of wheat bran, 1% of glucose, 1% of lime, 1% of gypsum, water content 55%-60%.

[0054] Obtaining and identification of strain 2023V48 in Example 1

[0055] In July 2023, researchers from the Edible Fungi Research Institute of Mudanjiang Branch of Heilongjiang Academy of Agricultural Sciences collected a wild strain of Laetiporus sulphureus (see Figure 1 ) in Yichun City, Heilongjiang Province (128°42′30″ E, 44°20′05″ N, altitude 341 m). The fruiting body grew on the dead wood of oak trees, and the surrounding environment was humid. After tissue isolation of the fruiting body, the test strain was obtained, numbered 2023V48. The fruiting bodies of strain 2023V48 were clustered, the pileus was fan-shaped, tiled, without a stipe, the pileus width was 22 cm - 30 cm, the edge of the pileus was wavy, the edge thickness was 1.2 cm - 1.8 cm, the pileus was light orange-yellow, with fine white villi and longitudinal wrinkles on the surface, without a zone, the context was milky yellow, fleshy and thick, becoming corky to lignified after maturity. Under the microscope, the hyphal diameter was 2 μm - 3 μm, with branches, simple septa, no clamp connections, the spores were ovate or subglobose, smooth, slightly yellow, and the basidiospores were (5.5 - 6.9) μm × (3.0 - 4.0) μm. The macroscopic morphological characteristics of this strain 2023V48 were consistent with those of Laetiporus sulphureus in "Mushroom Museum".

[0056] Furthermore, molecular biological identification was carried out on this strain 2023V48. Using the tissue isolation method, the fruiting body of fresh Laetiporus sulphureus was broken apart, and a "well" shape was cut with a scalpel at the thicker part of the pileus. The middle tissue block was inoculated into PDA medium and cultured in the dark at 25°C for 10 days to obtain mycelium (see Figure 2)。The mycelial DNA obtained after dark cultivation was extracted by the CTAB method, and PCR amplification was carried out using primers ITS1 / ITS4. The sequencing of the amplification product was completed by Sangon Biotech (Shanghai) Co., Ltd.

[0057] After ITS sequencing, a fragment with a length of 481 bp was obtained (shown in SEQ ID NO.1). This fragment was subjected to BLAST alignment in GenBank. The results showed that the homology between strain 2023V48 and Laetiporus sulphureus (ON797482.1) reached 99.79%. A phylogenetic tree was constructed using MEGA4.0 software (see Figure 3 ). Strain 2023V48, Laetiporus sulphureus (accession number ON797482.1), and Laetiporus cremeiporus (accession numbers LC770055.1 and OM809760.1) were grouped into one clade. Combining the phylogenetic tree, the alignment results, and the phenotypic characteristics of the fruiting bodies, it can be determined that strain 2023V48 belongs to Laetiporus sulphureus. This strain 2023V48 was deposited in the China General Microbiological Culture Collection Center on October 18, 2024, with the deposit number CGMCC No. 41575.

[0058] SEQ ID NO.1:

[0059] GCCCCTTGTCCACAAACACACCCCCGTGCACGTCGAAGGCCCGGCTCGTTGAGTGGGTGGGCGACCGCCCAGGATTCGTAGCCTCGCTTTCTTTACACAAACTTCGGAATGTAGATCGGAATGTCTATTGGGTACACAAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAACCCCTGCCATCTTTGCGGATGAGCGTCGGTTGGATTTTGGAGGCTGCCGGACTCGTTCGGCTCCTCTTGAAAGCATAGTGAAGCTTGGACCTGACCGACCGGGTGGACGTGATAGAAAGTCACCGTCGACCGAAGGGTCCGTCGCCGAACGGTTCAAGCTTTGTTTA.

[0060] Study on the Biological Characteristics of Strain 2023V48 in Example 2

[0061] 1. Test Method

[0062] (1) Carbon Source Test

[0063] Using the carbon source basal medium as a control, and adding 20 g of maltose, 20 g of soluble starch, 20 g of corn flour, 20 g of sucrose, 20 g of glucose, and 20 g of fructose to this medium respectively to prepare media. Then, inoculate 1 mycelial block with a diameter of 0.6 cm on each plate medium, and culture it at a constant temperature in the dark at 25 °C. Use the cross-streak method to measure the colony diameter, observe the mycelial growth trend, and calculate the mycelial growth rate. Each treatment has 5 replicates.

[0064] (2) Nitrogen Source Test

[0065] Using the nitrogen source basal medium as a control, and adding 2 g of beef extract, 2 g of ammonium sulfate, 2 g of yeast extract, 2 g of soybean powder, 2 g of peptone, and 2 g of wheat bran to this medium respectively to prepare media. Inoculate, culture, observe the mycelial growth trend, and calculate the mycelial growth rate according to the carbon source test. Each treatment has 5 replicates.

[0066] (3) Inorganic Salt Test

[0067] Using the basal medium as a control, and adding 1 g of MgSO4·7H2O, 1 g of KH2PO4, 1 g of NaCl, 1 g of CuSO4, 1 g of FeSO4, and 1 g of ZnO to this medium respectively to prepare media. Inoculate, culture, observe the mycelial growth trend, and calculate the mycelial growth rate according to the carbon source test. Each treatment has 5 replicates.

[0068] (4) Initial pH Test

[0069] Using the basal medium as a control, adjust the initial pH of the medium to 4, 5, 6, 7, 8, 9, and 10 respectively. Inoculate, culture, observe the mycelial growth trend, and calculate the mycelial growth rate according to the carbon source test. Each treatment has 5 replicates.

[0070] (5) Temperature Test

[0071] Using the basal medium as the medium, inoculate according to the carbon source test, and culture it at a constant temperature in the dark at 16 °C, 19 °C, 22 °C, 25 °C, 28 °C, and 31 °C respectively. Observe the mycelial growth trend and calculate the mycelial growth rate. Each treatment has 5 replicates.

[0072] 2. Test Results

[0073] (1) Effects of Different Carbon Sources on the Mycelial Growth of Strain 2023V48

[0074] As shown in Table 1 and Figure 4 , among which the mycelial growth rate was the fastest in the medium with corn flour as the carbon source, being 10.12 mm·d -1 , followed by fructose, sucrose, and maltose, and the mycelial growth rates were 9.28 mm·d -1 , 9.24 mm·d -1 , 9.19 mm·d -1 , all significantly higher than the control (P < 0.05).

[0075] Table 1 Effects of different carbon sources on the mycelial growth of strain 2023V48

[0076]

[0077] Note: Data are mean ± standard error (n = 7); +, ++, +++, ++++ represent sparse, average, dense, and very dense mycelial growth, respectively; different lowercase letters indicate significant differences (P < 0.05).

[0078] (2) Effects of different nitrogen sources on the mycelial growth of strain 2023V48

[0079] As shown in Table 2 and Figure 5 , among which the mycelial growth rate was the fastest in the medium with wheat bran as the nitrogen source, being 10.63 mm·d -1 , significantly higher than the control (P < 0.05), followed by soybean powder, peptone, and beef extract, and the mycelial growth rates were 9.50 mm·d -1 , 9.28 mm·d -1 , 9.14 mm·d -1 , with no significant difference from the control (P < 0.05), and the mycelial growth rate was the slowest in the medium with yeast extract as the nitrogen source, significantly lower than the control.

[0080] Table 2 Effects of different nitrogen sources on the mycelial growth of strain 2023V48

[0081]

[0082] Note: Data are mean ± standard error (n = 7); +, ++, +++, ++++ represent sparse, average, dense, and very dense mycelial growth, respectively; different lowercase letters indicate significant differences (P < 0.05).

[0083] (3) Effects of different inorganic salts on the mycelial growth of strain 2023V48

[0084] As shown in Table 3 and Figure 6 , among which the mycelial growth rate was the fastest in the medium with ferrous sulfate as the inorganic salt, being 9.27 mm·d -1, significantly higher than the control (P < 0.05), followed by sodium chloride, with a mycelial growth rate of 9.24 mm·d -1 , also significantly higher than the control.

[0085] Table 3 Effects of different inorganic salts on the mycelial growth of strain 2023V48

[0086]

[0087] Note: Data are presented as mean ± standard error (n = 7); +, ++, +++, ++++ represent sparse, average, dense, and very dense mycelial growth, respectively; different lowercase letters indicate significant differences (P < 0.05).

[0088] (4) Initial pH test

[0089] As shown in Table 4 and Figure 7 , the mycelial growth rate was the fastest in the medium with an initial pH of 5, at 12.76 mm·d -1 , followed by the medium with an initial pH of 6, with a mycelial growth rate of 11.97 mm·d -1 , significantly higher than other treatments (P < 0.05), and the mycelia hardly grew in the media with initial pH values of 9 and 10.

[0090] Table 4 Effects of different initial pH values on the mycelial growth of strain 2023V48

[0091]

[0092]

[0093] Note: Data are presented as mean ± standard error (n = 7); +, ++, +++, ++++ represent sparse, average, dense, and very dense mycelial growth, respectively; different lowercase letters indicate significant differences (P < 0.05).

[0094] (5) Temperature test

[0095] As shown in Table 5 and Figure 8 , the mycelial growth rate was 11.20 mm·d -1 ~11.64 mm·d -1 , significantly higher than other treatments (P < 0.05), and there was no significant difference in the mycelial growth rate between the two treatments. The mycelial growth rate was slow at 16°C and 19°C, significantly lower than other treatments.

[0096] Table 5 Effects of different temperatures on the mycelial growth of strain 2023V48

[0097]

[0098] Note: Data are presented as mean ± standard error (n = 7); +, ++, +++, ++++ indicate sparse, moderate, dense, and very dense mycelial growth, respectively; different lowercase letters indicate significant differences (P < 0.05).

[0099] 3. Orthogonal experiment

[0100] Combined with the single-factor experiments on the screening of carbon sources, nitrogen sources, and inorganic salts, it was found that the factors significantly affecting the mycelial growth rate of strain 2023V48 were corn flour, wheat bran, FeSO4, and NaCl. The medium formula was designed using a 4-factor, 3-level L9(34) orthogonal experiment. The carbon source experiment was inoculated, cultured, the mycelial growth was observed, and the mycelial growth rate was calculated. The factors and levels of the orthogonal experiment are shown in Table 6.

[0101] Table 6 Factors and levels of the orthogonal experiment (g·L -1 )

[0102]

[0103]

[0104] The mycelial growth in the orthogonal experiment is as shown in Figure 9 and Table 7. As can be seen from Table 7, the four factors of corn flour, wheat bran, FeSO4, and NaCl had significant differences in their effects on the mycelial growth rate of strain 2023V48 (P < 0.05). The order of influence was NaCl > FeSO4 > wheat bran > corn flour, and NaCl was the most important key factor. The mean values of NaCl were k3 > k2 > k1 from largest to smallest, the mean values of FeSO4 were k1 > k3 > k2 from largest to smallest, the mean values of wheat bran were k2 > k3 > k1 from largest to smallest, and the mean values of corn flour were k2 > k3 > k1 from largest to smallest. Through comprehensive analysis, the best combination was A2B2C1D3, that is, corn flour was 20 g·L -1 , wheat bran was 2.0 g·L -1 , FeSO4 was 0.5 g·L -1 , and NaCl was 1.5 g·L -1 , which was consistent with the variance results (Table 8).

[0105] Table 7 Results of the orthogonal experiment on the mycelial growth of 2023V48

[0106]

[0107] Note: Data are presented as mean ± standard error (n = 7); +, ++, +++, ++++ indicate sparse, moderate, dense, and very dense mycelial growth, respectively; different lowercase letters indicate significant differences (P < 0.05). Kn is the sum value of each factor at each level, kn is the average value of each factor at each level, and R is the range of each factor.

[0108] Table 8 Results of Variance Analysis of Orthogonal Experiment

[0109]

[0110] Note: Coefficient of determination R of the model 2 = 0.850; Adjusted coefficient of determination R 2 = 0.988.

[0111] 4. Conclusions

[0112] The results of single-factor experiments showed that the mycelia of strain 2023V48 could grow in media with various carbon sources, nitrogen sources, and inorganic salts, indicating that this strain has a relatively wide nutritional adaptability. This wide nutritional adaptability may contribute to the survival and reproduction of this strain in different ecological environments. The experiments found that the optimal carbon source for the mycelial growth of strain 2023V48 was corn flour, the optimal nitrogen source was wheat bran, the optimal inorganic salt was ferrous sulfate, the most suitable initial pH was 5, and the optimal culture temperature was 25°C - 28°C.

[0113] The results of orthogonal experiments showed that the four factors of corn flour, wheat bran, FeSO4, and NaCl had significant differences in the mycelial growth rate of strain 2023V48 (P < 0.05), and the order of influence degree was NaCl > FeSO4 > wheat bran > corn flour. This result revealed that NaCl was the most critical one among these four factors and had the greatest influence on the mycelial growth rate. This may be related to the role of NaCl in regulating the osmotic pressure of the medium and providing necessary inorganic salt ions. Although corn flour and wheat bran, as carbon and nitrogen sources, also had certain effects on mycelial growth, their influence degrees were relatively small compared with NaCl and FeSO4. By comprehensively analyzing the optimal levels of all factors, the best combination was obtained as A2B2C1D3, that is, corn flour was 20 g·L -1 , wheat bran was 2.0 g·L -1 , FeSO4 was 0.5 g·L -1 , NaCl was 1.5 g·L -1 , and this result was consistent with the results of variance analysis. Under this medium condition (200 g of potato, 20.0 g of corn flour, 0.5 g of FeSO4, 1.5 g of NaCl, 2.0 g of wheat bran, 18.0 g of agar, 1000 mL of ultrapure water, pH 5.0), the growth rate of strain 2023V48 could reach 13.86 mm·d -1 . Compared with the sulfur fungus (Research on the Biological Characteristics of Pycnoporus cinnabarinus) with the fastest mycelial growth rate recorded in the existing technology, the mycelial growth rate of strain 2023V48 was further increased by 35.48%, which could significantly shorten the cultivation cycle of medicinal fungi and improve the cultivation efficiency of medicinal fungi.

[0114] Analysis of the Nutritional Quality of the Fermentation Broth of Strain 2023V48 in Example 3

[0115] 1. Test Method

[0116] Using the sulfur bacteria strain 2023V48 as the test material and strain 2022V40 (GenBank database accession number: OR195051) as the control, with a liquid medium (200 g of potato, 20 g of fructose, 3 g of yeast extract, 2.5 g of KH2PO4, 1.5 g of MgSO4·7H2O, 1 L of water) as the culture medium substrate, and adopting the liquid culture method to determine the nutrient component content and extracellular enzyme activity in the fermentation broth at different culture times (1 day, 3 days, 5 days, 7 days, 9 days, 11 days, 13 days, 15 days, 17 days).

[0117] 2. Preparation of Fermentation Broth

[0118] On the activated plate culture, use a puncher to take 10 agar blocks with a diameter of 0.6 cm and inoculate them into a triangular flask containing 150 mL of liquid medium, and place them in a constant temperature shaking incubator at 25°C and 160 r / min for culture to obtain the fermentation broth.

[0119] 3. Preparation of Crude Enzyme Solution

[0120] Take 3 bottles of fermentation broth at each culture time point, mix them well and take 1.5 mL, centrifuge at 4°C and 10000 r / min for 15 min, and the supernatant is the crude enzyme solution.

[0121] 4. Determination of Biomass

[0122] Take 100 mL of fermentation broth, centrifuge at 10000 r / min for 10 min, discard the supernatant, wash the mycelium 3 times with ultrapure water, then dry the mycelium in an oven at 50°C until constant weight, and weigh the dry weight of the mycelium with an electronic analytical balance.

[0123] 5. Determination of Nutrient Components

[0124] The total sugar is determined by the method of GB / T 15672 - 2009, the total flavonoids are determined by the method of SN / T 4592 - 2016, the total polyphenols are determined by the method of GB / T 44349 - 2024, the ergosterol is determined by the method of DB44 / T 1991 - 2017, and the total triterpenoids are determined by the method of NY / T 3676 - 2020.

[0125] 6. Determination of Enzyme Activity

[0126] The determination is carried out according to the test methods and steps in the instruction manual of the laccase activity detection kit, and the kit is purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0127] 7. Experimental Results

[0128] (1) Determination of biomass in fermentation broth at different culture times

[0129] As Figure 10 shown, the strain 2023V48 showed a steady increase during the cultivation process, especially with relatively high biomass at 11 days and 13 days. The overall trend was a continuous increase in biomass, but it decreased at 17 days; the biomass of the strain 2022V40 was relatively low in the early stage (from 1 day to 7 days), but reached the highest value (1.07 g) at 11 days and then gradually decreased.

[0130] In the initial stage (from 1 day to 7 days), the biomass changes of the two strains were relatively close, but the strain 2023V48 was slightly ahead of the strain 2022V40. From 9 days to 13 days, the biomass of the strain 2023V48 was continuously higher than that of the strain 2022V40, showing stronger growth. At 17 days, the biomass of the strain 2023V48 was still higher than that of the strain 2022V40. The results indicate that the mycelial growth ability of the strain 2023V48 is superior to that of the existing strains, and it has great application value in shortening the cultivation cycle of medicinal fungi and improving the cultivation efficiency of medicinal fungi.

[0131] (2) Determination of nutritional components of different strains

[0132] The analysis results of the nutritional components of the culture broth of the strains 2023V48 and 2022V40 after 15 days of liquid fermentation culture are shown in Table 9 and Figure 11 , through comparative analysis, it can be seen that the strain 2023V48 is superior to the strain 2022V40 in the contents of key components such as total sugar, total flavonoids, total polyphenols, ergosterol, and total triterpenoids, indicating that the strain 2023V48 has a stronger ability to secrete and produce nutritional components.

[0133] It has been reported that polysaccharides have effects such as lowering blood pressure, blood lipid, and blood sugar, antioxidant, and immunomodulatory effects; flavonoids have anti-inflammatory, antioxidant, anti-tumor, antibacterial, and antiviral effects, polyphenols have anti-inflammatory, antioxidant, anti-tumor, antibacterial, and blood sugar-regulating effects; ergosterol has anti-inflammatory, lipid-lowering, anti-cancer, immunomodulatory activity, antibacterial activity, etc. In addition, ergosterol can be converted into fat-soluble vitamin D2 to provide natural vitamin D; triterpenoids have significant anti-inflammatory, liver-protecting, lipid-lowering, antioxidant, anti-tumor, and immunomodulatory effects. Edible mushroom polysaccharides, flavonoids, polyphenols, ergosterol, and triterpenoids are the main functional ingredients of various health products or functional foods. The above results indicate that the strain 2023V48 can be used for industrial fermentation to produce polysaccharides, flavonoids, polyphenols, ergosterol, and triterpenoids, providing sufficient raw materials for health products or functional foods.

[0134] Table 9 Determination of the content of nutritional components in the fermentation broth

[0135]

[0136] (3) Determination of laccase activity in fermentation broth at different culture times

[0137] The results of the determination of laccase activity in the liquid fermentation of strains 2023V48 and 2022V40 at different times are as Figure 12 shown. It can be seen that the laccase activity of strain 2023V48 showed an obvious increasing trend during the fermentation process, especially reaching the highest value of 11.63 U / mL on the 9th day, showing strong enzyme activity, and the activity remained relatively stable in the later stage. In contrast, the laccase activity of strain 2022V40 was initially low, and the activity changed relatively smoothly during the whole culture process. Although there was a slight increase on the 9th day, it was always lower than that of strain 2023V48. This indicates that strain 2023V48 has a stronger growth momentum and higher laccase production capacity during liquid fermentation and has better potential in practical applications.

[0138] Laccase can participate in the degradation of lignin and has wide applications in fields such as wastewater treatment, soil remediation, papermaking, and textile. Sulfur bacteria in the prior art (such as the literature "Comparison of Laccase Activities of 4 White Rot Fungi Cultured Alone and in Mixture") basically do not produce or produce low laccase activity and do not have the value of industrial production of laccase. Strain 2023V48 has a strong laccase production capacity, proving that this strain can be used for industrial liquid fermentation to produce laccase, providing a new microbial resource for the production of high-activity laccase.

[0139] Example 4 Establishment of the domestication and cultivation method of strain 2023V48

[0140] 1. Test method

[0141] Using sulfur bacteria strain 2023V48 as the test material and 2022V40 as the control, prepare the cultivation bag culture material according to the cultivation substrate formula, use mechanical bagging, fill it into a 17 cm × 35 cm polyethylene bag, with each bag filled with 1.2 kg of wet material, sterilize at 110 °C for 3.5 h, after cooling, inoculate the strain in a sterile environment, place it in the culture room (temperature controlled at 25 °C) for dark culture for 30 days. After the mycelium fills the material bag, move it to the fruiting shed, place it in a wall-like arrangement, adjust the temperature of the fruiting shed to 25 °C, the relative air humidity to 85%, the light intensity to 1000 Lx, and ventilate appropriately for fruiting management.

[0142] 2. Yield determination

[0143] Harvest the mature fruiting bodies, remove the impurities, dry them to a constant weight in an oven at 65 °C, and weigh the dry weight. Repeat 3 times and take the average value, and calculate the biological efficiency in combination with the weight of the culture material (biological efficiency = dry weight of fruiting body / dry weight of culture material × 100%).

[0144] 3. Experimental Results

[0145] The cultivation results showed that primordia appeared in strain 2023V48 in about 15 days ( Figure 13 ), and the fruiting bodies of Laetiporus sulphureus matured in about 30 days ( Figure 14 ). The color of the primordia was light orange-yellow, and the cap of the mature fruiting body was orange-yellow. After harvesting, the average dry weight of the fruiting bodies per bag was (79.26 ± 0.39) g / bag, which was significantly higher than that of the control strain (P < 0.05), and the biological efficiency was also significantly higher than that of the control strain (Table 10).

[0146] Table 10 Comparison of Yields and Biological Efficiencies of Different Laetiporus sulphureus Strains

[0147]

[0148] Note: Different letters indicate significant differences at the 5% level.

[0149] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the spirit of the design of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A Laetiporus sulphureus 2023V48, characterized in that, Deposited with the China General Microbiological Culture Collection Center, the deposit number is CGMCC No. 41575, and the deposit date is October 18, 2024.

2. Use of the Laetiporus sulphureus 2023V48 according to claim 1, characterized in that, The applications are any of the following: (1) Producing mycelium raw materials; (2) Producing polysaccharides; (3) Producing flavonoids; (4) Producing triterpenoids; (5) Producing polyphenols; (6) Producing ergosterol; (7) Producing highly active laccase; (8) Producing health products or functional foods.

3. A cultivation medium for producing the mycelium raw material of Laetiporus sulphureus 2023V48 as claimed in claim 1, characterized in that, The cultivation medium is made from raw materials with the following concentrations: 180 - 240 g·L of potato -1 , 18 - 22 g·L of corn flour -1 , 0.4 - 0.8 g·L of FeSO4 -1 , 1.2 - 1.6 g·L of NaCl -1 , 1.8 - 2.2 g·L of wheat bran -1 and 18 - 20 g·L of agar -1 , with a pH of 5.0 - 6.

0.

4. Use of the cultivation medium according to claim 3 in the production of the mycelium raw material of the Laetiporus sulphureus 2023V48 according to claim 1.

5. A cultivation method for producing the mycelium raw material of Laetiporus sulphureus 2023V48 as claimed in claim 1, characterized in that, Inoculate the fungal block of the Laetiporus sulphureus 2023V48 on the cultivation medium according to claim 3 and culture it in the dark at 25 - 28°C.

6. The mycelium raw material of Laetiporus sulphureus 2023V48 obtained by the cultivation method according to claim 5.

7. A cultivation method of the fruiting body of Trametes sulphurea 2023V48 as described in claim 1, characterized in that, Inoculate the Laetiporus sulphureus 2023V48 in the cultivation substrate and culture it in the dark at 22°C - 30°C for 30 days. After the mycelium fills the cultivation substrate, transfer it to the conditions of a temperature of 22°C - 28°C, a relative humidity of 80% - 90%, and a light intensity of 800 Lx - 1000 Lx to obtain fruiting bodies.

8. The fruiting bodies of Laetiporus sulphureus 2023V48 obtained by the cultivation method according to claim 7.

9. A method for producing highly active laccase, characterized in that, Inoculate the Laetiporus sulphureus 2023V48 according to claim 1 in the liquid medium and culture it at 25 - 28°C for 7 - 11 days.

10. The method according to claim 9, wherein The liquid culture medium is made from raw materials with the following concentrations: 180 - 240 g·L of potato -1 , 18 - 22 g·L of fructose -1 , 2 - 4 g·L of yeast extract -1 , 2 - 3 g·L of KH2PO4 -1 and 1.2 - 1.6 g·L of MgSO4·7H2O -1 .