Kluyveromyces marxianus and application thereof in preparation of fermented milk
Through the sequential fermentation of Max Kluvia NWAFU 91 and lactic acid bacteria, the problems of high lactose content and ethanol accumulation in traditional fermented milk are solved, and the preparation of fermented milk with low lactose and high flavor is achieved, which improves the sensory quality of the product.
Patent Information
- Application Number
- CN202510540285.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-27
- Publication Date
- 2025-07-29
AI Technical Summary
The existing traditional fermented milk has high lactose content, a single type of flavor compounds, and the accumulation of ethanol during the combined fermentation of mixed bacteria leads to deterioration of the sensory quality of the product.
Max Kluvia NWAFU 91 was used for mixed bacterial fermentation, and leucorbacteria was used to utilize its high lactose metabolism ability and high ester-yield properties to reduce the lactose content and produce additional aroma compounds. At the same time, biomass was preferred to produce instead of ethanol production under aerobic conditions to avoid ethanol accumulation.
The lactose content is significantly reduced by more than 30% in fermented milk, and 7 new aroma compounds above the threshold are added to improve the complexity of flavor, and keep the ethanol content not higher than 0.3%, avoiding deterioration in sensory quality.
Smart Images
Figure CN120384007A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbial fermentation, and particularly relates to a Kluyveromyces marxianus and its application in the preparation of fermented milk. Background Art
[0002] Fermented milk refers to a large category of dairy products made from animal milk such as cow's milk through a lactic acid bacteria fermentation process, mainly including sour milk, active milk, etc. Fermented milk containing a large number of beneficial live bacteria is one of the ideal foods for modern humans with both nutritional and health care functions.
[0003] Traditional stirred fermented milk generally uses lactic acid bacteria such as Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus subsp. salivarius as starters. However, these traditional fermenting microorganisms still have limitations in lactose hydrolysis and flavor compound production. The traditional fermenting microorganisms can hydrolyze at most 30% (m / v) of the lactose in cow's milk or goat's milk, resulting in a relatively large amount of lactose remaining in the final product, which poses a health risk to lactose-intolerant people. In addition, the types of flavor compounds produced by traditional fermenting microorganisms during fermentation are relatively single, mainly including acetaldehyde, diacetyl, acetoin, etc. Therefore, it is necessary to develop new fermenting microorganisms for use in traditional stirred fermented milk.
[0004] As a safe food-grade microorganism, Kluyveromyces marxianus has technical advantages such as strong heat resistance, strong β-galactosidase activity, and strong ability to produce ester compounds. Although there have been reports on the application of this yeast strain in fermented milk through co-fermentation with lactic acid bacteria, the co-fermentation process will lead to the accumulation of ethanol (0.6% - 0.8%, m / v) in the fermented milk, resulting in the deterioration of the sensory quality of the product. Therefore, it is necessary to develop a new Kluyveromyces marxianus strain for co-fermentation with lactic acid bacteria strains to solve the above problems. Summary of the Invention
[0005] To solve the problem that the co-fermentation process of the Kluyveromyces marxianus strain reported in the prior art with lactic acid bacteria will lead to the accumulation of ethanol in the fermented milk, resulting in the deterioration of the sensory quality of the product, the present invention aims to propose a new Kluyveromyces marxianus strain for sequential co-fermentation with lactic acid bacteria strains to solve the above problems. The present invention proposes a Kluyveromyces marxianus and its application in the preparation of fermented milk. To achieve the above object, the present invention adopts the following technical solutions.
[0006] The present invention provides a strain of Kluyveromyces marxianus NWAFU 91, the classification name of the Kluyveromyces marxianus NWAFU 91 is Kluyveromyces marxianus, which was deposited in the China General Microbiological Culture Collection Center on February 26, 2025, with the deposit number of CGMCC No. 33659, and the address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0007] The Kluyveromyces marxianus NWAFU 91 provided by the present invention has the characteristics of high lactose metabolism ability and high yield of ester compounds, and can reduce the lactose content of the product while producing additional aroma compounds during the fermentation process. Moreover, the ethanol produced by the Kluyveromyces marxianus NWAFU 91 provided by the present invention during the sequential fermentation with lactic acid bacteria in the fermented milk is not higher than 0.3% (m / v), thus not causing deterioration of the sensory quality of the product, and solving the problem that the Kluyveromyces marxianus strains in the prior art reported in the mixed fermentation with lactic acid bacteria lead to the accumulation of ethanol in the fermented milk (0.6% - 0.8%, m / v), thereby causing deterioration of the sensory quality of the product.
[0008] Preferably, the nucleotide sequence of the 16S rDNA of the Kluyveromyces marxianus NWAFU 91 is as shown in SEQ ID NO.1.
[0009] The present invention also provides a pure yeast starter, which includes the Kluyveromyces marxianus NWAFU 91 or the culture of the Kluyveromyces marxianus NWAFU 91.
[0010] The present invention also provides the application of the Kluyveromyces marxianus NWAFU 91 or the pure yeast starter in the preparation of fermented milk. The mass of lactose in the fermented milk accounts for 2% - 3% of the total mass. The lactose content in the existing fermented milk with the same solid content is generally 3% - 5%. Compared with the existing fermented milk, the lactose content in the fermented milk prepared in this application is low, and it is a low-lactose flavored fermented milk.
[0011] Preferably, the preparation method of the fermented milk includes the following steps:
[0012] Inoculate the Kluyveromyces marxianus NWAFU 91 or the pure yeast starter into animal milk, and after the first fermentation, obtain yeast-fermented animal milk.
[0013] Add sucrose to the yeast-fermented animal milk and inactivate it quickly to obtain sterilized yeast-fermented animal milk. The mass ratio of the sucrose to the volume of the yeast-fermented animal milk is 6%.
[0014] Inoculate the sterilized yeast-fermented animal milk with a commercial yogurt starter, and after the second fermentation, the fermented milk is obtained.
[0015] The probiotics in the commercial yogurt starter include Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus.
[0016] Preferably, the inoculation amount of the Kluyveromyces marxianus NWAFU 91 or the pure yeast starter in the animal milk is 5.5 log CFU / mL - 6.0 log CFU / mL; the inoculation amount of the commercial yogurt starter in the sterilized yeast-fermented animal milk is 6.5 log CFU / mL - 7.0 log CFU / mL.
[0017] Preferably, the animal milk includes cow milk or goat milk.
[0018] Preferably, the conditions for the first fermentation are 36°C - 38°C and incubation for 9 h; the conditions for the second fermentation are static fermentation at 40°C - 42°C for 6 h.
[0019] The present invention also provides the fermented milk prepared by the preparation method of the fermented milk.
[0020] Preferably, the fermented milk includes at least five of the following flavor compounds:
[0021] Isopentanol, ethyl acetate, ethyl propionate, ethyl butyrate, isobutyl acetate, ethyl isobutyrate, and isoamyl acetate.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] 1. The present invention provides a Kluyveromyces marxianus NWAFU 91. The Kluyveromyces marxianus NWAFU 91 provided by the present invention has the characteristics of high lactose metabolism ability and high yield of ester compounds. It can reduce the lactose content of the product during fermentation while producing additional aroma compounds, and can also solve the problems of high lactose content and relatively single flavor compounds in fermented milk prepared by existing commercial lactic acid bacteria starters. At the same time, the Kluyveromyces marxianus NWAFU 91 provided by the present invention has the characteristic of preferentially producing biomass rather than ethanol under aerobic conditions (Kluyver effect). Therefore, the ethanol produced by the Kluyveromyces marxianus NWAFU 91 during the sequential co-fermentation with lactic acid bacteria in the present invention is not higher than 0.3% (m / v) in the fermented milk content, thus not causing deterioration of the sensory quality of the product, and solving the problem of ethanol accumulation (0.6% - 0.8%, m / v) in the fermented milk during the co-fermentation of Kluyveromyces marxianus strains reported in the prior art in combination with lactic acid bacteria, which leads to deterioration of the sensory quality of the product.
[0024] 2. The Kluyveromyces marxianus NWAFU 91 provided by the present invention combined with the Danisco YO-MIX 883 stirred commercial yogurt starter can be used to prepare fermented milk. Compared with the fermented cow milk or goat milk prepared only with the Danisco YO-MIX 883 stirred commercial yogurt starter, the lactose level in this fermented milk is reduced by more than 30% (m / v), and 7 aroma compounds above the threshold are newly added, including isopentanol, ethyl acetate, ethyl propionate, ethyl butyrate, isobutyl acetate, ethyl isobutyrate, and isoamyl acetate, which improves the flavor complexity of the product. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 It is the colony morphology of Kluyveromyces marxianus NWAFU 91 and the strain morphology under an optical microscope in the present invention; among them, Figure 1 Figure A in it is the colony morphology of the Kluyveromyces marxianus NWAFU 91 on a YPD agar plate; Figure 1 Figure B in it is the photograph of the Kluyveromyces marxianus NWAFU 91 under an oil immersion microscope after Gram staining.
[0026] Figure 2 It is the comparison of the rheological properties of the fermented milk prepared by the sequential co-fermentation process in the present invention and the fermented milk prepared only with the Danisco YO-MIX 883 stirred commercial yogurt starter; among them, Figure 2 Figure A in it is the comparison of the storage modulus and loss modulus of the fermented cow milk; Figure 2 Figure B in it is the comparison of the storage modulus and loss modulus of the fermented goat milk; Figure 2Figure C in [reference] shows the comparison of the apparent viscosities of fermented cow milk; Figure 2 Figure D in [reference] shows the comparison of the apparent viscosities of fermented goat milk; Note: The sequential mixed-strain fermentation groups of cow milk and goat milk were fermented using the sequential mixed-strain process described in the present invention, and the conventional fermentation groups of cow milk and goat milk were fermented only using the Danisco YO-MIX 883 stirred commercial yogurt starter. Detailed implementation manners
[0027] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.
[0028] Example 1: Isolation and identification of Kluyveromyces marxianus NWAFU 91
[0029] 1. Isolation and purification of strain NWAFU 91
[0030] In September 2016, a sample of sour yak milk made by herdsmen was collected from the Qinghai pastoral area and then brought to the College of Food Science and Engineering, Northwest A&F University.
[0031] The collected sour yak milk sample was serially diluted 10-fold with sterile water, and then 10 -4 10 -5 and 10 -6 bacterial suspensions of three dilution degrees were spread on YPD agar plates supplemented with 1% (m / v) chloramphenicol and cultured at 30 °C for 48 h.
[0032] Typical colonies were selected and examined under an oil microscope after Gram staining. After being identified as yeast, the colonies were further purified by streak isolation on YPD agar plates. The initial number of this strain was designated as NWAFU 91, that is, strain NWAFU 91.
[0033] The colony morphology of strain NWAFU 91 on YPD agar plates and the photographs under an oil microscope after Gram staining are as Figure 1 shown.
[0034] 2. Identification of strain NWAFU 91
[0035] (1) The total genomic DNA of this strain NWAFU 91 was extracted using a yeast genomic DNA extraction kit, and then the ribosomal DNA sequence was amplified using primers ITS1 and ITS4 by PCR technology to obtain an amplification product.
[0036] Among them, the nucleotide sequence of primer ITS1 is shown in SEQ ID NO.2: 5'-TCCGTAGGTGAACCTGCGG-3'; the nucleotide sequence of primer ITS4 is shown in SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3'.
[0037] The reaction system (25 μL) for PCR amplification includes: template DNA (2 μL), upstream primer (0.5 μL), downstream primer (0.5 μL), Mix enzyme (12.5 μL), and double-distilled water (9.5 μL).
[0038] The reaction program for PCR amplification is as follows: pre-denaturation at 95°C for 5 min, followed by denaturation at 95°C for 1 min, annealing at 55°C for 2 min, extension at 72°C for 40 s, repeating 35 cycles, and finally extension at 72°C for 10 min.
[0039] (2) The nucleic acid sequence of the amplification product was determined by the Sanger method. The nucleotide sequence of the amplification product is shown in SEQ ID NO.1:
[0040] TCCCTTCCGGTGGGGGGGCCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCATAAAGCGGGAGGAAGAAAATATTAGGGGGGGGAGCGTCGGAACAAGGGCGGCGATTAGTTA。
[0041] The nucleic acid sequence was aligned with the existing sequences in the GenBank database, and the strain was identified as Kluyveromyces marxianus, named Kluyveromyces marxianus NWAFU 91.
[0042] Currently, Kluyveromyces marxianus NWAFU 91 is deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCC NO. 33659, and the address of the deposit unit is No. 3, Building 1, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0043] Example 2: Preparation of pure culture starter of Kluyveromyces marxianus NWAFU 91
[0044] Inoculate a single colony of Kluyveromyces marxianus NWAFU 91 into YPD broth with an inoculation loop, and continuously culture it at 37 °C for three generations, with each generation cultured for 18 h. Then, centrifuge to obtain bacterial cells. Resuspend the cells in 2 mL of 12% (m / v) sterilized skim milk, pre-freeze at -80 °C for 3 h, and then dry in a freeze dryer for 24 h to obtain the freeze-dried powder of this strain.
[0045] Inoculate the freeze-dried powder into YPD broth with an inoculation loop, culture it at 37 °C for 18 h, and then inoculate it into YPD broth at a ratio of 1% (v / v), and continuously culture it at 37 °C for two more generations to obtain the activated culture of this yeast strain. Centrifuge the activated culture to obtain bacterial cells.
[0046] Rinse the bacterial cells twice with sterile water, then resuspend them in the sterile water, and adjust the viable cell count to 7.6 log CFU / mL to obtain the pure culture starter of Kluyveromyces marxianus NWAFU 91.
[0047] Example 3: Application of pure culture starter of Kluyveromyces marxianus NWAFU 91 combined with Danisco YO-MIX883 commercial stirred yogurt starter in the preparation of low-lactose flavored fermented cow milk and goat milk
[0048] 1. Process flow for preparing low-lactose flavored fermented cow milk and goat milk based on a three-stage sequential fermentation process
[0049] Dissolve whole milk powder in ultrapure water to prepare 12% (m / v) reconstituted cow milk; dissolve whole goat milk powder in ultrapure water to prepare 15% (m / v) reconstituted goat milk.
[0050] The reconstituted cow milk and reconstituted goat milk were subjected to high-temperature sterilization to obtain sterilized reconstituted cow milk and sterilized reconstituted goat milk, respectively. Subsequently, the pure culture starter of Kluyveromyces marxianus NWAFU 91 prepared in Example 2 above was inoculated into the above-mentioned sterilized reconstituted cow milk and sterilized reconstituted goat milk at a rate of 1% (v / v), and cultured with shaking at 38 °C in a shaker at 140 r / min for 9 h to obtain yeast-fermented cow milk and yeast-fermented goat milk. To the yeast-fermented cow milk and yeast-fermented goat milk, 6% (m / v) sucrose was added respectively, and then rapid pasteurization (63 °C, 30 min) was carried out to inactivate yeast cells, obtaining inactivated yeast-fermented cow milk and inactivated yeast-fermented goat milk. Then, the Danisco YO-MIX 883 stirred commercial yogurt starter purchased from Danisco was inoculated into the above-mentioned inactivated yeast-fermented cow milk and inactivated yeast-fermented goat milk at an inoculum size of 6.8 log CFU / mL, and statically cultured at 42 °C for 6 h, and finally low-lactose flavored fermented cow milk and low-lactose flavored fermented goat milk were respectively prepared.
[0051] Among them, the probiotics in the Danisco YO-MIX 883 stirred commercial yogurt starter include Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus subsp. thermophilus.
[0052] The preparation methods of fermented cow milk and fermented goat milk products prepared only with the Danisco YO-MIX 883 stirred commercial yogurt starter are as follows:
[0053] The Danisco YO-MIX 883 stirred commercial yogurt starter purchased from Danisco was inoculated into the above-mentioned sterilized reconstituted cow milk and sterilized reconstituted goat milk at an inoculum size of 6.8 log CFU / mL, and statically cultured at 42 °C for 6 h to respectively prepare fermented cow milk and fermented goat milk prepared only with the Danisco YO-MIX 883 stirred commercial yogurt starter.
[0054] 2. Determination methods for product-related indicators
[0055] The following relevant indicators were respectively determined for the above-prepared low-lactose flavored fermented cow milk and low-lactose flavored fermented goat milk, and fermented cow milk and goat milk products prepared only with the Danisco YO-MIX 883 stirred commercial yogurt starter. The following steps only take one of the products as an example to illustrate the specific determination method.
[0056] (1) Determination of viable count
[0057] The viable count of lactic acid bacteria in the product was determined by the pour plate method using MRS agar. The poured agar plates were anaerobically cultured at 37 °C for 72 h, and then the plates with the colony count range between 30 - 300 CFU were selected for counting.
[0058] (2) Determination of pH and Titratable Acidity
[0059] The pH of the supernatant of the product was determined using a pH meter.
[0060] The titratable acidity of the product was determined using the procedure specified in the national standard GB / T 5009.239-2016 "Determination of Food Acidity".
[0061] (3) Determination of Organic Acid Content
[0062] The product was mixed with an equal volume of cold acetone, then centrifuged, and the supernatant was taken. The organic acid content in the product was determined using an Ultimate 3000 ultra-high performance liquid chromatograph from Thermo Fisher Scientific, USA. The target compounds were separated on a reversed-phase C18 chromatographic column (ZORBAX SB-Aq; 250 mm × 4.6 mm, 5 μm), detected using a diode array detector at a wavelength of 260 nm, and quantified by the external standard method based on peak area.
[0063] (4) Determination of Carbohydrate Content
[0064] The product was mixed with an equal volume of cold acetonitrile, then centrifuged, and the supernatant was taken. Lactose and sucrose in the sample were quantitatively analyzed using an Orbitrap Q Extractive Focus high-resolution liquid chromatography-mass spectrometry instrument from Thermo Fisher Scientific, USA. The target compounds were separated on a C18 chromatographic column (XBridge Amine; 150 mm × 2.1 mm, 3.5 μm), and then quantified based on the negative ion ionization mode, parallel reaction monitoring data acquisition mode, and external standard method based on peak area for the target compounds in the sample.
[0065] (5) Determination of Ethanol Content
[0066] The product was mixed with an equal volume of cold acetone, then centrifuged, and the supernatant was taken. The ethanol content in the sample was analyzed using a GC-2014 gas chromatograph from Shimadzu Corporation, Japan. The target compound was separated on a highly polar fused silica capillary chromatographic column (DB-WAX; 30 m × 0.25 mm, 0.25 μm) from Agilent Technologies, USA, detected using an FID detector, and quantified by the external standard method based on peak area.
[0067] (6) Determination of Volatile Flavor Compound Content
[0068] The contents of acetaldehyde, 2,3-butanedione, and acetoin in the product were determined by pre-column 2,4-dinitrophenylhydrazine derivatization combined with ultra-high performance liquid chromatography. The specific method is as follows:
[0069] The product was mixed with an equal volume of cold acetonitrile, followed by centrifugation. The supernatant was taken and mixed with an equal volume of a 1 g / L 2,4-dinitrophenylhydrazine derivatizing agent, and derivatized at 60 °C for 30 min. The obtained derivative was separated on the above-mentioned ZORBAX SB-Aq reverse C18 chromatographic column, detected using a diode array detector at a wavelength of 360 nm, and quantified by the external standard method of peak area.
[0070] The contents of isopentanol and ester compounds in the product were determined using a GCMS-QP2010Ultra gas chromatography-mass spectrometry instrument from Shimadzu Corporation, Japan. The product was mixed with an equal volume of cold acetone, then centrifuged, and the supernatant was taken. The target substances were separated on the above-mentioned DB-WAX fused silica capillary chromatographic column, and then mass spectrometry data were obtained in the selected ion mode, and the target substances were quantified by the external standard method of peak area.
[0071] (7) Determination of free amino acid content
[0072] The content of free amino acids in the product was determined by the pre-column o-phthalaldehyde-9-fluorenylmethyl chloroformate on-line derivatization method combined with high performance liquid chromatography. The specific method is as follows:
[0073] The product was mixed with an equal volume of cold acetone, then centrifuged, and the supernatant was taken. The internal standards norvaline and sarcosine were added. The free amino acids after on-line derivatization were separated on an amino acid analysis chromatographic column (AdvanceBio; 100 mm × 4.6 mm, 2.7 μm), detected using a diode array detector at wavelengths of 338 and 262 nm, and quantified by the internal standard method of peak area.
[0074] (8) Determination of water holding capacity
[0075] The water holding capacity of the product was calculated based on the ratio of the mass of the precipitate obtained after centrifuging the product to its initial total mass.
[0076] Among them, the calculation formula for water holding capacity is as follows:
[0077] WHC = (W / W0) × 100%;
[0078] In the above formula, WHC is the water holding capacity, with the unit of %; W represents the mass of the precipitate obtained after centrifugation, with the unit of g; W0 represents the initial total mass of the product, with the unit of g.
[0079] (9) Determination of rheological properties
[0080] The rheological properties (frequency sweep and shear rheology) of the product were analyzed using a DHR-1 rheometer from TA Instruments, USA.
[0081] 3. Determination results of product-related indicators
[0082] The determination results of the microorganisms, physical and chemical properties, water-holding capacity and texture properties in the low-lactose flavored fermented cow milk and low-lactose flavored fermented goat milk obtained by the above preparation and the fermented cow milk and fermented goat milk products prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter are shown in Table 1.
[0083] Table 1 Microorganism, physical and chemical, water-holding capacity and texture property parameters of the fermented products
[0084]
[0085] Note: The cow milk mixed-strain sequential fermentation group and the goat milk mixed-strain sequential fermentation group were fermented by the mixed-strain sequential process described in the present invention, and the cow milk conventional fermentation group and the goat milk conventional fermentation group were only fermented using the Danisco YO-MIX 883 stirred commercial yogurt starter; the data are expressed as mean ± standard deviation (n = 3); ND indicates not detected; the differences between the two groups: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, NS indicates no significant difference; — indicates no difference analysis was performed.
[0086] As can be seen from Table 1, in terms of the viable count of lactic acid bacteria, the viable count of the low-lactose flavored fermented cow milk prepared by the sequential fermentation process was significantly increased by 0.2 log CFU / mL (P < 0.05) compared with the fermented cow milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter. There was no significant difference in the viable count of the low-lactose flavored fermented goat milk prepared by the sequential fermentation process and the fermented goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter (P > 0.05).
[0087] In terms of acidification characteristics, the organic acid in the fermented products was mainly lactic acid. The lactic acid content in the low-lactose flavored fermented cow milk and goat milk prepared by the sequential fermentation process was significantly reduced by 16.0% and 7.6% respectively (P < 0.05) compared with the fermented cow milk and goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter. The pH values of the four groups were very close, and the mean value was about 4.5. The titratable acidity of the low-lactose flavored fermented cow milk prepared by the sequential fermentation process was significantly reduced by 5.3% (P < 0.05) compared with the fermented cow milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, and there was no significant difference in the titratable acidity between the two groups of fermented goat milk products (P > 0.05).
[0088] In terms of sugar content, compared with the fermented cow milk and goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, the lactose content of the low-lactose flavored fermented cow milk and goat milk prepared by the sequential fermentation process decreased significantly by 32.3% and 34.5% respectively (P<0.05); there was no significant difference in the sucrose content between the two groups of fermented cow milk products and between the two groups of fermented goat milk (P>0.05).
[0089] In terms of ethanol content, no ethanol was detected in the fermented cow milk and goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, while the ethanol content in the low-lactose flavored fermented cow milk and goat milk prepared by the sequential fermentation process was 3.0 and 2.9 g / L respectively. Compared with the ethanol levels detected at the end of yeast fermentation, the two decreased by 14.3% and 5.5% respectively.
[0090] In terms of the content of volatile flavor compounds, 7 flavor compounds above the threshold were newly added to both the low-lactose flavored fermented cow milk and goat milk prepared by the sequential fermentation process, including ethyl acetate, ethyl propionate, ethyl butyrate, isobutyl acetate, ethyl isobutyrate, isoamyl acetate and isoamyl alcohol. Among them, the content of ethyl acetate was the highest. Compared with the fermented cow milk and goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, among the flavor compounds derived from lactic acid bacteria, the increase in acetaldehyde content was the most obvious, increasing significantly by 26.2% and 27.1% respectively (P<0.05).
[0091] In terms of the total free amino acid content, compared with the fermented cow milk and goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, the content increased significantly by 19.8% and 21.3% respectively (P<0.05).
[0092] In terms of water holding capacity, compared with the fermented cow milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, there was no significant difference in the water holding capacity of the low-lactose flavored fermented cow milk prepared by the sequential fermentation process (P>0.05). Compared with the fermented goat milk prepared only using the Danisco YO-MIX 883 stirred commercial yogurt starter, the water holding capacity of the low-lactose flavored fermented goat milk prepared by the sequential fermentation process showed a slight downward trend.
[0093] In terms of rheological properties, there were no obvious differences in the storage modulus, loss modulus and apparent viscosity between the two groups of fermented cow milk and between the two groups of fermented goat milk, as Figure 2As shown, with the increase of shear rate, both the fermented milk products fermented by different starters and the fermented goat milk products showed a similar trend of gradually decreasing apparent viscosity, which is in line with the typical rheological characteristics of fermented milk as a shear-thinning non-Newtonian fluid.
[0094] From the above results, it can be seen that compared with the fermented milk and fermented goat milk prepared only by using the Danisco YO-MIX 883 stirred commercial yogurt starter, the lactose content of the fermented milk and fermented goat milk prepared by the sequential fermentation process described above was significantly reduced, the free amino acid content was significantly increased, and 7 flavor compounds (isopentanol and 6 ester compounds) higher than the threshold level were newly added to the products.
[0095] In summary, the Kluyveromyces marxianus NWAFU 91 described in the present invention not only reduces the lactose content in fermented milk, but also improves the complexity of the flavor of fermented milk; the sequential fermentation process of mixed strains avoids the problem of excessive ethanol accumulation in the existing co-fermentation process of mixed strains and has high application potential.
[0096] It should be noted that when the present invention involves numerical ranges, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To prevent repetition, the present invention describes preferred embodiments.
[0097] Although the preferred embodiments of the present invention have been described, once those skilled in the art learn the basic creative concept, additional changes and modifications can be made to these embodiments, and all such changes and modifications fall within the scope of the present invention.
Claims
1. A Kluyveromyces marxianus NWAFU 91, characterized in that, The Kluyveromyces marxianus NWAFU 91 was deposited at the China General Microbiological Culture Collection Center on February 26, 2025, with the deposit number CGMCC NO. 33659.
2. A Kluyveromyces marxianus NWAFU 91 according to claim 1, characterized in that, The nucleotide sequence of the 16S rDNA of the Kluyveromyces marxianus NWAFU 91 is shown as SEQ ID NO.
1.
3. A pure yeast starter, characterized in that, The pure yeast starter culture includes the Kluyveromyces marxianus NWAFU 91 described in claim 1 or the culture of the Kluyveromyces marxianus NWAFU 91.
4. Use of the pure yeast starter culture according to claim 3 in the preparation of fermented milk, characterized in that, In the fermented milk, the mass of lactose accounts for 2% - 3% of the total mass, and the mass of ethanol in the fermented milk is less than 0.3% of the total mass.
5. The application according to claim 4, characterized in that, The method for preparing the fermented milk includes the following steps: Inoculate the pure yeast starter culture into animal milk, and after the first fermentation, obtain yeast-fermented animal milk. Add sucrose to the yeast-fermented animal milk and inactivate it to obtain sterilized yeast-fermented animal milk; the mass ratio of the sucrose to the volume of the yeast-fermented animal milk is 6%. Inoculate a commercial yogurt starter culture into the sterilized yeast-fermented animal milk, and after the second fermentation, obtain the fermented milk. The probiotics in the commercial yogurt starter culture include Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus subsp. thermophilus.
6. The application according to claim 5, wherein The inoculation amount of the pure yeast starter culture in the animal milk is 5.5 log CFU / mL - 6.0 log CFU / mL; the inoculation amount of the commercial yogurt starter culture in the sterilized yeast-fermented animal milk is 6.5 log CFU / mL - 7.0 log CFU / mL.
7. The application according to claim 5, characterized in that, The animal milk includes cow milk or goat milk.
8. The application according to claim 5, characterized in that, The conditions for the first fermentation are 36°C - 38°C for 9 h; the conditions for the second fermentation are static fermentation at 40°C - 42°C for 6 h.
9. The fermented milk prepared by the method for preparing the fermented milk according to claim 5.
10. The fermented milk according to claim 9, characterized in that, The fermented milk includes at least five of the following flavor compounds: Isoamyl alcohol, ethyl acetate, ethyl propionate, ethyl butyrate, isobutyl acetate, ethyl isobutyrate, and isoamyl acetate.