A pinene synthetase, gene and application thereof

Abstract

The application discloses a new sabinene synthetase, a gene and application thereof, and belongs to the technical field of biotechnology.The nucleotide sequence and the coding amino acid sequence of a HbSaS gene from Hevea brasiliensis or a plasmid containing the nucleotide sequence and the coding amino acid sequence can be used for synthesizing sabinene.The synthesized sabinene can be used for synthesizing and blending essence and perfume, and can be applied to the pharmaceutical industry due to the good anti-inflammatory and antifungal activities of sabinene itself.A recombinant vector and an engineering bacterium are obtained by recombination of the rubber tree synthetase gene for synthesizing sabinene, and a sabinene high-yield strain is successfully constructed, and the yield of sabinene in a flask is up to 8 mg / L.The application provides a new synthetase gene element for the biotechnological synthesis of sabinene, is helpful to the industrial application of the biotechnological production of sabinene, and lays a good foundation for the development and utilization of rubber tree gene resources and provides a new application strategy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of natural product biotechnology, and particularly relates to a sabinene synthase gene, a construct and application thereof. BACKGROUND

[0002] Sabinene belongs to monoterpenes, and has a molecular formula of C 10 H 16 , a molecular weight of 136.23, and exists in volatile oils of various plants such as Salvia miltiorrhiza Bunge, Pinus, lemon, rosemary and the like, and endows the plants with unique flavors, fragrances, medicinal physiological activities and the like. Sabinene can be used for raw material development in the fragrance and flavor industry and deployment of high-grade fragrance and flavor, and is widely used in the pharmaceutical industry due to its good anti-inflammatory and antifungal activities. Due to its complex bicyclic structure, sabinene has the advantages of high energy density, low freezing point and high flash point, and can also be used as a raw material for high-grade biofuels, and has important economic value. Sabinene currently mainly exists in plant volatile oils, and due to a low content, difficulty in obtaining and high cost, it is not conducive to large-scale production of sabinene. Chemical synthesis of sabinene has a complicated process and negative impact on the environment. So far, sabinene has not been commercially produced due to no suitable manufacturing process. Biotechnological synthesis of sabinene has broad prospects, but a main reason for generally low yield of microbial synthesis of monoterpenes is lack of efficient monoterpenes synthase. Mining of new sabinene synthase has important research significance for biosynthesis of sabinene and further development value.

[0003] At present, only several sabinene synthases have been cloned and identified from plants, and there are few sabinene synthase gene elements that can be used. The sabinene synthase gene in rubber trees that has been functionally confirmed has not been reported in the literature, and identification of sabinene synthase in rubber trees through gene mining and functional characterization has important value for broadening the research and application of small molecule compounds other than natural rubber in rubber trees.

[0004] The sabinene synthase gene is cloned from rubber trees for the first time, can be used for efficient synthesis of sabinene, and determines the nucleotide sequence and amino acid sequence, fills the blank of sabinene synthesis genes in rubber trees in the prior art, and provides a new usable gene element for biotechnological synthesis of sabinene, which is beneficial to research and application of biotechnological synthesis of sabinene. SUMMARY

[0005] The present application aims at the above-mentioned deficiencies of the prior art, and provides an enzyme as follows:

[0006] a) the enzyme with an amino acid sequence of SEQ ID No. 2;

[0007] b) a protein having rubber tree carene synthase activity obtained by substitution and / or deletion and / or addition of one or several amino acid residues in the amino acid sequence represented by SEQ ID No. 2.

[0008] Secondly, the present application also provides biological materials related to the rubber tree carene synthase, which are any of the following B1) to B8):

[0009] B1) a nucleic acid molecule encoding rubber tree carene synthase;

[0010] B2) an expression cassette containing the nucleic acid molecule of B1);

[0011] B3) a recombinant vector containing the nucleic acid molecule of B1),

[0012] B4) a recombinant vector containing the expression cassette of B2);

[0013] B5) a recombinant microorganism containing the nucleic acid molecule of B1);

[0014] B6) a recombinant microorganism containing the expression cassette of B2);

[0015] B7) a recombinant microorganism containing the recombinant vector of B3);

[0016] B8) a recombinant microorganism containing the recombinant vector of B4);

[0017] Optionally, the vector includes pESC yeast expression vector and transgenic plant expression vector.

[0018] Optionally, the recombinant microorganism includes engineered bacteria or plant cells.

[0019] The recombinant vector and engineered bacteria provided by the present application can be directly cultured, amplified and expressed to obtain rubber tree carene synthase β - oliveene synthase, and the large amount of active rubber tree carene synthase obtained can be used for producing carene.

[0020] Preferably, the nucleic acid molecule is the nucleic acid molecule as shown in 1) or 2) or 3) or 4) below:

[0021] 1) the coding sequence is a DNA molecule or a cDNA molecule of SEQ ID No. 1 in the sequence listing;

[0022] 2) the nucleic acid sequence is a DNA molecule of SEQ ID No. 1 in the sequence listing;

[0023] 3) the nucleotide sequence has 75% or more identity with the nucleotide sequence defined in 1) or 2), and is a cDNA molecule or a genomic DNA molecule encoding the above-mentioned enzyme;

[0024] 4) hybridizes to the nucleotide sequence defined in 1) or 2) under stringent conditions, and encodes a cDNA molecule or a genomic DNA molecule of the above-mentioned enzyme.

[0025] Secondly, the application also provides the application of the rubber tree myrcene synthetase in preparing myrcene.

[0026] The application also provides the application of the above-mentioned biological material in preparing the rubber tree myrcene synthetase or constructing a transgenic plant or producing myrcene.

[0027] In addition, the application also provides a primer pair for amplifying a fragment of a nucleic acid molecule encoding the rubber tree myrcene synthetase.

[0028] Preferably, the amplification primer pair is that the forward primer is as shown in SEQ ID NO. 3, and the reverse primer is as shown in SEQ ID NO. 4.

[0029] The application also provides a production method of myrcene, which utilizes the above-mentioned rubber tree myrcene synthetase to catalyze geranyl pyrophosphate GPP to obtain myrcene.

[0030] The application also provides the application of the rubber tree myrcene synthetase or the above-mentioned biological material in the development of raw materials for fragrances and flavors or the blending of high-grade fragrances and flavors.

[0031] Finally, the application also provides a biosynthetic product for the development or blending of fragrances and flavors, which comprises the rubber tree myrcene synthetase or the above-mentioned biological material.

[0032] Compared with the prior art, the application has the following advantages and beneficial effects:

[0033] (1) The application first discovers a synthetase gene from rubber trees which can efficiently synthesize myrcene, the gene can synthesize myrcene, and the enzyme has good specificity and high purity of target product, and can be applied to the fragrance and flavor industry and the pharmaceutical industry as an aromatic compound.

[0034] (2) The application recombines the rubber tree myrcene synthetase gene to obtain a recombinant vector and an engineering bacterium, and successfully constructs a myrcene production strain, and the yield of the strain in a shaking flask is as high as 8 mg / L, which lays an important foundation for the industrial application of myrcene. BRIEF DESCRIPTION OF DRAWINGS

[0035] FIG. 1 is the GC-MS detection result of the fermentation product of the engineering strain YHbSAS constructed by the application. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the present application more clear, the specific embodiments of the present application are further described in detail below in combination with specific examples and drawings. The specific techniques or conditions not mentioned in the examples are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be obtained by market purchase.

[0037] DNA polymerase, restriction endonuclease and plasmid extraction kit were purchased from Baori Biotechnology (Beijing) Co., Ltd.; RNA extraction kit was purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd.; DNA gel recovery kit and homologous recombination kit were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; pTOPO-Blunt Simple vector was purchased from Beijing Aideley Biotechnology Co., Ltd., and yeast expression plasmid pESC was purchased from Novagen Company; specific gene primer pair P1 / P2 was synthesized by Wuhan Jin Kai Rui Biological Engineering Co., Ltd.

[0038] The detection method of sabinene is as follows: GC-MS detection is carried out by using Thermo TRACE GC Ultra system and TSQ 9000 system. The GC detection program is set as follows: the initial oven temperature is 50℃, which lasts for 1 minute; then it is raised to 280℃ at a speed of 15℃ / minute, which lasts for 1 minute; then it is raised to 300℃ at a speed of 20℃ / minute, which lasts for 2 minutes. The volatile sample is injected at 240℃, and the MS transfer temperature is kept at 270℃. The compound is determined by comparing with the standard product or by comparing with the NIST (National Institute of Standards and Technology) database and the retention index. The standard product sabinene is purchased from Shanghai Taoshu Biological Technology Co., Ltd., and the CAS number is 3387-41-5.

[0039] YPD culture medium: the culture medium components contain 2% glucose (National Pharmaceutical Group), 2% tryptone (Angel Yeast), and 1% yeast extract (Angel Yeast);

[0040] The yeast strain YZL141 is constructed by the method described in Shi Bin et al., “Systematic Metabolic Engineering of Saccharomyces cerevisiae for Lycopene Overproduction.” Journal of agricultural and food chemistry vol. 67, 40 (2019): 11148-11157. doi:10.1021 / acs.jafc.9b04519.

[0041] Rubber tree cDNA: RNA extracted from rubber tree latex and then reverse transcribed into cDNA, the process is usually carried out according to the conventional conditions such as the conditions described in the Guide to Molecular Cloning Experiments (4th Edition) (Chinese version) published by Science Press, or the conditions recommended by the manufacturer, which are well known to those skilled in the art, and the present application does not limit the experimental operation.

[0042] The nucleotide sequence of the rubber tree myrcene synthase gene is shown in SEQ ID NO. 1.

[0043] The amino acid sequence of the rubber tree myrcene synthase provided by the present application is shown in SEQ ID NO. 2.

[0044] The rubber tree myrcene synthase provided by the present application can be used in the production of myrcene. The rubber tree myrcene synthase in the present application can use geranyl pyrophosphate as a substrate to catalyze the synthesis of myrcene, and can be applied to the fragrance and flavor industry.

[0045] The production method of myrcene provided by the present application can use the rubber tree myrcene synthase in the present application to catalyze farnesyl pyrophosphate to obtain myrcene.

[0046] The present application also provides a recombinant vector containing the rubber tree myrcene synthase gene, which recombines the rubber tree myrcene synthase gene in the expression vector to construct a biosynthesis module, which can realize the simple and rapid use of the rubber tree myrcene synthase gene and quickly obtain a large amount of target gene or target protein. In the present application, the expression vector is preferably a pESC yeast expression vector.

[0047] The present application also provides an engineering bacteria containing the rubber tree myrcene synthase gene, which includes the rubber tree myrcene synthase gene and a host cell, and the nucleotide sequence of the rubber tree myrcene synthase gene is shown in SEQ ID NO. 1.

[0048] The rubber tree myrcene synthase gene is introduced into the host cell to quickly obtain a large amount of target gene and target proteinase, and the biosynthesis module composed of the engineering bacteria avoids the cumbersome operation of PCR amplification from the rubber tree genome when the target gene is used. The host cell is preferably a yeast YZL141 strain.

[0049] The present application also provides a plant cell or transgenic plant into which the above-mentioned rubber tree myrcene synthase gene is introduced, and the nucleotide sequence of the rubber tree myrcene synthase gene is shown in SEQ ID NO. 1. As the skilled person in the art is well aware, the rubber tree gene is constructed into a plant expression vector, and the transgenic plant is regenerated by introducing it into the plant cell and callus by Agrobacterium, protoplast and gene gun methods to synthesize and produce myrcene. Example 1

[0050] (1) Gene cloning

[0051] The applicant analyzes the genome of rubber tree and finds a rubber tree monoterpene sylvestrene synthase gene, the amino acid sequence of which is shown as SEQ ID NO. 1, and the nucleotide sequence of which is shown as SEQ ID NO. 2.

[0052] The rubber tree latex sample is collected from the Hairen 7-33-97 clone of the routine tapping in the experimental field of the Chinese Academy of Tropical Agricultural Sciences in Hainan Province. The total RNA extraction kit of Tiangeng Biochemical Technology (Beijing) Co., Ltd. is used for extraction, and then the Fermentas cDNA first strand reverse transcription kit is used for synthesizing cDNA. The primer pair P1-P2 (see Table 1) is used for gene cloning from the latex cDNA template by RT-PCR. The PCR reaction system used is (30 μL): 12.5 μL of water, 10 μL of 2 x PrimerSTAR Max Permix, 1 μL of each of forward and reverse primers (10 μM), and 0.5 μL of cDNA template. The PCR reaction system is: 95℃ for 3 min, 98℃ for 10 s, 58℃ for 20 s, 72℃ for 2 min, 35 cycles, 72℃ for 10 min, and 16℃ for holding. Then the DNA fragment is recovered by using the latex recovery kit of Nanjing Novozyme Biological Technology Co., Ltd., connected to the pTOPO-Blunt Simple vector, transformed into DH5 α The ampicillin resistance screening is performed in the E. coli competence, and after the bacterial liquid PCR verification, the sequencing company is used for sequencing confirmation. After the sequencing confirmation, the target gene is obtained.

[0053] Table 1

[0054] Primer name Sequence (5'-3') P1 SEQ ID NO. 3: GGCCCGGGCGTCGACATGGCCCTTCAATTGCTT P2 SEQ ID NO. 4: CGGATCTTAGCTAGCTTACAGATAGGCAGAAGAAAG

[0055] (2) Recombinant expression vector construction

[0056] After the re-PCR cloning and latex recovery of the correct target gene vector, the homologous recombination kit of Nanjing Novozyme Biological Technology Co., Ltd. is used for connection with the linearized yeast expression vector (37℃, 30 min), and the DH5 α The screening is performed in the E. coli competence, and after the bacterial liquid PCR verification, the yeast expression vector containing the correct target gene is obtained, which is named as pHbSAS1.

[0057] (3) Construction of engineering strain and functional characterization

[0058] ① Preparation of yeast competence

[0059] The YZL141 yeast strain was inoculated in 50 mL fresh YPD medium after overnight culture, and cultured at 30°C until OD600 was about 0.6. After centrifugation at 500 g for 5 min, the cells were suspended in TE / LiAC solution, and then centrifuged at high speed for 5 min. The cells were resuspended in 1 mL TE / LiAC solution to obtain the competent cells.

[0060] 2. Yeast competent transformation

[0061] The above expression vector pHbSaS1 was transformed into YZL141 yeast competent cells by PEG-LiAc method, and placed at 30°C for 30 min, and then heated at 42°C for 10 min. After centrifugation at 500 g for 5 min, the cells were plated on SD-URA selection plates and incubated at 30°C for 3 days. Then, colony PCR was performed using primers P1-P2, and the positive YZL141 transformant was named YHbSAS.

[0062] 3. Functional characterization

[0063] The YHbSAS strain stored at low temperature was inoculated in 50 mL SD-URA deficient medium (containing 1% galactose), and cultured at 30°C for 3 days. The cells were collected by centrifugation at 4000 rpm for 5 min, and then transferred to a sample bottle for GC-MS detection. As shown in FIG. 1 , the main product was identified as sabinene by comparing the retention time and fragment ratio with the standard sabinene. The rubber tree-derived gene contained in the YHbSAS strain was named HbSaS .

[0064] 4. Fermentation evaluation

[0065] After the function of the gene was determined, the YHbSAS strain was inoculated in 50 mL YPD medium using a similar method, and 1% galactose and 1% IPM were added. After incubation at 30°C for 3 days, the organic phase was collected by centrifugation at 4000 rpm for 8 min, and then used for sample preparation and GC-MS detection for quantification. The yield of YHbSAS in a shake flask was 8 mg / L. Example 2

[0066] To evaluate the potential value of sabinene as a fragrance and flavoring agent, the aroma of the molecule was analyzed by a perfumer. Sabinene has a woody, fresh pine tree aroma, and a respiratory comfort aroma. When sabinene is heated, white smoke is produced along with the enhanced odor, which indicates its potential for use as a component of fragrance formulations, and in products such as electronic cigarettes.

[0067] The features in the above examples and in the examples can be combined with each other without conflict.

[0068] The above description is only the preferred embodiment of the present application, and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Use of a rubber tree myrcene synthase in the preparation of myrcene, characterized in that, The amino acid sequence of the rubber tree myrcene synthase is shown in SEQ ID No.

2.

2. Use of a biomaterial in the production of sabinene, characterized in that, The biological material is a nucleic acid molecule of SEQ ID No.

1.

3. A method for producing limonene, characterized by, It comprises a step of catalyzing geranyl pyrophosphate (GPP) to obtain myrcene by using rubber tree myrcene synthase; the amino acid sequence of the rubber tree myrcene synthase is shown in SEQ ID No.

2. The amino acid sequence of the rubber tree myrcene synthase is shown in SEQ ID No.

2. The biological material is a nucleic acid molecule of SEQ ID No.

1. It comprises a step of catalyzing geranyl pyrophosphate (GPP) to obtain myrcene by using rubber tree myrcene synthase; the amino acid sequence of the rubber tree myrcene synthase is shown in SEQ ID No. 2.

Images