BHMT gene molecular marker related to anti-enterocytozoon hepatopenaei disease character of litopenaeus vannamei as well as detection primer and application of BHMT gene molecular marker
Through the SNP molecular marker screening of the BHMT gene of vannerbine shrimp, individuals with resistant shrimp hepatocetesia were quickly and accurately screened, solving the problems of long breeding cycle and low efficiency, and achieving efficient breeding of disease-resistant varieties.
Patent Information
- Application Number
- CN202510640900.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-05-19
AI Technical Summary
The prior art is difficult to effectively solve the infection problem of vannabinoid shrimp hepatoli, resulting in long breeding cycles, low efficiency and difficult to guarantee the genetic stability of traits.
The SNP molecular markers A, B and C of the vannabinoid shrimp BHMT gene were used to design specific primers for PCR amplification and sequencing, and parent individuals resisting shrimp hepatocetesiasis were screened, and the genotypes of BHMT-8159, BHMT-12167 and BHMT-12710 loci were used for breeding selection.
It has achieved rapid and accurate screening of individuals that resist shrimp hepatocetesiasis, improved breeding efficiency and accuracy, ensured the genotype stability of breeding individuals, and supported the cultivation of disease-resistant varieties.
Smart Images

Figure CN120384137A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of Litopenaeus vannamei breeding, and specifically relates to a BHMT gene molecular marker related to the trait of resistance to Enterocytozoon hepatopenaei in Litopenaeus vannamei, as well as its detection primers and applications. Background Art
[0002] Litopenaeus vannamei is one of the most important marine cultured shrimps globally. However, in recent years, the large-scale outbreak of Enterocytozoon hepatopenaei (EHP) has posed a serious threat to the Litopenaeus vannamei aquaculture industry. EHP mainly infects the hepatopancreas and intestine of shrimps, resulting in slow growth, reduced feed conversion rate, decreased disease resistance, and even large-scale death of shrimps, bringing huge economic losses to farmers. Currently, the prevention and control measures against EHP mainly rely on traditional methods such as aquaculture environment regulation, disease-resistant feed additives, and pathogen detection. However, due to the strong host adaptability and hidden transmission of EHP, the above methods are difficult to fundamentally solve the problem of EHP infection. Therefore, breeding new Litopenaeus vannamei varieties with stable EHP-resistant traits has become an urgent need for the industrial development.
[0003] Disease-resistant molecular breeding technology can achieve the directional selection of excellent traits and significantly improve the breeding efficiency by screening molecular markers closely linked to the target traits. Betaine-homocysteine S-methyltransferase (BHMT) is a key enzyme in the body's methyl metabolism pathway. It catalyzes the generation of methionine and dimethylglycine from betaine and homocysteine. Methionine is further converted into S-adenosylmethionine, which is the main donor for the methylation of molecules such as DNA, RNA, and proteins, and is involved in epigenetic regulation and the synthesis of various biomolecules. BHMT participates in regulating important physiological processes such as cellular methylation modification, antioxidant stress, and immune response.
[0004] Currently, the breeding of EHP-resistant Litopenaeus vannamei mainly relies on traditional family selection methods. Due to the lack of accurate molecular marker assistance, the breeding cycle is long, the efficiency is low, and the genetic stability of the target traits is difficult to guarantee. Therefore, screening BHMT gene molecular markers closely linked to the EHP-resistant trait and developing efficient molecular breeding technology have become the key to breaking through the existing breeding bottlenecks. By analyzing the polymorphism of the BHMT gene in Litopenaeus vannamei and identifying specific molecular markers related to the EHP-resistant trait, it can provide important gene resources and technical support for the cultivation of disease-resistant Litopenaeus vannamei varieties, which is of great significance for promoting the sustainable development of the shrimp aquaculture industry.
[0005] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphisms at the genomic level caused by the variation of a single nucleotide. It has the characteristics of high density, wide distribution, co-dominance, and stable inheritance, and is currently the most promising molecular marker. With the rapid development of sequencing and chip technologies, SNP markers have been widely used in research such as the construction of high-density genetic linkage maps, the fine mapping of quantitative traits, and genome-wide association studies. Molecular marker-assisted breeding precisely utilizes the association between molecular markers and the traits of cultured varieties to achieve selective breeding at the gene level, overcoming the disadvantages of low breeding efficiency and large influence of human factors in traditional breeding methods, and greatly improving the accuracy of selection and the breeding cycle. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a BHMT gene molecular marker related to the trait of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei, its detection primers, and applications, which can quickly, accurately, and effectively detect disease-resistant individuals of shrimp using SNP marker detection primers, and have good breeding efficiency and accuracy.
[0007] The technical solution adopted by the present invention to solve the above technical problem is as follows: A BHMT gene molecular marker related to the trait of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei, including at least one of molecular marker A, molecular marker B, and molecular marker C.
[0008] The molecular marker A is named BHMT-8159, and its nucleotide sequence is as shown in SEQ ID NO.1. The mutation type at the 252nd base is T>A.
[0009] The molecular marker B is named BHMT-12167, and its nucleotide sequence is as shown in SEQ ID NO.2. The mutation type at the 93rd base is C>T.
[0010] The molecular marker C is named BHMT-12710, and its nucleotide sequence is as shown in SEQ ID NO.2. The mutation type at the 636th base is G>A.
[0011] The present invention also provides detection primers for the above BHMT gene molecular markers. The primer pair for detecting the above molecular marker A is: the sequence of the forward primer F1 is TACGTCAGCTTCACCGGGAG, and the sequence of the reverse primer R1 is AGGTCGAGAGCTGGTTCCTG.
[0012] The primer pair for detecting the above molecular markers B and C is: the sequence of the forward primer F2 is ACACGATGGGACATGCACAAG, and the sequence of the reverse primer R2 is CACCTCCCTTAGGCTTTGGTC.
[0013] The present invention also provides the application of the detection primers of the BHMT gene molecular markers related to the traits of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei in screening the parents of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei.
[0014] Furthermore, the application is as follows: If the TA genotype at the BHMT-8159 locus, the CT genotype at the BHMT-12167 locus, and the GG genotype at the BHMT-12710 locus are detected in the parents of Litopenaeus vannamei, they are selected as the parents resistant to Enterocytozoon hepatopenaei.
[0015] Furthermore, the specific steps are as follows:
[0016] Step 1: Extract the genomic DNA of the muscle tissue of the Litopenaeus vannamei to be tested.
[0017] Step 2: Using the extracted DNA as a template, perform PCR amplification with the detection primers of the 3 SNP markers, and then sequence the obtained PCR amplification products to determine the genotypes of molecular marker A, molecular marker B, and molecular marker C.
[0018] Step 3: When the genotype of molecular marker A is the TA genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties; when the genotype of molecular marker B is the CT genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties; when the genotype of molecular marker C is the GG genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties.
[0019] Compared with the prior art, the advantages of the present invention are as follows: The BHMT gene molecular markers related to the traits of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei, their detection primers and applications of the present invention, based on the BHMT gene of Litopenaeus vannamei, screen SNP molecular markers related to the traits of Enterocytozoon hepatopenaei, and use the SNP molecular markers as functional markers for the traits of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei for the breeding of Litopenaeus vannamei varieties with good ability to resist Enterocytozoon hepatopenaei. It can be applied to the breeding of new varieties of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei, and the genotypes of the selected individuals are stable and do not undergo genetic differentiation. At the same time, the method of the present invention has good breeding efficiency and accuracy, providing a good basis for the research on the cultivation and improvement of Litopenaeus vannamei varieties. Description of the Drawings
[0020] Figure 1It is a partial fragment sequence of the product obtained by amplifying the BHMT gene in the embodiment. a represents positions 250 - 254 of the amplified product 1 sequence, where the TT and TA peak maps of the BHMT - 8159T>A locus are shown; b represents positions 91 - 95 of the amplified product 2 sequence, where the CC and CT peak maps of the BHMT - 12167C>T locus are shown; c represents positions 634 - 638 of the amplified product 2 sequence, where the GG, AA, and GA peak maps of the BHMT - 12710G>A locus are shown. Detailed implementation mode
[0021] The present invention will be further described in detail below in combination with the accompanying drawings and embodiments. For the specific experimental conditions and methods not specified in the following embodiments, the technical means adopted are usually conventional means well known to those skilled in the art.
[0022] The screening process of the BHMT gene molecular marker related to the trait of Litopenaeus vannamei against Enterocytozoon hepatopenaei is as follows:
[0023] Step 1. Experimental animals
[0024] After selecting 400 Litopenaeus vannamei with a body weight of about 3 grams and mixing and culturing them for 7 days, feed the Litopenaeus vannamei infected with EHP in the Litopenaeus vannamei culture box for artificial EHP infection, and then feed ordinary feed, and the culture lasts for two months. The final body weights of the Litopenaeus vannamei are counted, and 100 Litopenaeus vannamei with a final body weight greater than 8 grams and 100 Litopenaeus vannamei with a final body weight less than 6 grams are respectively selected as samples of the Enterocytozoon hepatopenaei - sensitive group and the Enterocytozoon hepatopenaei - tolerant group of Litopenaeus vannamei.
[0025] Step 2. Experimental methods
[0026] 2.1 Preliminary screening of BHMT gene molecular markers
[0027] Extract the muscle tissues of Litopenaeus vannamei in the sensitive group and the tolerant group, extract genomic DNA using the TIANGEN marine animal tissue genomic DNA kit, and store the obtained genomic DNA at -20 °C for standby. The SNP molecular marker A is located in the third intron region of the BHMT gene, the molecular marker B is located in the eighth exon region of the BHMT gene, and the molecular marker C is located in the ninth exon region of the BHMT gene.
[0028] 2.2 Primer design and amplification
[0029] Taking the Litopenaeus vannamei BHMT genomic data (LOC113817434) in the NCBI database as a reference, amplify partial fragments of the BHMT gene, design primers F1, primer R1, primer F2, and primer R2, and then amplify and screen the SNP loci located in the BHMT gene;
[0030] The sequence of the forward primer F1 is: TACGTCAGCTTCACCGGGAG;
[0031] The sequence of the reverse primer R1 is: AGGTCGAGAGCTGGTTCCTG;
[0032] The sequence of the forward primer F2 is: ACACGATGGGACATGCACAAG;
[0033] The sequence of the reverse primer R2 is: CACCTCCCTTAGGCTTTGGTC;
[0034] The above PCR amplification system 1 consists of the following components: 25 μL of 2×TransStar FastPfu Fly PCR SuperMix, 22 μL of ddH2O, 1 μL of primer F1, 1 μL of primer R1, and 1 μL of DNA template. The above PCR amplification system 2 consists of the following components: 25 μL of 2×TransStar FastPfu Fly PCR SuperMix, 22 μL of ddH2O, 1 μL of primer F2, 1 μL of primer R2, and 1 μL of DNA template.
[0035] The reaction procedures for PCR1 and PCR2 amplifications both include the following steps:
[0036] S1. Pre-denature at 98 °C for 1 min;
[0037] S2. Denature at 98 °C for 10 s, anneal at 60 °C for 5 s, extend at 72 °C for 30 s, and perform 34 cycles;
[0038] S3. Extend at 72 °C for 5 min.
[0039] The PCR amplification products are detected by 1 wt% agarose gel electrophoresis, purified and sequenced, and then the sequencing results are compared and analyzed using Geneious prime software, including nucleotide sequence alignment and peak Figure 1 analysis, and relevant SNPs sites are screened out;
[0040] The nucleotide sequence of PCR amplification product 1 of one of the samples is as shown in SEQ ID NO.1: TACGT CAGCTTCACCGGGAGTTCTTGCGCGCAGGAGCTGACGTCATGCAAGCGTTCACCTTCTACGCCTCAGATGACAAACTGGCCAACAGGGGTAACGAGTCTAGCAAAAAATATACGGTGAGTTTTGTAAAGATTTTTTTGTTTACCTTTTTTTTGGATAGAAGGATTGTTTGTAGAGGTTTGATACCTCTGTTGTCTTGATGAGAAAGTTTTTATTATTATTATTATTATTATTTTAAATAATGTGAATTTCGCGTTAGGAGTTTAAGAAGGATTAGTTGTTTTAGGCCTTGATACCTCTGTCGTCTTAATTTTCTTTCTTATTTATTTTTATTACGATGGAAATTTCACGTTAGGAATTGAAGAAGGATTATTTATTAAGCCTTGATACCTCTCTGTTGTCTTGATGAGAAGAGTTAATTTTTTTTTATAGATATTACGATGGAAATTTGGTGTTAGGAATCGAAAGGGTGTTTATGCAAGCTTGCAATCTATTTCAGTGCCGGGGAATCAACGACGCAGCTTGCAGACTCGCCCGGGAGGTTGCAGAGGAAGGGGATGGCCTGGTTGCCGGAGGACTCTCCCAGACCCCTACCTACCTGTCAGGTGAGTCCCCTACCTGGCTTGCAGGAACCAGCTCTCGACCT. The 252nd position is BHMT-8159 T>A, the base at this site is T or A, and the mutation type is T / T homozygous or T / A heterozygous.
[0041] The nucleotide sequence of PCR amplification product 2 is shown as SEQ ID NO.2 below: ACACGATGGGACATGCACAAGTACGCCCGGGAGTGCTACGATCTCGGCGTCCGCTACATCGGCGGCTGCTGCGGGTTCGAGCCCTACCACATCCGCGCGGTGGCCGAGGAGCTGGCCAAGGAGCGAGGGACGTTCCCCAAGGGCTGCGAGAAGCACGAACCCTGGGCTGGCGGCCTCAAGATGCACACGAAGCCCTGGGTCAGAGCGAGGTGAATGCAGAGCTCTGTGTGTTTGTAATACGGGGTATAACATCACTTTCCAATGGGTGCATATACCGTTTAGACATAAACATAGATGGCGCACACACTATAATATTACAGAATTTAATACATTAACTATTAGACATAAACATAGATGGCGCACACACTATAATATTACAAAATTTAATACATTAACACAATGCAATACAACAGCTCACTTTACACACCATACAACATCGTAGTCACTATCTCTTAACTTTTCATACCTATAAAATCCCGACTTTCCCTTCTCTCTTCCTCAACGAATATTTAAATCCCCAGAGCCGGCCGCGAGTACTGGGAGAACCTCCGCCCTTCCTCCGGCCGCCCCTACAGCGCCGCCATGTCCAAGCCTGACAACTGGGGCGTGACCGCTGGCGACGACATCCTCAAGCAGAAGACCGCAAGCACCACCGAAGACGAGATCAAAATCCTCAAGACCAAGAAGACCAAAGCCTAAGGGAGGTG. Among them, the 93rd position is BHMT-12167C>T, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous; the 636th position is BHMT-12710G>A, the base at this site is G or A, and the mutation types are G / G homozygous, A / A homozygous, G / A heterozygous.
[0042] Step 4: According to the selected SNPs sites, the Litopenaeus vannamei in the sensitive group and the tolerant group are respectively detected and genotyped according to the above method. The samples of different SNP sites in the sensitive group and the tolerant group are counted, the genotype frequencies and allele frequencies are calculated, and the chi-square analysis is used for independence test. The results of the chi-square analysis are shown in Table 1.
[0043] Chi-square analysis results of molecular marker loci of BHMT gene in Table 1
[0044]
[0045] According to the analysis in Table 1, the dominant genotype of molecular marker A is TA genotype, the dominant genotype of molecular marker B is CT genotype, and the dominant genotype of molecular marker C is GG genotype. When molecular marker A is T / A heterozygous (TA), molecular marker B is C / T heterozygous (CT), and molecular marker C is G / G homozygous (GG), select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties. The molecular markers provided by the present invention are closely associated with the anti-EHP trait, significantly improving the breeding efficiency and accuracy, and providing key technical support for the cultivation of disease-resistant Litopenaeus vannamei varieties.
[0046] The above description is not a limitation of the present invention, and the present invention is not limited to the above specific embodiments. Without departing from the essence of the present invention, any modifications, equivalent substitutions, improvements, etc. made by those of ordinary skill in the art shall be included within the protection scope of the present invention.
Claims
1. A molecular marker of the BHMT gene related to the trait of resistance to Enterocytozoon hepatopenaei in Litopenaeus vannamei, characterized in that including at least one of molecular marker A, molecular marker B and molecular marker C, The molecular marker A is named BHMT-8159, and its nucleotide sequence is shown in SEQ ID NO.
1. The mutation type at the 252nd base is T>A. The molecular marker B is named BHMT-12167, and its nucleotide sequence is shown in SEQ ID NO.
2. The mutation type at the 93rd base is C>T. The molecular marker C is named BHMT-12710, and its nucleotide sequence is shown in SEQ ID NO.
2. The mutation type at the 636th base is G>A.
2. The detection primer for the BHMT gene molecular marker according to claim 1, characterized in that: The primer pair for detecting the molecular marker A described in claim 1 is: The sequence of the forward primer F1 is TACGTCAGCTTCACCGGGAG, The sequence of reverse primer R1 is AGGTCGAGAGCTGGTTCCTG; The primer pair for detecting the molecular markers B and C described in claim 1 is: The sequence of the forward primer F2 is ACACGATGGGACATGCACAAG, The sequence of reverse primer R2 is CACCTCCCTTAGGCTTTGGTC.
3. Use of the detection primers for the BHMT gene molecular marker related to the hepatoenteric cytosis resistance trait of Litopenaeus vannamei according to claim 2 in screening parents of Litopenaeus vannamei that are resistant to hepatoenteric cytosis.
4. Use of the detection primer for the BHMT gene molecular marker related to the Litopenaeus vannamei anti-Enterocytozoon hepatopenaei disease trait according to claim 3 in screening the parents of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei, characterized in that The application is: if the vannamei shrimp parent is detected to have the TA genotype at the BHMT-8159 site, the CT genotype at the BHMT-12167 site, and the GG genotype at the BHMT-12710 site, it is selected as a parent resistant to shrimp hepatoenterozoan disease.
5. Use of the detection primer for the BHMT gene molecular marker related to the trait of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei in screening parents of Litopenaeus vannamei resistant to Enterocytozoon hepatopenaei, characterized in that The specific steps are as follows: Step 1, extracting genomic DNA from muscle tissue of the tested Litopenaeus vannamei; Step 2: Using the extracted DNA as a template, PCR amplification is performed using the detection primers for the three SNP markers, and then the obtained PCR amplification products are sequenced to determine the genotypes of molecular marker A, molecular marker B, and molecular marker C; Step 3: When the genotype of molecular marker A is the TA genotype, which is the dominant genotype, the individual is selected as a reserve parent for breeding of Penaeus vannamei varieties; when the genotype of molecular marker B is the CT genotype, which is the dominant genotype, the individual is selected as a reserve parent for breeding of Penaeus vannamei varieties; when the genotype of molecular marker C is the GG genotype, which is the dominant genotype, the individual is selected as a reserve parent for breeding of Penaeus vannamei varieties.
Citation Information
Patent Citations
SNP marker on LvFREP2 gene related to disease resistance of litopenaeus vannamei, detection primer and application of SNP marker
CN114540510A
SNP (Single Nucleotide Polymorphism) marker related to disease resistance character of litopenaeus vannamei, detection primer and application of SNP marker
CN114540511A
Combined molecular marker for litopenaeus vannamei enterocytozoon hepatopenaeus resistance character, KASP detection primer and application
CN116240308A