Fluorescent PCR (Polymerase Chain Reaction) kit for qualitatively detecting vibrio parahaemolyticus and detection method

Abstract

The invention discloses a fluorescent PCR (polymerase chain reaction) kit and a detection method for qualitatively detecting vibrio parahaemolyticus, and belongs to the technical field of microbiological detection, the kit comprises a primer and a probe which are designed aiming at vibrio parahaemolyticus species specificity and highly conservative single-copy beta-lactamase coding gene blaCARB, as well as a positive control, a Super Real PreMix (Probe) and the like. According to the detection method, specific qPCR reaction premixed liquid is prepared, amplification is performed on a fluorescent PCR instrument according to optimized reaction conditions, and rapid qualitative detection of vibrio parahaemolyticus is realized according to an amplification curve. The kit and the detection method are high in specificity, the detection limit of vibrio parahaemolyticus pure bacterial liquid is 32 CFU / mL, the lowest limit of quantitation in actual samples (such as artificially polluted salmon samples) can reach 108 CFU / mL, the kit and the detection method are suitable for detection of clinical samples such as excrement and food samples such as aquatic products, and a powerful tool is provided for food safety guarantee and risk assessment.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and particularly relates to a fluorescence PCR kit and a detection method for qualitatively detecting Vibrio parahaemolyticus. Background Art

[0002] Vibrio parahaemolyticus (VP) is a Gram-negative halophilic pathogen that can grow in an environment containing 0.5%-8% salt, has the characteristic of facultative anaerobiosis, and its morphology mostly appears rod-shaped or curved. This pathogen is widely distributed in seawater, estuaries, silt, and seafood such as fish, shrimp, shellfish, and algae. VP is one of the main pathogens causing human foodborne disease infections. Once people consume aquatic products contaminated by it, not fully cooked, or cross-contaminated, they are extremely likely to cause Vibrio parahaemolyticus food poisoning, which in turn leads to diseases such as gastroenteritis. In China, VP is the primary pathogen causing foodborne diseases, mainly transmitted through seafood such as crustaceans and shellfish. Relevant research shows that when the number of Vibrio parahaemolyticus in food reaches ≥10 6 CFU / mL, it can cause diseases, but currently, there are still many difficulties in its rapid and accurate qualitative detection.

[0003] Currently, the detection of Vibrio parahaemolyticus mainly uses traditional methods, among which the national standard method (national standard method) occupies an important position. The national food safety standard has standardized the traditional detection techniques for foodborne pathogenic bacteria. Taking the qualitative method specified in GB4789.7-2013 as an example, its process mainly includes four links: pre-enrichment, selective isolation, biochemical identification, and serological identification. Although this method is mature and reliable, the operation process is cumbersome, not only consuming a large amount of time and energy, and the entire detection cycle is as long as 6-7 days. If the Kanagawa test is added to determine the virulence of the strain, the total time is even more than 10 days, far from meeting the need for rapid detection of VP.

[0004] In recent years, food poisoning incidents caused by foodborne pathogenic bacteria have occurred frequently. However, although traditional detection methods are relatively mature in technology, they have problems such as cumbersome operation steps, long detection cycles, and poor sensitivity, making it difficult to achieve the purpose of rapid and accurate detection and unable to meet the investigation needs of relevant departments for food safety incidents and the actual needs of the market. In this context, some emerging rapid detection methods have emerged. Among them, molecular biology techniques represented by real-time fluorescence PCR (Quantitative real-time PCR, qPCR), with their advantages of rapidity, accuracy, high efficiency, and precision, have gradually been widely used in the field of rapid detection of pathogenic bacteria. However, the current rapid detection methods for Vibrio parahaemolyticus still need to be further improved and optimized to better ensure food safety. Summary of the Invention

[0005] In view of the above technical problems, the present application provides a fluorescence PCR kit and a detection method for qualitatively detecting Vibrio parahaemolyticus, so as to solve the problems existing in the existing detection technologies, such as cumbersome operation, long detection cycle, low sensitivity, etc., and achieve rapid, accurate, and specific qualitative detection of Vibrio parahaemolyticus, meeting the requirements of clinical and food safety detections.

[0006] In order to achieve the above object, the technical solution adopted by the present application is as follows: A fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus, the kit comprising:

[0007] Primers and probes for qualitatively detecting Vibrio parahaemolyticus, the primers and probes being designed for the single-copy β-lactamase encoding gene blaCARB of Vibrio parahaemolyticus, wherein the primers include blaCARB-F and blaCARB-R, and the probe is blaCARB-P, and their sequences are respectively:

[0008] blaCARB-F: 5’-GACATCTCCCTCATCGAGAAAC-3’;

[0009] blaCARB-R: 5’-CGTTCGTCTCCGCGATAAT-3’;

[0010] blaCARB-P: 5’-[FAM]ACATCTGGGCGAATTGGAGTGTCA[BHQ]-3’;

[0011] A positive control, the positive control being Vibrio parahaemolyticus ATCC17802 genomic DNA with a concentration of 70 ng / μL;

[0012] SuperReal PreMix(Probe).

[0013] In order to better implement the present invention, further, the final concentrations of the primers and probes in the qPCR reaction system are respectively: blaCARB-F 300 nM, blaCARB-R 300 nM, blaCARB-P 250 nM.

[0014] In order to better implement the present invention, further, the qPCR reaction system further includes: 2×SuperRealPreMix(Probe) 12.5 μL, DNA template (with a concentration of 100 - 60 ng / μL) 2 μL, deionized water 8.5 μL, and the total volume is 25 μL.

[0015] To better implement the present invention, further, the qPCR reaction conditions are as follows: pre-denaturation at 95°C for 10 min; then 40 cycles are carried out, and each cycle includes denaturation at 95°C for 10 s and annealing at 60°C for 50 s.

[0016] A detection method for qualitatively detecting Vibrio parahaemolyticus by using the fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus according to any one of the foregoing items, comprising the following steps:

[0017] Add 25 g of the sample into a 225 mL PBS homogenization bag, homogenize, take 1 mL of the homogenate, centrifuge at 10000 rpm for 1 min, discard the supernatant, and extract the DNA of the precipitated bacteria.

[0018] Prepare the qPCR reaction premix according to the reaction system described in claim 3.

[0019] Add the qPCR reaction premix into a 96-well plate, seal the film, and place it on a fluorescence PCR instrument, and carry out the amplification reaction according to the reaction conditions described in claim 4.

[0020] Judge whether Vibrio parahaemolyticus exists in the sample according to the amplification curve.

[0021] If a positive amplification signal appears, it is determined that Vibrio parahaemolyticus exists in the sample.

[0022] If there is no amplification curve, it is determined that Vibrio parahaemolyticus does not exist in the sample.

[0023] To better implement the present invention, further, the DNA of the precipitated bacteria includes clinical samples and food samples.

[0024] The technical solution provided by the present invention has the following beneficial effects compared with the prior art:

[0025] 1. By selecting the single-copy β-lactamase encoding gene blaCARB, which is species-specific and highly conserved in Vibrio parahaemolyticus, as the target sequence to design primers and probes, through experimental verification, this kit and detection method only show positive amplification signals for Vibrio parahaemolyticus standard strains and self-isolated strains, while the detections of other vibrios and common foodborne pathogenic bacteria are all negative, without amplification curves, and can effectively avoid the occurrence of false positive results, with good specificity.

[0026] 2. In the present invention, in the detection of pure Vibrio parahaemolyticus liquid, this method can detect up to 10 -8 dilutions, and the detection limit reaches 32 CFU / mL; in the detection of artificially contaminated salmon samples, the lowest quantification limit can reach 108 CFU / mL, which can meet the requirements of the minimum control levels for Vibrio parahaemolyticus contamination in foods at home and abroad, with high sensitivity, and can effectively detect low-concentration Vibrio parahaemolyticus.

[0027] 3. In the present invention, compared with the detection cycle of the traditional detection method, which is as long as 6 - 7 days or even more than 10 days, the fluorescence PCR detection method of the present invention can complete the detection in a shorter time by optimizing the reaction system and conditions, greatly improving the detection efficiency, and can quickly provide detection results for work such as food safety assurance and risk assessment.

[0028] 4. In the present invention, the kit and the detection method are not only applicable to the detection of Vibrio parahaemolyticus in clinical samples such as feces, but also particularly applicable to the detection of food samples such as aquatic products, and can meet the detection requirements of Vibrio parahaemolyticus in different scenarios, with a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present application. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0030] Figure 1 It is the fluorescence PCR amplification result of 4 sets of primer - probe for Vibrio parahaemolyticus;

[0031] Figure 2A It is the qPCR amplification map of the gradient - diluted pure Vibrio parahaemolyticus bacterial solution;

[0032] Figure 2B It is the standard curve of the gradient - diluted pure Vibrio parahaemolyticus bacterial solution;

[0033] Figure 3 It is the qPCR detection amplification curve of the artificially contaminated salmon sample. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present application clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present application with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are some, but not all, of the embodiments of the present application. Usually, the components of the embodiments of the present application described and illustrated herein can be arranged and designed in various different configurations.

[0035] Therefore, the following detailed description of the embodiments of the present application provided in the drawings is not intended to limit the scope of the present application claimed, but merely represents the selected embodiments of the present application. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present application.

[0036] Such asFigures 1 - 3 As shown in the figure, the present invention provides a fluorescence PCR kit and a detection method for qualitatively detecting Vibrio parahaemolyticus, including

[0037] - Fluorescence PCR kit: A fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus, containing primers and probes for qualitatively detecting Vibrio parahaemolyticus, a positive control, and SuperReal PreMix (Probe). Among them, the primers and probes are designed for the single-copy β-lactamase encoding gene blaCARB (GenBank no. KJ934265.1) of Vibrio parahaemolyticus, and the specific sequences are as follows:

[0038] blaCARB-F: 5’-GACATCTCCCTCATCGAGAAAC-3’;

[0039] blaCARB-R: 5’-CGTTCGTCTCCGCGATAAT-3’;

[0040] blaCARB-P: 5’-[FAM]ACATCTGGGCGAATTGGAGTGTCA[BHQ]-3’.

[0041] The positive control is the genomic DNA of Vibrio parahaemolyticus ATCC17802, and the concentration is set to 70 ng / μL.

[0042] qPCR reaction system: In the qPCR reaction system, the working solution concentrations and loading amounts of each component are as follows: 2×SuperReal PreMix (Probe) 12.5 μL, blaCARB-F (10 μM) 0.75 μL, so that the final concentration reaches 300 nM; blaCARB-R (10 μM) 0.75 μL, the final concentration is 300 nM; blaCARB-P (10 μM) 0.5 μL, the final concentration is 250 nM; DNA template (concentration range is 100 - 60 ng / μL) 2 μL; deionized water 8.5 μL, and the total volume of the reaction system is 25 μL.

[0043] qPCR reaction conditions: The qPCR reaction conditions are as follows: First, perform pre-denaturation at 95 °C for 10 min; then perform 40 cycles of amplification reaction, and each cycle includes denaturation at 95 °C for 10 s and annealing at 60 °C for 50 s.

[0044] - Detection method: A detection method for qualitatively detecting Vibrio parahaemolyticus using the above fluorescence PCR kit, and the specific steps are as follows:

[0045] Extract precipitated bacterial DNA from clinical samples such as feces and food samples such as aquatic products;

[0046] Prepare a reaction premix according to the above qPCR reaction system;

[0047] Add the prepared reaction premix to a 96-well plate, seal the film, and place it on a fluorescence PCR instrument (such as Roche LightCycler 480Ⅱ), and perform an amplification reaction according to the set qPCR reaction conditions;

[0048] Judge whether Vibrio parahaemolyticus exists in the sample according to the amplification curve. If a positive amplification signal appears (i.e., a good "S"-shaped amplification curve appears), it is determined that Vibrio parahaemolyticus exists in the sample; if no amplification curve appears, it is determined that Vibrio parahaemolyticus does not exist in the sample.

[0049] Specific analysis is as follows according to the above fluorescence PCR kit and detection method:

[0050] I. Test strains and culture conditions: A total of 72 strains were used in the experiment, including 2 standard strains of Vibrio parahaemolyticus (ATCC 17802, CGMCC 1.1997), 15 self-isolated strains (isolated from aquatic products), 15 standard / reference strains of other Vibrios, and 26 standard strains of other common foodborne pathogenic bacteria and probiotics. All Vibrio and non-Vibrio strains were activated for 3 generations on T1 N1 agar plates and BHI agar plates respectively, and probiotics were cultured using MRS medium. Single colonies were picked and inoculated into 5 mL of 2% sodium chloride alkaline peptone water, 5 mL of BHI liquid medium, and MRS liquid medium respectively, and cultured with shaking at 37 °C and 110 r / min for 18 h. 1 mL of the bacterial solution was taken for 10-fold serial dilution for subsequent extraction of bacterial genomic DNA.

[0051] Design, screening of qPCR primers and probes

[0052] Design: Select the single-copy β-lactamase encoding gene blaCARB (GenBank no. KJ934265.1) of Vibrio parahaemolyticus as the target sequence, perform sequence analysis and alignment through the NCBI online tool, and use the online website (INTEGRATED DNA TECHNOLOGIES,

[0053] https: / / sg.idtdna.com / site / account / login?returnurl=%2FPrimerquest%2FHome%2FIndex) to design 4 pairs of primer and probe combinations.

[0054] Screening: The overnight culture DNA of Vibrio parahaemolyticus (ATCC 17802) was extracted using a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., product number: DP302). Four sets of primer-probe pairs were used to amplify the extracted DNA. The results showed that one set of primer-probe (i.e., the primer and probe finally adopted) had the best fluorescence signal intensity. Therefore, this set of primer-probe was selected for subsequent detection.

[0055] Specificity analysis of qPCR for detecting Vibrio parahaemolyticus: The genomic DNA of the pure cultures of the above 72 strains of bacteria was extracted using a bacterial genomic DNA extraction kit. The DNA concentration was adjusted to 70 ng / μL and used for qPCR detection respectively. The primer-probe obtained by screening was used, and sterile water was used instead of the template as a negative control.

[0056] The results showed that positive amplification signals appeared in the standard strains of Vibrio parahaemolyticus (ATCC 17802, CGMCC 1.1997) and 15 self-isolated strains, while the detections of other vibrios and common foodborne pathogenic bacteria were all negative without amplification curves, proving that this method has good specificity.

[0057] Detection of pure Vibrio parahaemolyticus liquid

[0058] qPCR detection: The bacterial liquid DNA of the overnight culture of Vibrio parahaemolyticus (ATCC 17802) was extracted using a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., product number: DP302). The extraction steps were carried out according to the kit instructions. Finally, the nucleic acid was dissolved in 100 μL TE buffer. The extracted DNA was diluted 10-fold serially and then subjected to qPCR detection. The results showed that it was detectable at the 10 -8 dilution.

[0059] The qPCR detection results showed a good linear relationship (R2 = 0.999) in the range from the undiluted solution to 10 -6 . The slope of the standard curve was -3.265, and the amplification efficiency reached 102%.

[0060] Plate counting: At the same time, for the 10-fold serially diluted pure Vibrio parahaemolyticus (ATCC17802) liquid, 1 mL of the bacterial suspension was respectively pipetted into sterile petri dishes, and two petri dishes were made for each dilution. Immediately, 15 - 20 mL of plate counting T1N1 agar medium cooled to 46 °C was poured into the petri dishes and the petri dishes were rotated to mix evenly. After the agar solidified, it was incubated at 36 °C in an inverted position for 24 h ± 2 h. The total number of colonies was counted for the plates with the number of colonies between 30 - 300 CFU and no spreading colony growth. The average number of colonies of two plates was taken for each dilution. The original bacterial liquid concentration was measured to be 3.2×10 9CFU / mL. Combining with the qPCR detection results, it can be known that for the pure Vibrio parahaemolyticus solution, the detection limit of fluorescence PCR is 32 CFU / mL.

[0061] Detection of artificially contaminated salmon samples: Salmon samples verified to be free of Vibrio parahaemolyticus by traditional methods were selected as the addition matrix. The overnight culture suspension of Vibrio parahaemolyticus (ATCC17802) was serially diluted 10-fold and plated for counting. At the same time, 1 mL of the bacterial suspensions at 10 -4 、10 -5 、10 -6 dilutions were respectively added to the homogenization bags containing 25 g of salmon samples + 225 mL of PBS. Five sample replicates were set for each addition concentration. Another 25 g of salmon sample was added with 225 mL of PBS instead of the added bacterial suspension as a negative control.

[0062] The above samples were homogenized with a stomacher for 2 min to prepare a series of contaminated samples containing different concentrations of Vibrio parahaemolyticus at a ratio of 1:10. 1 mL of each sample homogenate was used to extract bacterial genomic DNA using a kit (Tiangen Biochemical Technology Co., Ltd., product number: DP302). Finally, the nucleic acid was dissolved in 100 μL of TE buffer for qPCR detection.

[0063] The results showed that the salmon samples at 10 -4 、10 -5 contamination levels showed positive amplification, and 10 -6 showed partial positive amplification. In the actual sample detection, for the salmon samples at 10 -4 、10 -5 contamination levels, the coefficient of variation CV of the determination results of the blaCARB gene of Vibrio parahaemolyticus was less than 20%. The lowest quantification limit of this qualitative detection method could reach 108 CFU / mL, meeting the requirements of the minimum control levels for Vibrio parahaemolyticus contamination in food at home and abroad.

[0064] II. Experimental process

[0065] 1. Materials

[0066] 1.1. Test strains and culture conditions

[0067] A total of 72 strains of bacteria were used (Table 1), including 2 standard strains of Vibrio parahaemolyticus, 15 self-isolated strains, 15 standard / reference strains of other Vibrio species, and 26 standard strains of other common foodborne pathogenic bacteria and probiotics. After activating all Vibrio and non-Vibrio strains for 3 generations on T1 N1 agar plates and BHI agar plates respectively, for probiotics, using MRS medium, single colonies were picked and inoculated into 5 mL of 2% sodium chloride alkaline peptone water, 5 mL of BHI liquid medium, and MRS liquid medium respectively. They were cultured with shaking at 37 °C and 110 r / min for 18 h. 1 mL of the bacterial solution was taken for 10-fold serial dilution, which was used for the extraction of bacterial genomic DNA.

[0068] Table 1 List of strains used in the experiment

[0069]

[0070]

[0071]

[0072] Note: ATCC: American Type Culture Collection; CMCC: China Center for Medical Culture Collections; CGMCC: China General Microbiological Culture Collection Center; BJCIQ: Beijing Entry-Exit Inspection and Quarantine Bureau; CICC: China National Center of Industrial Culture Collection.

[0073] 2. Design of qPCR primers and probes

[0074] To achieve specific and rapid detection of Vibrio parahaemolyticus, we selected the single-copy β-lactamase encoding gene blaCARB (GenBank no. KJ934265.1) with species specificity and high conservation in Vibrio parahaemolyticus as the target sequence. Sequence analysis and alignment were performed using the NCBI online tool, and 4 pairs of primer and probe combinations were designed using the online website (INTEGRATED DNATECHNOLOGIES,

[0075] https: / / sg.idtdna.com / site / account / login?returnurl=%2FPrimerquest%2FHome%2FIndex). The sequences are shown in Table 1. After screening, finally, 1 set of primers / probes with good fluorescence signal, strong specificity, and suitable for qPCR amplification conditions was obtained. The probe was labeled with FAM at the 5' end and BHQ at the 3' end. The primers / probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0076] Table 2 qPCR primer / probe sequences

[0077]

[0078] a) The primer / probe positions refer to the sequence information of GenBank no. KJ934265.1.

[0079] 3. qPCR detection

[0080] 3.1. Preparation of reaction premix

[0081] Prepare 25 μL of qPCR reaction premix according to Table 3.

[0082] Table 3 qPCR reaction system

[0083]

[0084]

[0085] 3.2. Amplification reaction

[0086] Add the amplification system into a 96-well plate, seal the membrane, and place it on a fluorescence PCR instrument (Roche LightCycler 480Ⅱ) for amplification reaction. The amplification conditions are shown in Table 4.

[0087] Table 4 qPCR reaction conditions

[0088]

[0089] 4. Screening of primers and probes for qPCR detection of Vibrio parahaemolyticus

[0090] Extract the DNA of the overnight culture of Vibrio parahaemolyticus (ATCC 17802) using a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., product number: DP302). Amplify the extracted DNA using 4 sets of primer-probe pairs. The amplification results show that the fluorescence signal intensity of FRP3 is the best. The results are shown in Figure 1 , and select FRP3 as the proposed fluorescence probe.

[0091] 5. Specificity analysis of qPCR detection of Vibrio parahaemolyticus

[0092] Extract the genomic DNA of the pure cultures of the strains listed in Table 1 using a bacterial genomic DNA extraction kit, adjust the DNA concentration to 70 ng / μL, and use them for qPCR detection respectively. Use the FRP3 primer-probe, and at the same time use sterile water instead of the template as a negative control to determine the specificity of this method. The results show that positive amplification signals appear in the standard strains of Vibrio parahaemolyticus (ATCC 17802, CGMCC1.1997) and 15 self-isolated strains, while the detections of other Vibrio species and common foodborne pathogenic bacteria are all negative without amplification curves. It is proved that this method has good specificity.

[0093] 6. Detection of pure Vibrio parahaemolyticus culture

[0094] 6.1 qPCR detection

[0095] The overnight culture of Vibrio parahaemolyticus (ATCC17802) was used to extract the DNA of the bacterial solution with a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., product number: DP302). The extraction steps were carried out according to the kit instructions, and finally the nucleic acid was dissolved in 100 μL TE buffer. The extracted DNA was diluted 10-fold serially, and then qPCR detection was performed. The results showed that it could be detected at a dilution of 10 -8 dilution ([[]] Figure 2A ). qPCR showed a good linear relationship in the range from the undiluted solution to 10 -6 (R 2 = 0.999), the slope of the standard curve was -3.265, and the amplification efficiency reached 102%([[]] Figure 2B ).

[0096] 6.2 Plate counting

[0097] At the same time, for the pure Vibrio parahaemolyticus (ATCC17802) culture diluted 10-fold serially, 1 mL of the bacterial suspension was respectively pipetted into sterile petri dishes, and two petri dishes were made for each dilution. Immediately, 15 - 20 mL of plate counting T1N1 agar medium cooled to 46 °C was poured into the petri dishes, and the petri dishes were rotated to mix evenly. After the agar solidified, it was incubated at 36 °C in an inverted position for 24 h ± 2 h. The total number of colonies was counted for the plates with colony numbers between 30 - 300 CFU and no spreading colony growth. The average number of colonies of two plates should be taken for each dilution. The results showed that the concentration of the original bacterial solution was 3.2×10 9 CFU / mL, while fluorescence PCR detection could detect up to a dilution of 10 -8 . Thus, it can be seen that for the pure Vibrio parahaemolyticus culture, the detection limit of fluorescence PCR is 32 CFU / mL.

[0098] 7. Detection of artificially contaminated salmon samples

[0099] Salmon samples verified to be free of Vibrio parahaemolyticus by traditional methods were selected as the addition matrix. The overnight culture suspension of Vibrio parahaemolyticus (ATCC 17802) was diluted 10-fold serially and plate counted. At the same time, 10 -4 , 10 -5 , 10 -61 mL of the dilution bacterial liquid was added to a homogenization bag containing 25 g of salmon samples + 225 mL of PBS respectively. Five sample replicates were set for each added concentration. Another 25 g of salmon samples were added with 225 mL of PBS instead of the added bacterial liquid as a negative control. The above samples were homogenized with a beating homogenizer for 2 min to prepare a series of contaminated samples containing different concentrations of Vibrio parahaemolyticus at a ratio of 1:10. 1 mL of the homogenate of each sample was used to extract bacterial genomic DNA by using a kit (Tiangen Biochemical Technology Co., Ltd., product number: DP302). Finally, the nucleic acid was dissolved in 100 μL of TE buffer for qPCR detection to observe the detection effect in actual samples.

[0100] According to the plate counting results of the added bacterial liquid, it was estimated that the content of Vibrio parahaemolyticus in the 10 -4 to 10 -6 bacterial liquid contaminated samples was 1.08×10 3 ~1.08×10 1 CFU / mL. It was found that the salmon samples at the contamination levels of 10 -4 and 10 -5 all showed positive amplification, and 10 -6 showed partial positive amplification. The qPCR amplification curve is as Figure 3 shown. In the actual sample detection, for the salmon samples at the contamination levels of 10 -4 and 10 -5 the coefficient of variation CV of the determination results of the blaCARB gene of Vibrio parahaemolyticus was less than 20%. The lowest quantitative limit of this qualitative detection method could reach 108 CFU / mL, meeting the requirements of the minimum control levels for Vibrio parahaemolyticus contamination in foods at home and abroad.

[0101] Table 5 Qualitative detection results of Vibrio parahaemolyticus in artificially contaminated salmon samples by qPCR

[0102]

[0103] [Appendix] Kit composition:

[0104] This kit includes primers and probes for the qualitative detection of Vibrio parahaemolyticus, a positive control (genomic DNA of Vibrio parahaemolyticus ATCC 17802, 70 ng / μL), and SuperReal PreMix (Probe) (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0105] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. A fluorescence PCR kit for qualitative detection of Vibrio parahaemolyticus, characterized in that, The kit comprises: Primers and probes for qualitatively detecting Vibrio parahaemolyticus, which are designed for the single-copy β-lactamase encoding gene blaCARB of Vibrio parahaemolyticus. The primers include blaCARB-F and blaCARB-R, and the probe is blaCARB-P. Their sequences are respectively: blaCARB-F: 5’-GACATCTCCCTCATCGAGAAAC-3’; blaCARB-R: 5’-CGTTCGTCTCCGCGATAAT-3’; blaCARB-P: 5’-[FAM]ACATCTGGGCGAATTGGAGTGTCA[BHQ]-3’; A positive control, which is the genomic DNA of Vibrio parahaemolyticus ATCC17802 with a concentration of 70 ng / μL; SuperReal PreMix(Probe).

2. The fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus according to claim 1, wherein The final concentrations of the primers and the probe in the qPCR reaction system are respectively: blaCARB-F 300 nM, blaCARB-R 300 nM, and blaCARB-P 250 nM.

3. A fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus according to claim 1, wherein, The qPCR reaction system further comprises: 12.5 μL of 2×SuperReal PreMix(Probe), 2 μL of DNA template (with a concentration of 100 - 60 ng / μL), and 8.5 μL of deionized water, with a total volume of 25 μL.

4. A fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus according to any one of claims 1-3, characterized in that, The qPCR reaction conditions are: pre-denaturation at 95 °C for 10 min; then 40 cycles are carried out, and each cycle includes denaturation at 95 °C for 10 s and annealing at 60 °C for 50 s.

5. A detection method for qualitatively detecting Vibrio parahaemolyticus using a fluorescence PCR kit for qualitatively detecting Vibrio parahaemolyticus according to any one of claims 1-4, characterized in that, It includes the following steps: Extracting the DNA of the sample to be detected; Preparing a qPCR reaction premix according to the reaction system described in claim 3; Adding the qPCR reaction premix into a 96-well plate, sealing the film, and placing it on a fluorescence PCR instrument to carry out an amplification reaction according to the reaction conditions described in claim 4; Judging whether Vibrio parahaemolyticus exists in the sample according to the amplification curve, If a positive amplification signal appears, it is determined that Vibrio parahaemolyticus exists in the sample; If there is no amplification curve, it is determined that Vibrio parahaemolyticus does not exist in the sample.

6. The detection method for qualitatively detecting Vibrio parahaemolyticus according to claim 5, wherein, The sample to be detected includes clinical samples and food samples.

Images