Novel yeast belonging to genus Leucosporidium and method for preparing oil and fat using same

By cultivating Leucosporidium golubevii yeast, especially IS-300 strains, in sugar-containing medium, the problem of low temperature limitation of yeast is solved, and efficient oil production under medium temperature conditions is achieved. The prepared oil can be used in a variety of industrial applications.

CN120390804APending Publication Date: 2025-07-29IDEMITSU KOSAN CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202380088160.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-23
Filing Date
2023-12-22
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

The high productivity of the existing yeasts of Leucosporidium is the most effective but the low temperature limits its industrial application, especially when the growth temperature is higher than 20°C, resulting in low production efficiency.

Method used

Leucosporidium golubevii yeast, especially IS-300 strains, is used to culture in a culture medium containing sugar, with a culture temperature of 10°C to 30°C, preferably 25°C to 30°C, to improve the oil production efficiency and recover the oil and fat.

Benefits of technology

By improving temperature resistance, IS-300 plants significantly proliferate and produce oils under medium temperature conditions, reducing cooling energy demand, increasing growth rate and oil production speed. The prepared oils can be used in biofuels, bionaphthala oil, food oils, lubricating oils and surfactants, etc.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120390804A_ABST
    Figure CN120390804A_ABST
Patent Text Reader

Abstract

Provided is a method for producing an oil or fat, said method being characterized in that a yeast belonging to Leucosporidium golubevii, in particular a Leucosporidium golubevii IS-300 (NITE BP-03675) strain or a sibling strain thereof, is cultured in a culture medium containing a sugar to produce an oil or fat from the sugar, and the obtained oil or fat is recovered.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for producing oil using yeast and a novel yeast used therein. Background Art

[0002] Conventionally, vegetable oils and animal fats have been widely used as raw materials for green fuels, but competition with food and the destruction of tropical rainforests due to oil palm and coconut plantations are regarded as problems.

[0003] Therefore, oil production from microalgae or oil production from lignocellulosic biomass such as agricultural residues by heterotrophic microorganisms (yeast, mold) has attracted attention. However, the problem is that both are costly, and in order to solve this problem, it is necessary to improve the production efficiency of raw materials (oil yield per sugar) in oil production by heterotrophic microorganisms.

[0004] As described in Non-Patent Citation Document 1, it has been reported that Leucosporidium creatinivorum belonging to the genus Leucosporidium has a high oil production ability among many yeasts, but the problem is that the growth temperature of yeasts belonging to the genus Leucosporidium is relatively low (about 20°C).

[0005] Prior Art Documents

[0006] Patent Documents

[0007] Patent Document 1: Filippucci et al. Biotechnol Biofuels (2016) 9:259, DOI10.1186 / s13068-016-0672-1 Summary of the Invention

[0008] Problems to be Solved by the Invention

[0009] As described above, it has been reported that some strains of yeasts belonging to the genus Leucosporidium have high oil productivity, but they are cold-loving and have problems in industrial application.

[0010] Therefore, the problem of the present invention is to provide a method for producing oil using mesophilic yeasts that are advantageous for industrial production among yeasts belonging to the genus Leucosporidium, and to provide a novel yeast strain that can be used in this method.

[0011] Means for Solving the Problems

[0012] The inventors of the present invention conducted in-depth research to solve the above problems and found that yeasts belonging to Leucosporidium golubevii are excellent in the preparation of oils and fats. Moreover, it was found that among the strains belonging to Leucosporidium golubevii, there are strains with relatively high temperature tolerance. In particular, it was found that the IS-300 strain, a novel oil-producing yeast strain, has higher temperature tolerance compared to other yeast species of the genus Leucosporidium and actively proliferates and produces oils and fats even under the culture conditions of 28°C. Based on this knowledge, the present invention was completed.

[0013] The present invention provides a method for preparing oils and fats, which is characterized by culturing yeasts belonging to Leucosporidium golubevii in a medium containing sugar to produce oils and fats from the sugar, and recovering the obtained oils and fats.

[0014] Here, the aforementioned medium containing sugar may be a medium containing saccharides of lignocellulosic biomass.

[0015] In addition, the culture temperature may be 10°C to 30°C, or may be 25°C to 30°C.

[0016] In addition, the sugar concentration in the medium may be 50 g / L to 500 g / L, or may be 200 g / L to 500 g / L.

[0017] In addition, the aforementioned yeasts belonging to Leucosporidium golubevii may be the Leucosporidium golubevii IS-300 (NITE BP-03675) strain or its related strains, and the related strains may be strains having a base sequence of the 5.8S rDNA region and the ITS1 region and the ITS2 region that is 95% or more identical to SEQ ID NO: 1 and having an oil and fat production ability at 28°C equivalent to that at 24°C.

[0018] In addition, the present invention provides the Leucosporidium golubevii IS-300 (NITE BP-03675) strain as a novel yeast strain excellent in oil and fat production.

[0019] The oils and fats obtained by the preparation method of the present invention can be used as raw materials for biofuels, bio-naphtha, food oils, lubricating oils, or surfactants.

[0020] In addition, the present invention relates to the oils and fats prepared by the aforementioned preparation method and biofuels or bio-naphtha using the oils and fats as raw materials.

[0021] Advantages of the Invention

[0022] By applying Leucosporidium golubevii, particularly Leucosporidium golubevii strain IS-300, oils and fats can be effectively prepared using sugars such as biomass saccharified liquid as raw materials. In particular, since strain IS-300 has high temperature tolerance, by culturing strain IS-300 or its related strains for the fermentative production of oils and fats, the cooling energy during culturing can be inhibited. In addition, an effect of increasing the growth rate and the oils and fats production rate by raising the culturing temperature can be expected, and oils and fats can be effectively prepared.

[0023] The oils and fats produced by the method of the present invention can be used not only as raw materials for biofuels and bio-naphtha with a GHG reduction effect, but also as raw materials for food oils, lubricant bases, and surfactants with less environmental impact. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Microscopic image (photo) of strain IS-300.

[0025] Figure 2 A diagram showing the taxonomic position of the novel oil-producing yeast Leucosporidium golubevii strain IS-300 in the molecular phylogenetic tree (5.8S rDNA and ITS sequences, NJ method) of the genus Leucosporidium. The GenBank Accession numbers of the DNA sequences used in the phylogenetic analysis are shown in the figure. The numbers at each node are bootstrap values for 1,000 trials.

[0026] Figure 3 A diagram showing the dry cell weight and the amount of oils and fats produced per 24 hours at 24°C for each strain of the genus Leucosporidium.

[0027] Figure 4 A diagram showing the dry cell weight and the amount of oils and fats produced per 24 hours at 28°C for each strain of the genus Leucosporidium.

[0028] Figure 5 A diagram showing the time-course change in the dry cell weight during flask culture in the study of the nitrogen source type based on the CYM medium.

[0029] Figure 6 A diagram showing the time-course change in the amount of oils and fats produced during flask culture in the study of the nitrogen source type based on the CYM medium.

[0030] Figure 7 A diagram showing the time-course change in the dry cell weight during flask culture under each condition of changing the nitrogen source based on the YSM medium. ​​​​​​​

[0031] Figure 8 Graph showing the time-course changes in the oil production during flask cultivation under various conditions with the nitrogen source changed based on the YSM medium.

[0032] Figure 9 Graph showing the time-course changes in the dry cell weight during flask cultivation in the study of the ammonium sulfate concentration based on the CYM medium.

[0033] Figure 10 Graph showing the time-course changes in the oil production during flask cultivation in the study of the ammonium sulfate concentration based on the CYM medium.

[0034] Figure 11 Graph showing the time-course changes in the dry cell weight during 250 mL fermenter cultivation in the study of various carbon sources based on the CYM medium.

[0035] Figure 12 Graph showing the time-course changes of each carbon source during 250 mL fermenter cultivation in the study of various carbon sources based on the CYM medium.

[0036] Figure 13 Graph showing the time-course changes in the oil production during 250 mL fermenter cultivation in the study of various carbon sources based on the CYM medium.

[0037] Figure 14 Graph showing the time-course changes in the dry cell weight and oil production during 2 L fermenter cultivation using molasses.

[0038] Figure 15 Graph showing the time-course changes in the sucrose concentration, glucose concentration, and fructose concentration during 2 L fermenter cultivation using molasses.

[0039] Figure 16 Graph showing the time-course changes in the dry cell weight during 250 mL fermenter cultivation in the study of the culture temperature conditions.

[0040] Figure 17 Graph showing the time-course changes in the glucose concentration during 250 mL fermenter cultivation in the study of the culture temperature conditions.

[0041] Figure 18 Graph showing the time-course changes in the oil production during 250 mL fermenter cultivation in the study of the culture temperature conditions.

[0042] Figure 19 Graph showing the time-course changes in the dry cell weight during 2 L fermenter cultivation in the study of the culture pH conditions.

[0043] Figure 20 ​​​​​​​​​​​​​A graph showing the study of the culture pH conditions and the time-course change of glucose concentration in 2 L fermenter culture.

[0044] Figure 21 A graph showing the study of the culture pH conditions and the time-course change of oil production in 2 L fermenter culture.

[0045] Figure 22 A graph showing the study of the initial glucose concentration and the time-course change of dry cell weight in 250 mL fermenter culture.

[0046] Figure 23 A graph showing the study of the initial glucose concentration and the time-course change of glucose concentration in 250 mL fermenter culture.

[0047] Figure 24 A graph showing the study of the initial glucose concentration and the time-course change of oil production in 250 mL fermenter culture.

[0048] Figure 25 A graph showing the study of the initial glucose concentration and the comparison of sugar-oil yields due to the difference in glucose concentration at the initial stage of culture.

[0049] Figure 26 A graph showing the study of the initial glucose concentration (high concentration) and the time-course change of dry cell weight in 250 mL fermenter culture.

[0050] Figure 27 A graph showing the study of the initial glucose concentration (high concentration) and the time-course change of glucose concentration in 250 mL fermenter culture.

[0051] Figure 28 A graph showing the study of the initial glucose concentration (high concentration) and the time-course change of oil production in 250 mL fermenter culture.

[0052] Figure 29 A graph showing the study of the initial glucose concentration (high concentration) and the comparison of sugar-oil yields due to the difference in glucose concentration at the initial stage of culture. Detailed implementation mode

[0053] The method for preparing oil of the present invention is characterized in that yeast belonging to Leucosporidium golubevii is cultured in a medium containing sugar to produce oil from the sugar, and the obtained oil is recovered.

[0054] Oil is also called acylglycerol. As long as the type of oil is produced by fermentation of sugar by yeast belonging to Leucosporidium golubevii, there is no particular limitation. The oil contains triacylglycerol, diacylglycerol, and monoacylglycerol.​​​​​​​​​

[0055] There is no particular limitation on the yeast classified as Leucosporidium golubevii in taxonomy. Preferably, strain IS-300 (NITE BP-03675) is used.

[0056] Leucosporidium golubevii strain IS-300 was isolated from the flowers of Gnaphalium affine in Kisarazu City, Chiba Prefecture, Japan. On June 24, 2022, it was internationally deposited at the Patent Microorganisms Depository of the National Institute of Technology and Evaluation (Room 122, 2-5-8, Kamigeneralizume, Kisarazu City, Chiba Prefecture, Japan) under the Budapest Treaty with the deposit number NITE BP-03675. The colony is white, shiny, smooth, and forms a viscous substance on YPD agar medium. The cells are oval and form oil droplets ( Figure 1 ).

[0057] In the base sequence of the DNA encoding the rRNA of strain IS-300, the base sequences of the 5.8S rDNA region, ITS1 (internal transcribed spacer 1) region, and ITS2 (internal transcribed spacer 2) region are shown in SEQ ID NO: 1.

[0058] In the method for preparing the oil and fat of the present invention, related strains of strain IS-300 can also be used. Related strains of strain IS-300 can be used, and their oil and fat production ability at medium temperature (for example, 28°C) is equivalent to that at low temperature (for example, 24°C). Here, the oil and fat production ability at 28°C being equivalent to that at 24°C means that the amount of oil and fat produced when a related strain of strain IS-300 is cultured in a sugar-containing medium at 28°C is 50% or more, preferably 80% or more, of the amount of oil and fat produced when the same strain is cultured in the same sugar-containing medium at 24°C during the same period.

[0059] In addition, "related strain" means a strain in which the base sequences of the 5.8S rDNA region, ITS1 region, and ITS2 region are 95% or more, preferably 98% or more, more preferably 99% or more identical to SEQ ID NO: 1.

[0060] The related strain can be a naturally occurring strain or a strain bred from strain IS-300 by mutation or the like. Such related strains include Leucosporidium golubevii CBS 9652.

[0061] The culture medium contains sugar, and there is no particular limitation as long as it is a culture medium in which Leucosporidium golubevii can grow.

[0062] The sugar can be a monosaccharide or a polysaccharide. In addition, the culture medium may contain a raw material containing sugar, that is, a sugar-containing raw material.

[0063] As a specific sugar, there is no particular limitation as long as it is a sugar that can be recycled by Leucosporidium golubevii. Various sugars can be used. For example, glucose, sucrose, fructose, xylose, mannose, soluble starch, glycerol, mannitol, etc. can be listed.

[0064] As sugar-containing raw materials, molasses and saccharified products of lignocellulosic biomass are listed. Here, as lignocellulosic biomass, herbaceous biomass such as bagasse, corn stover, wheat straw, rice straw, switchgrass, pearl millet, sugarcane grass, bamboo grass, miscanthus, etc., and lignaceous biomass such as waste wood, wood chips, bark, old paper, etc. can be preferably used. In addition, lignocellulosic biomass contains cellulose and hemicellulose (hereinafter sometimes simply referred to as celluloses), and the celluloses can be decomposed into sugars such as glucose and xylose by glucoamylase according to a conventional method and used as sugar-containing raw materials.

[0065] The concentration of sugar in the culture medium is preferably 50 g / L to 500 g / L, more preferably 60 g / L to 420 g / L, and further preferably 100 g / L to 420 g / L. In addition, when the culture medium contains a sugar-containing raw material, the sugar concentration converted from the concentration of the sugar-containing raw material is adjusted to the above range.

[0066] The IS-300 strain can recycle high-concentration sugar. Therefore, in the case of culturing the IS-300 strain or its related strain, the sugar concentration in the culture medium can be 200 g / L to 500 g / L or 200 g / L to 400 g / L. Thereby, the concentration of the produced oil can be increased, and the preparation efficiency of the oil can be improved.

[0067] The culture medium preferably further contains a nitrogen source. The nitrogen source is not particularly limited. For example, yeast extract, malt extract, meat extract, peptone, casein amino acid, corn steep liquor, etc. can be used. The nitrogen source can be ammonium sulfate, urea, potassium nitrate, etc.

[0068] As components other than these, inorganic salts such as magnesium salts (magnesium sulfate heptahydrate, etc.), calcium salts (calcium chloride, etc.), phosphates (potassium phosphate, etc.), iron salts (iron sulfate, etc.), copper salts (copper sulfate, etc.), sodium salts (sodium chloride, etc.) are preferably contained.

[0069] Generally, for high oil production, a high C / N ratio (the ratio of nitrogen to carbon source in the culture medium, carbon source amount / nitrogen source amount) is desired. However, yeast belonging to the genus Leucosporidium is hardly affected by the C / N ratio in oil production, and any nitrogen concentration at which the yeast can grow is acceptable without particular limitation. For example, the C / N ratio (the ratio of carbon molar concentration to nitrogen molar concentration) is preferably 10 to 300, more preferably 10 to 150, further preferably 10 to 100, and particularly preferably 30 to 100.

[0070] The culture temperature is not particularly limited as long as it is a temperature at which yeast belonging to Leucosporidium golubevii can grow. For example, it is preferably 10°C to 30°C, more preferably 20°C to 30°C, and further preferably 20 to 28°C. Since the IS-300 strain can grow at medium temperature, in the case of culturing the IS-300 strain or its related strains, the culture temperature can be 25°C to 30°C. By culturing at 20°C to 28°C, there are advantages of inhibiting the growth of contaminants and improving the culture efficiency.

[0071] The pH of the culture medium is not particularly limited as long as it is a pH at which strains belonging to Leucosporidium golubevii can grow. For example, it is preferably pH 3.5 to 7.0, more preferably pH 3.5 to 6.0, and further preferably pH 4.0 to 6.0.

[0072] The culturing method of Leucosporidium golubevii is not particularly limited. The cells can be directly inoculated into the culture medium for culturing, or the pre-culture solution obtained by pre-culturing can be inoculated into the liquid medium for culturing. Alternatively, the strains cultured on the solid medium can be inoculated into the liquid medium for culturing. Known culture media used in the culturing of conventional yeast can also be used. For example, PDA medium, YPD medium, etc. can be used.

[0073] The culturing method is not particularly limited as long as it is a method at which strains belonging to Leucosporidium golubevii can grow. For example, it can be carried out by stirring culture, shaking culture, static culture, etc. In addition, examples of the culture mode include batch culture, fed-batch culture, continuous culture, etc.

[0074] The culturing time of the strains belonging to Leucosporidium golubevii can be determined according to the desired amount of oil. For example, it can be 1 day or more, preferably 4 days or more. In the case of long-term culturing, it is preferable to add sugar during the culturing process. The upper limit of the culturing period is not particularly limited. For example, it can be within 30 days.

[0075] The method for recovering oil from the cultured cells can be carried out by conventional well-known methods. For example, it can be carried out as follows: First, the cells are separated and recovered from the culture solution by centrifugation, filtration, etc., and the oil is extracted from the cells with an organic solvent such as n-hexane.

[0076] A step of purifying the obtained oil can also be carried out. The purification step can purify the oil by concentrating it, or can purify a single component in the oil. For example, industrial oil purification methods such as removing the precipitated colloid by adding water or acid to the fraction containing oil obtained in the above recovery step, or removing free fatty acids by adding alkali and decolorizing with activated clay can be applied. In addition, the components can be further finely separated and purified by repeated silica gel chromatography.

[0077] The obtained oil can be used as edible oil as it is or after purification, and can also be used as a raw material for biofuels, bio-naphtha, lubricants, or surfactants, etc.

[0078] By applying biomass such as edible sugars, molasses, and saccharides of lignocellulosic biomass as raw materials in the method of the present invention, and transesterifying the obtained oil with methanol (FAME as the product), biodiesel can be obtained. In addition, by hydrodeoxygenating the obtained oil and then isomerizing it, and decomposing it as needed (HVO, HEFA as the products), biodiesel, bio-jet fuel, and bio-naphtha can be obtained. By co-processing the obtained oil with a petroleum purification hydrogenation treatment device and petroleum-based raw materials, diesel, jet fuel, kerosene, gasoline, etc. as mixtures with petroleum-based fuels can be obtained.

[0079] As a lubricant, for example, it can be used as a lubricant base material or an additive, and can be obtained by carrying out the method of the present invention with the obtained oil as it is, or by partially hydrogenating the unsaturated bond part, or by generating fatty acids and alkylating them, etc.

[0080] As a surfactant, for example, anionic surfactants such as fatty acid metal salts can be cited, and can be obtained by generating fatty acids from the obtained oil and neutralizing them by carrying out the method of the present invention.

[0081] Examples

[0082] Hereinafter, the present invention will be specifically described by way of examples, but the present invention is not limited to the following modes.

[0083] Example 1

[0084] <1> Obtaining of IS-300 strain

[0085] The IS-300 strain was obtained from the flowers of Gnaphalium affine in Kisarazu City, Chiba Prefecture, Japan, using the ability to produce oil from sugar as an index.

[0086] In the base sequence of the DNA encoding the rRNA of the IS-300 strain, the base sequences of the 5.8S rDNA region, the ITS1 (internal transcribed spacer 1) region, and the ITS2 (internal transcribed spacer 2) region were analyzed using a DNA sequencer, and a phylogenetic analysis was performed in combination with the sequence data of other strains of the genus Leucosporidium registered in the existing database. As a result, the 5.8S rDNA region, the ITS1 region, and the ITS2 region of the IS-300 strain were 100% identical to those of the CBS 9651 strain, which is the type strain of Leucosporidium golubevii, and formed a monophyletic group with the Leucosporidium golubevii CBS 9652 strain ( Figure 2 ). In addition, there was only one base difference between the IS-300 strain and the CBS 9652 strain. Therefore, the IS-300 strain was identified as Leucosporidium golubevii. In addition, as described later, the growth at 28°C and the oil production ability of the CBS 9651 strain were different from those of the IS-300 strain. Therefore, although the sequences of the 5.8S rDNA region, the ITS1 region, and the ITS2 region were identical, the IS-300 strain was a different strain from the CBS 9651 strain.

[0087] The base sequences of the 5.8S rDNA region, the ITS1 region, and the ITS2 region of the novel Leucosporidium golubevii IS-300 strain and Leucosporidium golubevii CBS9652 are shown below.

[0088] >Leucosporidium golubevii.IS-300

[0089] GTGAATATTAGCGCATCTCTTCGGAGAGCGTGACCTCCACTTTCTAACTCTGTGCATTTATTTGGCGGCTCTGAAGATGTAACAGTCTACTTAGCTGCGGCTCATTTTATAACACTAGTTAAAGTATGTAACGAAATATCGAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTTGCTCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCGTGGTATTCCGCGGAGCATGTCTGTTTGAGTGTCATGAACTCTTCAACCCACCAGTTTCTTGTAAATTGGATTGGTGTTTGGATTTTGAGTGTTGCTATTCCTAGTTGAATCAGCTCATTCGTAATATATTAGCATCTCTAATTCGAACTCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACACGCTCTTTGTAGTGTGGCCGAATGAGATCTCAGTAGAAGCTTCCAACTACTTTAGTCAACTTTAGA (SEQ ID NO: 1)

[0090] >Leucosporidium golubevii.CBS9652

[0091] GTGAATATTAGCGCATCTCTTCGGAGAGCGTGACCTCCACTTTCTAACTCTGTGCATTTATTTGGCGGCTCTGAAGATGTAACAGTCTACTTAGCTGCGGCTCATTTTATAACACTAGTTAAAGTATGTAACGAAATATCGAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTTGCTCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCGTGGTATTCCGCGGAGCATGTCTGTTTGAGTGTCATGAACTCTTCAACCCACCAGTTTCTTGTAAATTGGATTGGTGTTTGGATTTTGAGTGTTGCTATTCCTAGTGAATCAGCTCATTCGTAATATATTAGCATCTCTAATTCGAACTCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACACGCTCTTTGTAGTGTGGCCGAATGAGATCTCAGTAGAAGCTTCCAACTACTTTAGTCAACTTTAGA (SEQ ID NO: 2)

[0092] Example 2

[0093] <2> Comparison with other Leucosporidium species

[0094] Each yeast strain grown on PDA (Potato Dextrose Agar) medium was inoculated into YPD medium dispensed in a 14 ml PS tube and cultured with shaking at 24 °C and 200 rpm for 48 hours (pre-culture). The pre-culture solution was inoculated into 100 ml of YPD modified medium placed in a 500 ml baffled flask so that the final concentration OD 600 = 0.1, and cultured with shaking at 160 rpm (main culture). At this time, the culture temperature was set at 24 °C and 28 °C, and an antifoaming agent (Antifoam 204, SIGMA) was added as needed. 1 ml of the sample was taken every 24 hours from the start of the main culture and used for the determination of dry cell weight and lipid quantification.

[0095] The composition of each medium is as follows.

[0096] PDA medium

[0097] Potato Dextrose Broth (Difco) 24 g

[0098] Agar (Wako) 20 g

[0099] Distilled water 1 L

[0100] YPD medium

[0101] Bacto peptone (Difco) 20 g

[0102] Yeast extract (Difco) 10 g

[0103] Glucose (Wako) 20 g

[0104] Distilled water 1 L

[0105] Modified YPD medium

[0106] Bacto peptone (Difco) 10 g

[0107] Yeast extract (Difco) 10 g

[0108] Glucose (Wako) 60 g

[0109] Distilled water 1 L

[0110] The samples were centrifuged (700 g, 5 minutes), and the obtained precipitate was dried overnight using a freeze dryer. After measuring the dry cell weight, it was used in the measurement of lipid production. The lipid amount was measured by the following method.

[0111] To inactivate lipase in the dry cells, 260 μl of distilled water and 40 μl of 10× D-PBS (Wako) were added, and the cells were resuspended and boiled for 10 minutes. 100 μl of 25 mg / ml Zymolyase solution (Nacalai Tesque, Zymolyase-20T) was added, and after incubation with shaking at 35°C for 1 hour, 200 μl of glass beads (Merck, G8772-500G) and 500 μl of hexane were added, and the mixture was stirred for 1 hour (TAITEC, E-36, maximum speed). Centrifugation was performed (10,000 g, 10 minutes), and the hexane layer was transferred to a new microtube. Then, 500 μl of hexane was added again, and the mixture was stirred for 1 hour. The hexane layer obtained by centrifugation (10,000 g, 10 minutes) was added to the microtube. The lipid amount in the obtained hexane extract was measured by the enzyme reaction method (LaboAssay Triglyceride, Wako, 290-63701).

[0112] Figure 3 and Figure 4 Show the dry cell weight and lipid production per 24 hours of each strain.

[0113] It was confirmed that all strains except L. drummii CBS 11562 proliferated vigorously and produced high amounts of oil at 24 °C ( Figure 3 ). On the other hand, it was confirmed that the proliferation of all strains except Leucosporidium golubevii CBS9652 and IS-300 was significantly inhibited at 28 °C, but the proliferation of the IS-300 strain and CBS962 strain was only slightly inhibited, and they also produced high amounts of oil ( Figure 4 ).

[0114] Example 3

[0115] Study on the types of nitrogen sources added to the CYM medium of the IS-300 strain

[0116] [Test tube culture (pre-culture)]

[0117] In 3 mL each of the modified YPD113 medium (10 g / L bacterial yeast extract, 10 g / L bacterial tryptone, 30 g / L glucose) placed in a 15 mL polystyrene (PS) tube (φ17 mm × 100 mm) from Asone Corporation, the cells of the oleaginous yeast IS-300 strain grown on a YPD agar plate were gently scraped with the tip of a disposable loop and inoculated. The TAITEC ROTARY SHAKER NR-2 set in the SANYO INCUBATOR MIR-253 was set to approximately 200 rpm and rotary culture was carried out at 28 °C for 2 days of pre-culture.

[0118] [Study on the types of nitrogen sources based on the CYM medium in 500 mL baffled Erlenmeyer flask culture (main culture)]

[0119] Prepare the CYM medium and the medium in which ammonium sulfate in the CYM medium composition is changed to urea or potassium nitrate (Table 1). The addition amounts of ammonium sulfate, urea, or potassium nitrate are added in such a way that the nitrogen concentrations are the same. When preparing the medium, each medium is adjusted to pH 5.5 with 6N KOH, quantified to a specified amount, and filter sterilized through a MF filter with a pore size of 0.22 μm. Thereafter, 100 mL each is aseptically dispensed into a sterilized 500 mL baffled Erlenmeyer flask. The turbidity (OD600 nm value) of the pre-culture solution in the test tube was measured with a spectrophotometer, and after inoculating an amount with an OD600 nm value of 0.05 at the start of the main culture, rotary culture was carried out at 28 °C and a speed of 180 rpm.

[0120] [Table 1]

[0121]

[0122] Figure 5 Show the dry cell weight of the IS-300 strain, Figure 6 Show the time-course change in the amount of oil produced. Under the conditions where ammonium sulfate, urea, and potassium nitrate are used as added nitrogen sources, respectively, cell growth and oil production can be confirmed.

[0123] Example 4

[0124] Study on the types of added nitrogen sources based on the YSM medium for the IS-300 strain

[0125] Pre-culture was carried out under the same conditions as in Example 3. In the main culture, YSM medium was prepared, and the amount of ammonium sulfate nitrogen (N) in the YSM medium composition was uniformly changed to the media of urea and potassium nitrate as other nitrogen sources (Table 2). Each medium was prepared in the same manner as in Example 3, and rotary culture in a baffled Erlenmeyer flask was carried out under the same culture conditions.

[0126] [Table 2]

[0127]

[0128] Figure 7 Show the dry cell weight of the IS-300 strain, Figure 8 Show the time-course change in the amount of oil produced. Under the conditions where ammonium sulfate, urea, and potassium nitrate are used as added nitrogen sources, respectively, cell growth and oil production can be confirmed.

[0129] Example 5

[0130] Study on the ammonium sulfate concentration in the medium for the IS-300 strain

[0131] [Study on the ammonium sulfate concentration (main culture) based on the CYM medium in 500 mL baffled Erlenmeyer flask culture]

[0132] Pre-culture was carried out under the same conditions as in Example 3. In the main culture, CYM medium (ammonium sulfate concentration 0.1 g / L, nitrogen concentration 0.103 g / L, C / N ratio = 273) was prepared, and the ammonium sulfate in the CYM medium composition was set to 10 times the concentration (ammonium sulfate concentration 1.0 g / L, nitrogen concentration 0.294 g / L, C / N ratio = 96), and 100 times the concentration (ammonium sulfate concentration 10 g / L, nitrogen concentration 2.202 g / L, C / N ratio = 13) of the medium (Table 3). In addition, the C / N ratio described here represents the ratio of the carbon molar concentration to the nitrogen molar concentration. Each medium was prepared in the same manner as in Example 3 except for the medium composition, and rotary culture in a baffled Erlenmeyer flask was carried out under the same culture conditions.

[0133] [Table 3]

[0134]

[0135] Figure 9 Show the dry cell weight of the IS-300 strain under the culture conditions of each ammonium sulfate concentration, Figure 10 Show the time-course change of the oil production amount. Under the condition where the ammonium sulfate concentration is 10-fold concentration (ammonium sulfate concentration 1.0 g / L, nitrogen concentration 0.294 g / L, C / N ratio = 96), compared with the basic condition (ammonium sulfate concentration 0.1 g / L, nitrogen concentration 0.103 g / L, C / N ratio = 273), more than a 2-fold increase was observed in the oil production amount.

[0136] Example 6

[0137] Confirmation of oil production from each carbon source type during the fermenter culture of the IS-300 strain

[0138] [Test tube culture (pre-culture)]

[0139] In 3.5 mL each of the YEL medium (5 g / L bacterial yeast extract, 30 g / L glucose) placed in a 15 mL polystyrene (PS) tube (φ17 mm×100 mm) of Asone Corporation, scrape slightly with the tip of a disposable loop and inoculate each oleaginous yeast cell grown on a YPD agar plate. Set the multi-well shaking incubator MLU-4-GR-16 of Iwashiya BioScience Corporation to 140 rpm and perform rotary culture at 28 °C for 2 days.

[0140] [Comparison of oil productivity from each carbon source during 250 mL fermenter culture (main culture)]

[0141] Use a 250 mL 8-connected culture tank Bio Jr.8 manufactured by ABLE-Biott for the fermenter and use compressed air for aeration. In each main culture tank, prepare 95 mL of various CYM modified media (Table 4, autoclaved) with glucose, xylose, arabinose, and glycerol as carbon sources respectively. At this time, the carbon source concentration is approximately 60 g / L (after inoculation). Mix the test tube culture solutions, inoculate 5 mL of the pre-culture solution into each main culture tank, and then start subculture at 22 °C. Perform automatic control of the stirring speed (DO cascade control) with the lower limit of the stirring speed being 300 rpm and the lower limit of DO being 2 ppm. The aeration condition is 100 mL / min (1 vvm). After the start of the culture, automatically control with 0.5 N KOH with the lower limit of pH 5.0, and in the case where the pH increases, manually control with 0.1 N H2SO4 using an external peristaltic pump to reduce it to the set pH. The main culture continues for 168 - 216 hours.

[0142] [Table 4]

[0143]

[0144] Figure 11 、 Figure 12 and Figure 13 respectively show the time-course changes in the dry cell weight of the IS-300 strain, the concentration of each carbon source, and the oil production amount under each carbon source condition (only the arabinose concentration was not measured). In all cultures using C6 sugar glucose, C5 sugar xylose and arabinose, and in addition glycerol as carbon sources, cell growth and oil production were confirmed. Under the condition of using C6 sugar glucose as the carbon source, the fastest cell growth and oil production and high oil production amount were shown.

[0145] Example 7

[0146] Confirmation of oil production from molasses in the fermentor culture of the IS-300 strain

[0147] [Test tube culture (seed culture)]

[0148] In 3.5 mL each of YEL medium (5 g / L bacterial yeast extract, 30 g / L glucose) placed in a 15 mL polystyrene (PS) tube (φ17 mm×100 mm) from Asone Corporation, the cells of the oleaginous yeast IS-300 strain grown on a YPD agar plate were gently scraped with the tip of a disposable loop and inoculated. The TAITEC ROTARY SHAKER NR-2 set in the SANYO INCUBATOR MIR-253 was set to approximately 200 rpm and rotary culture was carried out at 28 °C. Pre-culture was carried out for 2 days.

[0149] [Flask culture (pre-culture)]

[0150] The test tube culture solutions were mixed, and 5 mL each of the seed culture solution was inoculated into 100 mL of YEL medium (5 g / L bacterial yeast extract, 30 g / L glucose) placed in a 500 mL baffled Erlenmeyer flask. The Iwashiya BioScience multi-tank shaking incubator MLU-4-GR-16 was set to 180 rpm and cultured at 28 °C for 2 days.

[0151] [Confirmation of oil production from molasses in 2 L fermentor culture (main culture)]

[0152] The fermenter used was a 2 L culture tank Bioneer-Neo 2 L manufactured by Marubishi Bioengineering Co., Ltd. In the main culture tank, 950 mL of CYM modified medium using molasses as the sugar source was prepared. The CYM modified medium had the same composition as in Example 6. At this time, the sugar source concentration was approximately 60 g / L (total value of glucose, fructose, and sucrose). After inoculating 50 mL of the preculture solution into the main culture tank, fed-batch culture was started at 22 °C. The agitation speed was automatically controlled (DO cascade control) with a lower limit of 300 rpm and a DO lower limit of 24% (approx. 2 ppm). The aeration condition was 1 L / min (1 vvm). After the start of the culture, automatic control was performed at pH 5.0 using 1.0 N KOH and 0.1 N H2SO4.

[0153] Figure 14 and Figure 15 respectively show the time-course changes in the dry cell weight of strain IS-300, each sugar (sucrose, glucose, fructose), and oil production under the condition of using molasses as the sugar source. Bacterial cell growth and oil production were also observed under the condition of using molasses as the carbon source. The change in sugar concentration was shown, where the sucrose concentration decreased first after the start of the culture, followed by the glucose concentration, and finally the fructose concentration.

[0154] Example 8

[0155] Study on the culture temperature during fermenter culture

[0156] [Test tube culture (preculture)]

[0157] As seed culture, preculture in test tubes was carried out under the same conditions as in Example 6.

[0158] [Study on the culture temperature during 250 mL fermenter culture (main culture)]

[0159] The fermenter and aeration used were the same as those in Example 6. In each main culture tank, 95 mL of CYM modified medium using reagent glucose as the sugar source was prepared. The CYM modified medium had the same composition as in Example 6. At this time, the sugar concentration was approximately 60 g / L (after inoculation). The culture temperature conditions were 10, 12, 16, 20, 24, 28, 30, and 32 °C. After mixing the test tube culture solutions and inoculating 5 mL of the preculture solution into each main culture tank, fed-batch culture was started under each temperature condition. The DO and agitation speed conditions were the same as in Example 6. The main culture continued until 144 hours.

[0160] Figure 16 、 Figure 17 and Figure 18The time-dependent changes in dry cell weight, glucose, and oil production of the IS-300 strain under various temperature conditions are shown. Cell growth and oil production were observed within the culture temperature range of 10°C to 30°C, while the oil production rate and oil production were good within the 20°C to 28°C range. No oil production was observed at a culture temperature of 32°C.

[0161] Example 9

[0162] Study on the Culture pH in Fermenter Culture

[0163] [Test tube culture (seed culture), flask culture (pre-culture)]

[0164] Under the same conditions as in Example 7, seed culture and pre-culture were carried out using test tubes and flasks.

[0165] [Cultivation in 2L fermenter (main culture)]

[0166] The fermentation tank and gas supply were the same as those used in Example 7. 950 mL of CYM modified medium containing reagent glucose as the sugar source was added to the main culture tank. The CYM modified medium had the same composition as in Example 6. At this time, the sugar concentration was approximately 60 g / L (after inoculation). The culture pH conditions were pH 3.5, 4.0, 4.5, 5.0, 5.5, and pH 6.0. After 50 mL of the preculture solution was inoculated into the main culture tank, batch culture at 22°C was started. The stirring speed was automatically controlled (DO cascade control) with a lower limit of 300 rpm and a lower limit of DO of 24% (approximately 2 ppm). The aeration condition was 1 L / min (1 vvm). After the start of culture, automatic control was performed so that the pH conditions for each study were achieved using 1.0 N KOH and 0.2 N H2SO4.

[0167] Figure 19 、 Figure 20 and Figure 21 The time-dependent changes in dry cell weight, glucose concentration, and oil production of the IS-300 strain at various culture pH conditions are shown. Cell growth and oil production were observed at all culture pH conditions. At a culture pH of 3.5, glucose consumption tended to be slightly slower.

[0168] Example 10

[0169] Study on the initial sugar concentration of the culture medium in fermenter culture (reagent glucose concentration range below 240 g / L)

[0170] [Test tube culture (pre-culture)]

[0171] As pre-culture, test tube culture was performed under the same conditions as in Example 6.

[0172] [Cultivation (main cultivation) in a 250 mL fermenter]

[0173] Use the same fermenter and gas supply as in Example 6. The initial sugar (glucose) concentration conditions of the medium are 60 g / L (reference), 100 g / L, 140 g / L, 180 g / L, 210 g / L, and 240 g / L. Take the medium composition conditions with a reagent glucose concentration of 60 g / L (after inoculation) in the CYM medium of Example 6 as the reference. For media with other glucose concentrations, set the conditions such that the concentrations of other medium components increase according to the increase in glucose concentration corresponding to the reference (glucose concentration 60 g / L). Pour 95 mL of each of these media into a 250 mL culture tank. Mix the test tube culture solution, inoculate 5 mL of the pre-culture solution into each main culture tank, and then start the sub-cultivation under each sugar concentration condition. The conditions of pH, DO, and stirring speed are the same as in Example 6. The main cultivation continues for 144 - 240 hours.

[0174] Figure 22 , Figure 23 and Figure 24 respectively show the time-course changes of the dry cell weight, glucose concentration, and oil production of the IS-300 strain under each glucose concentration condition. In the range of glucose concentration from 60 g / L to 240 g / L, cell growth and oil production are observed. In addition, Figure 25 shows the sugar-oil yield (relative value compared to the cultivation with 60 g / L glucose) under each initial glucose concentration condition.

[0175] Example 11

[0176] Study on the initial sugar concentration of the medium in fermenter cultivation (high concentration)

[0177] [Test tube cultivation (pre-cultivation)]

[0178] As the pre-cultivation, carry out test tube cultivation under the same conditions as in Example 6.

[0179] [Cultivation (main cultivation) in a 250 mL fermenter]

[0180] The fermenter used for gas supply was the same as that in Example 6. The initial sugar (glucose) concentration conditions of the medium were 60 g / L (reference), 240 g / L, 300 g / L, 360 g / L, 420 g / L, and 480 g / L. The medium composition conditions with a reagent glucose concentration of 60 g / L (after inoculation) in the CYM medium of Example 6 were used as the reference. For media with other glucose concentrations, the conditions were set such that the concentrations of other medium components increased according to the increase in glucose concentration corresponding to the reference (glucose concentration of 60 g / L). 95 mL of each of these media was put into each 250 mL culture tank. The test tube culture solution was mixed, and after inoculating 5 mL of the pre-culture solution into each main culture tank, the subculture under each sugar concentration condition was started. The conditions for pH, DO, and stirring speed were the same as those in Example 6. The main culture continued for 192 - 360 hours.

[0181] Figure 26 , Figure 27 and Figure 28 respectively show the time-course changes in the dry cell weight, glucose concentration, and oil production of the IS-300 strain under each initial glucose concentration condition. In the range of glucose concentration from 60 g / L to 420 g / L, cell growth and oil production were observed. Under the condition of a glucose concentration of 480 g / L, no oil production was seen. In addition, Figure 29 shows the sugar-to-oil yield (relative value compared to the culture with glucose at 60 g / L) under each glucose concentration condition.

Claims

1. A method for preparing oil and fat, characterized in that, A yeast belonging to Leucosporidium golubevii is cultured in a sugar-containing medium to produce oil from the sugar, and the obtained oil is recovered.

2. The method for preparing the grease according to claim 1, wherein, The sugar-containing medium is a medium containing a saccharified product of lignocellulosic biomass.

3. The preparation method of the grease according to claim 1, wherein, The culture temperature is 10°C to 30°C.

4. The preparation method of the grease according to claim 1, wherein, The culture temperature is 25°C to 30°C.

5. The method for preparing the grease according to claim 1, wherein, The sugar concentration is 50 g / L to 500 g / L.

6. The preparation method of the grease according to claim 1, wherein, The sugar concentration is 200 g / L to 500 g / L.

7. A method for preparing the oil or fat according to any one of claims 1 to 6, wherein, The yeast belonging to Leucosporidium golubevii is the Leucosporidium golubevii IS-300 (NITE BP-03675) strain or a related strain thereof.

8. The method for preparing the grease according to claim 7, wherein, The related strain is a strain in which the base sequences of the 5.8S rDNA region, ITS1 region, and ITS2 region are 95% or more identical to SEQ ID NO: 1 and the oil production ability at 28°C is equivalent to the oil production ability at 24°C.

9. The method for preparing the oil or fat according to any one of claims 1 to 8, wherein, The oil is a raw material for biofuel, bio-naphtha, food oil, lubricating oil, or surfactant.

10. An oil, which is prepared by the method according to any one of claims 1 to 8.

11. A biofuel or bio-naphtha, which uses the oil according to claim 10 as a raw material.

12. The Leucosporidium golubevii IS-300 (NITE BP-03675) strain.