Method for rapidly creating tobacco nuclear male sterile line and application
The SNP sites of tobacco plants were detected by KASP primer combination, and the nucleus male sterile lines and maintenance lines were quickly screened, solving the problems of low breeding efficiency and unstable seed quality in tobacco breeding, and achieving the judgment of seedling breeding and efficient breeding.
Patent Information
- Application Number
- CN202510568396.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-01
AI Technical Summary
The lack of excellent nucleus male sterile lines in tobacco breeding makes it difficult to guarantee seed quality and low breeding efficiency. Inbred line cultivation has problems such as impure and inconsistent varieties. Relying on artificial pollination costs and high resource consumption.
Molecular labeling screening technology was used to detect the SNP sites of tobacco plants using KASP primers combination, and quickly screen out the nucleus male sterility and maintenance lines. New F2 tobacco plants were obtained through hybridization and self-breeding, and the seedling breeding judgment was achieved.
It significantly reduces the cost and time of infertility lines creation, improves breeding efficiency, provides efficient breeding judgment methods, and is suitable for large-scale tobacco breeding.
Smart Images
Figure CN120391322A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of tobacco breeding, and particularly relates to a method for rapidly creating a tobacco genic male sterile line and its application. Background Art
[0002] Tobacco is one of the main cash crops. Currently, there are still the following problems in the tobacco seed industry: First, due to factors such as the lack of fundamental breakthroughs in the basic research of tobacco male sterility, it is difficult to protect the intellectual property rights of tobacco inbred lines, resulting in the long-term existence of follow-up and imitative breeding phenomena in the tobacco seed industry in recent years, and the slow breeding efficiency of major new varieties. Second, in the cultivation of tobacco inbred lines, there is a problem of farmers saving seeds themselves, resulting in non-standard production varieties, low purity and poor consistency of the tobacco leaf varieties purchased, affecting the formula application of cigarette industrial enterprises and the stability of cigarette product quality. Third, the tobacco seed production industry is still in a labor-intensive stage relying mainly on artificial pollination, with high costs, huge resource consumption, and it is difficult to guarantee the seed quality.
[0003] Compared with other model plants such as rice and corn, there is still a certain gap in the utilization of heterosis in tobacco, mainly lacking excellent sterile lines. The male sterile line is an important material for the utilization of crop heterosis and hybrid seed production, mainly including cytoplasmic male sterility (CMS) and genic male sterility (GMS). CMS is jointly controlled by mitochondrial genes and nuclear genes. Although it has been applied in tobacco breeding and hybrid seed production, there is currently only one available sterile cytoplasm, and there are also problems such as low resource utilization rate, single sterile cytoplasm, and susceptibility to diseases. GMS is controlled solely by nuclear genes and can overcome the defects of CMS, but it is difficult to mass-produce homozygous sterile lines through conventional breeding methods. In recent years, with the progress of biotechnology, the tobacco multi-control sterility technology and the plant general dominant sterility technology created by combining genetic engineering and molecular design breeding can effectively solve the problems of maintaining and propagating tobacco recessive genic male sterile lines. An important prerequisite for realizing the above technical applications is to obtain a large number of GMS genes with clear functions controlling tobacco male development and corresponding male sterile materials.
[0004] For the traditional method of transferring sterile lines, through hybridization and backcrossing, and planting the offspring materials, after the plants bloom, then according to the fertility observation, the target single plants are selected. The number of offspring materials to be planted is large and the time is long. Using modern molecular markers to conduct genotype selection at the seedling stage can greatly reduce the input of financial resources, material resources, labor, etc. in the selection process and improve the accuracy of selection, which is the key to modern hybrid breeding and seed production.
[0005] Single nucleotide polymorphisms (SNPs) are widely distributed in the genome and are the most common form of genetic variation among plant individuals. Common SNPs include base substitutions, transversions, insertions, and deletions. Most of the SNPs widely distributed in the genome do not directly determine the phenotype, but because they are tightly linked to the loci that determine the phenotype, they can be developed into important molecular markers. SNPs have become one of the most ideal molecular markers for the genetic study of complex traits in plants.
[0006] Kompetitive Allele Specific PCR (KASP) is used to genotype SNPs by specific matching of the terminal bases of primers. The basic principle is that two primers with different terminal bases carry fluorescent adapter sequences respectively. According to the different fluorescent signals carried by the amplification products, a large number of samples can be quickly detected and their genotypes can be accurately judged. Since its emergence, KASP technology has quickly occupied the market with its extremely high flexibility, accuracy, and cost-effectiveness and plays an important role in crop assisted breeding.
[0007] Currently, there is no report on the use of co-dominant KASP markers for selection in the backcross transfer of the nuclear male sterility gene in tobacco. Summary of the Invention
[0008] In view of the above technical problems, the present invention provides a method and application for quickly creating a tobacco nuclear male sterile line.
[0009] The technical solution adopted by the present invention is specifically as follows:
[0010] A method for quickly creating a tobacco nuclear male sterile line, the method comprising:
[0011] (1) Hybridizing a first parental tobacco plant and a second parental tobacco plant to obtain an F1 tobacco plant;
[0012] The first parental tobacco plant is an NtCYP704B1-T / S double mutant sterile line tobacco plant in which both the NtCYP704B1-T and NtCYP704B1-S gene fragments are homozygously mutated; the second parental tobacco plant is a tobacco plant in which both the NtCYP704B1-T and NtCYP704B1-S gene fragments are wild-type;
[0013] The genotype of the first parental tobacco plant is gmst38gmst38 / gmss38gmss38; the genotype of the second parental tobacco plant is GMST38GMST38 / GMSS38GMSS38; the genotype of the F1 tobacco plant is GMST38gmst38 / GMSS38gmss38;
[0014] (2) Self-cross the F1 tobacco plants to obtain F2 tobacco plants, and use molecular markers to screen. At the seedling stage of the F2 tobacco plants, a new sterile line with the genotype gmst38gmst38 / gmss38gmss38, a maintainer line with the genotype gmst38gmst38 / GMSS38 gmss38, or a maintainer line with the genotype GMST38gmst38 / gmss38gmss38 is screened out.
[0015] Further, in step (2), the molecular marker screening uses a primer combination to detect the seedling stage materials of the F2 tobacco plants; the primer combination is a PCR primer combination or a KASP primer combination.
[0016] Further, the PCR primer combination includes a first PCR primer group and a second PCR primer group;
[0017] The first PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.1-3; the second PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.4-6.
[0018] Further, the KASP primer combination uses the KASP38_T / S primer group;
[0019] The KASP38_T / S primer group includes a KASP38_T primer group and a KASP38_S primer group; the KASP38_T primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.3; the KASP38_S primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.6.
[0020] Further, in step (2), the molecular marker screening uses a kit to detect the seedling stage materials of the F2 tobacco plants; the kit includes the PCR primer combination or the KASP primer combination.
[0021] Further, in the first parental tobacco plant, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.
[0022] Further, the second parental plant includes any one of the tobacco cultivars of K326, Honghuadajinyuan, Yunyan 85, Yunyan 87, Yunyan 97, Yunyan 97, Yunyan 100, Yunyan 105, Yunyan 116, NC89, Zhongyan 100, and Cuibi No. 1.
[0023] Application of a newly created male sterile line in tobacco nucleus created by a method for rapidly creating a male sterile line in tobacco nucleus. Using the newly created male sterile line obtained by the method as the female parent, crossing with the second parental tobacco plant to obtain a new F1 tobacco plant, self-crossing the new F1 tobacco plant to obtain a new F2 tobacco plant, and using molecular marker screening to detect the seedling stage materials of the new F2 tobacco plant; screening out a sterile line with the genotype of gmst38gmst38 / gmss38gmss38 and other traits similar to the second parental tobacco plant at the seedling stage of the new F2 tobacco plant;
[0024] The molecular marker screening is detected using a primer combination; the primer combination is a PCR primer combination or a KASP primer combination;
[0025] The PCR primer combination includes a first PCR primer group and a second PCR primer group; the first PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.1-3; the second PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.4-6.
[0026] The KASP primer combination uses the KASP38_T / S primer group; the KASP38_T / S primer group includes the KASP38_T primer group and the KASP38_S primer group; the KASP38_T primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.3; the KASP38_S primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.6.
[0027] Further, using the newly created male sterile line obtained by the method as the female parent and the maintainer line obtained by the method as the male parent for crossing to obtain the next generation of male sterile line and maintainer line, where the male sterile line can be used for hybrid seed production.
[0028] The beneficial effects of the present invention are:
[0029] The method provided by the present invention uses molecular marker screening to judge the fertility of tobacco materials at the seedling stage, provides an efficient method for creating tobacco male sterile lines, and has broad application prospects;
[0030] The present invention provides a PCR primer combination and a KASP primer combination for detecting markers and performing seedling stage identification. The operation method is simple, with high efficiency and short time, significantly reducing the costs of manpower, material resources, time, etc. in the creation of male sterile lines, and having important application value in the cultivation of tobacco male sterile lines and hybrid seed production. Description of the Drawings
[0031] Figure 1 It is the result of SNP genotype typing using the KASP primer combination of the present invention.
[0032] Figure 2 It is the result of screening male sterile lines and maintainer lines from the F2 progeny segregation population using the KASP primer combination of the present invention.
[0033] Figure 3 It is the anther of the NtCYP704B1-T / S double mutant male sterile line in the embodiment of the present invention.
[0034] Figure 4 It is the endothecium of the anther of the NtCYP704B1-T / S double mutant male sterile line in the embodiment of the present invention.
[0035] Figure 5 It is the anther of the wild type of tobacco inbred line K326 in the present invention.
[0036] Figure 6 It is the endothecium of the anther of the wild type of tobacco inbred line K326 in the present invention. Detailed Embodiments
[0037] The present invention will be further described in detail below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments.
[0038] For the specific technologies or conditions not specified in the following embodiments, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained by purchase.
[0039] Embodiment 1: A method for rapidly creating a tobacco nuclear male sterile line, the method comprising:
[0040] (1) Hybridizing a first parental tobacco plant and a second parental tobacco plant to obtain an F1 tobacco plant;
[0041] The first parental tobacco plant is an NtCYP704B1-T / S double mutant sterile line tobacco plant with homozygous mutations in both the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) gene fragments; the second parental tobacco plant is a tobacco plant with wild-type NtCYP704B1-T and NtCYP704B1-S gene fragments;
[0042] The genotype of the first parental tobacco plant is gmst38gmst38 / gmss38gmss38; the genotype of the second parental tobacco plant is GMST38GMST38 / GMSS38GMSS38; the genotype of the F1 tobacco plant is GMST38gmst38 / GMSS38gmss38;
[0043] (2) Self-cross the F1 tobacco plants to obtain F2 tobacco plants, and use molecular markers to screen. At the seedling stage of the F2 tobacco plants, a new sterile line with the genotype gmst38gmst38 / gmss38gmss38, a maintainer line with the genotype gmst38gmst38 / GMSS38 gmss38, or a maintainer line with the genotype GMST38gmst38 / gmss38gmss38 is screened out.
[0044] In step (2) of this example, the molecular marker screening uses a primer combination to detect the seedling stage materials of the F2 tobacco plants; the primer combination is a PCR primer combination or a KASP primer combination.
[0045] The PCR primer combination includes a first PCR primer group and a second PCR primer group; the first PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.1-3; the second PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.4-6 (see Table 1);
[0046] Table 1 Primer sequences in the PCR primer combination
[0047]
[0048] Specifically, the first PCR primer set is used to amplify the SNP site at positions 98bp - 102bp of the tobacco NtCYP704B1-T gene; at this site, the genotype of common tobacco is CTATTA, and the genotype of the NtCYP704B1-38 tobacco material is C----A, with 4 bases deleted; the second PCR primer set is used to amplify the SNP site at positions 99bp - 100bp of tobacco NtCYP704B1-S, at this site, the genotype of common tobacco is TA, and the genotype of the NtCYP704B1-38 tobacco material is TTA, with one base inserted; the position of the SNP site is determined based on the NtCYP704B1-T and NtCYP704B1-S gene sequences in the whole genome sequence of common tobacco K326.
[0049] In this example, the KASP primer combination uses the KASP38_T / S primer set; the KASP38_T / S primer set includes the KASP38_T primer set and the KASP38_S primer set; the KASP38_T primer set consists of three primers with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.3; the KASP38_S primer set consists of three primers with nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.6; the specific nucleotide sequences are shown in Table 2:
[0050] Table 2 Primer sequences in the KASP primer combination
[0051]
[0052] It can be seen that the KASP primer combination for screening tobacco genic male sterile lines consists of 2 primer sets, each primer set consists of 3 primers, including a first upstream primer, a second upstream primer, and a downstream primer, for amplifying one SNP site. The last base at the 3' end of the first upstream primer is the SNP genotype of tobacco K326; the last base at the 3' end of the second upstream primer is the SNP genotype of the NtCYP704B1-T / S double mutant male sterile line of tobacco. In each primer set, the 5' end of the first upstream primer contains the FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT), and the 5' end of the second upstream primer contains the HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT). The numbers in the primer names indicate the position of the SNP site amplified by the primer set on chromosome 13.
[0053] Specifically, the KASP38_T primer set consists of three primers, namely KASP38_T_WT, KASP38_T_4D, and KASP38_T_com. Among them, KASP38_T_WT is formed by concatenating a first tag sequence with the nucleotide sequence shown in SEQ ID NO.1 from the 5'-end to the 3'-end; KASP38_T_4D is formed by concatenating a second tag sequence with the nucleotide sequence shown in SEQ ID NO.2 from the 5'-end to the 3'-end; the nucleotide sequence of KASP38_T_com is as shown in SEQ ID NO.3.
[0054] The KASP38_S primer set consists of three primers, namely KASP38_S_WT, KASP38_S_1i, and KASP38_S_com. Among them, KASP38_S_WT is formed by concatenating a first tag sequence with the nucleotide sequence shown in SEQ ID NO.4 from the 5'-end to the 3'-end; KASP38_S_1i is formed by concatenating a second tag sequence with the nucleotide sequence shown in SEQ ID NO.5 from the 5'-end to the 3'-end; the nucleotide sequence of KASP38_S_com is as shown in SEQ ID NO.6. Among them, the nucleotide sequences of the first tag sequence and the second tag sequence are different and not homologous to the tobacco genomic sequence; the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT.
[0055] Among them, the KASP38_T primer set is used to amplify the SNP site at 98bp - 102bp of tobacco NtCYP704B1-T. At this site, the genotype of common tobacco is CTATTA, and the genotype of NtCYP704B1-38 tobacco material is C----A, with 4 bases deleted; the KASP38_S primer set is used to amplify the SNP site at 99bp - 100bp of tobacco NtCYP704B1-S. At this site, the genotype of common tobacco is TA, and the genotype of NtCYP704B1-38 tobacco material is TTA, with one base inserted.
[0056] In this example, a PCR primer combination is used to detect the seedling-stage materials of the F2 tobacco plants, and the screening method includes the following steps:
[0057] a) Extract the DNA of the leaves of the tobacco plants in the F2 population;
[0058] b) Use the above PCR primer set to perform PCR amplification on the DNA of the tobacco;
[0059] c) Detect the amplification results, determine the genotypes of the SNPs in the tobacco at the SNP loci amplified by each PCR primer set, and screen for SNPs where both the first PCR primer set and the second PCR primer set are of the NtCYP704B1_38 genotype as new sterile lines;
[0060] For SNPs where the first PCR primer set is of the NtCYP704B1_38 genotype and the second PCR primer set is heterozygous, or the second PCR primer is of the NtCYP704B1_38 genotype and the first PCR primer set is heterozygous, they are maintainer lines.
[0061] In this example, in step (2), the molecular marker screening uses a kit to detect the seedling stage materials of the F2 tobacco plants; the kit includes the PCR primer combination or the KASP primer combination.
[0062] When the kit includes the KASP primer combination, the kit also includes a PCR premix; the PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe;
[0063] The nucleotide sequence of the first fluorescent probe is the same as the nucleotide sequence of the first tag sequence in the KASP primer combination, and the 5'-end of the first fluorescent probe is linked to a first fluorescent group; the nucleotide sequence of the first quenching probe is reverse complementary to the nucleotide sequence of the first tag sequence, and the 3'-end of the first quenching probe is linked to a quenching group;
[0064] The nucleotide sequence of the second fluorescent probe is the same as the nucleotide sequence of the second tag sequence in the KASP primer combination, and the 5'-end of the second fluorescent probe is linked to a second fluorescent group; the nucleotide sequence of the second quenching probe is reverse complementary to the nucleotide sequence of the second tag sequence, and the 3'-end of the second quenching probe is linked to a quenching group.
[0065] In the example of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.
[0066] In this example, using the kit to detect the seedling stage materials of the F2 tobacco plants, the screening method includes the following steps:
[0067] a) Extract the DNA from the leaves of the tobacco plants in the F2 population;
[0068] b) Add the KASP primer set and the PCR premix to the DNA of the new sterile line and the maintainer line, and perform KASP amplification;
[0069] c) Detect the fluorescence signal, determine the genotypes of the new sterile line and maintainer line tobacco at the SNP loci amplified by each KASP primer set, and screen for SNP loci where the first PCR primer set and the second PCR primer set are both of the NtCYP704B1_38 genotype, which is the new sterile line; for SNP loci where the first PCR primer set is of the NtCYP704B1_38 genotype and the second PCR primer set is heterozygous, or the second PCR primer is of the NtCYP704B1_38 genotype and the first PCR primer set is heterozygous, it is the maintainer line. The new sterile line and maintainer line are the progeny of the cross, self-cross, and backcross of the donor parent NtCYP704B1_38 tobacco and the recipient parent common tobacco such as K326.
[0070] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorophore is FAM, and the second fluorophore is HEX.
[0071] In some embodiments of the present invention, in the KASP amplification,
[0072] The PCR system comprises: DNA template, KASP primer working solution, and KASP-TF V4.02X MasterMix;
[0073] The PCR procedure is as follows: First step, pre-denaturation at 95 °C for 15 min; second step, denaturation at 95 °C for 20 s, annealing at 65 - 57 °C (decreasing 1 °C per cycle) for 60 s, a total of 9 cycles; third step, denaturation at 95 °C for 20 s, renaturation at 57 °C for 1 min, 32 cycles.
[0074] The experimental results show that using the KASP primer set developed by the present invention, with the genomic DNA of the tobacco to be tested as the template for PCR amplification, and then genotyping the PCR amplification products by fluorescence signal detection, the new sterile line and maintainer line can be quickly and accurately screened through the genotyping results, different common tobaccos can be backcrossed, and excellent sterile lines and their corresponding maintainer lines for hybrid breeding and seed production can be obtained according to the phenotypes. Compared with the previous traditional marker screening, the KASP primer set developed by the present invention has the advantages of high accuracy, low cost, and high detection efficiency, and is suitable for large-scale screening of sterile line and maintainer line tobacco breeding. The identification method using the KASP primer set of the present invention can perform early-generation screening for the cultivation of sterile lines and maintainer lines and hybrid breeding, greatly shortening the breeding cycle of sterile line backcrossing and improving the breeding efficiency.
[0075] In this embodiment, the second parental plant includes any one of tobacco cultivars such as K326, Honghuadajinyuan, Yunyan 85, Yunyan 87, Yunyan 97, Yunyan 97, Yunyan 100, Yunyan 105, Yunyan 116, NC89, Zhongyan 100, and Cuibi 1.
[0076] In this embodiment, the first parental tobacco plant is a tobacco genic male sterile plant, and in the present invention, the first parental tobacco plant is designated as NtCYP704B1_38 tobacco plant. In the first parental tobacco plant NtCYP704B1_38, both the NtCYP704B1-T and NtCYP704B1-S gene fragments are homozygously mutated, and this NtCYP704B1_38 tobacco plant is an NtCYP704B1-T / S double mutant sterile line.
[0077] NtCYP704B1-38 is the SNP locus at positions 98bp - 102bp of NtCYP704B1-T. At this locus, the genotype of common tobacco is CTATTA, and the genotype of the NtCYP704B1-38 tobacco material is C----A, with a deletion of 4 bases; the SNP locus at positions 99bp - 100bp of NtCYP704B1-S. At this locus, the genotype of common tobacco is TA, and the genotype of the NtCYP704B1-38 tobacco material is TTA, with an insertion of one base; the positions of the SNP loci are determined based on the NtCYP704B1-T and NtCYP704B1-S gene sequences in the whole genome sequence of common tobacco K326.
[0078] K326 is a main cultivated flue-cured tobacco variety with normal NtCYP704B1-T and NtCYP704B1-S gene loci, which has been disclosed in a non-patent literature (Edwards et al., 2017, A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Bmc Genomics 18, 448.). The public can obtain its reference genome sequence from the website (https: / / solgenomics.net / organism / Nicotiana_tabacum / genome), and can obtain this tobacco material from the tobacco germplasm resource conservation unit.
[0079] The F1 generation plants obtained by crossing with NtCYP704B1-38 as the female parent and K326 as the male parent, and the F² population obtained by self-crossing the F1 are all created by the present applicant and are preserved in the Yunnan Academy of Tobacco Agricultural Sciences.
[0080] In the present invention, the method for creating NtCYP704B1_38 tobacco plants (NtCYP704B1-T / S double mutant sterile line) includes:
[0081] In the tobacco database (National Center for Biotechnology Information (nih.gov)), it is found that there are 2 paralogous genes of tobacco NtCYP704B1, namely NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664). In the tobacco inbred line K326, the nucleotide sequences of the NtCYP704B1-T gene and the NtCYP704B1-S gene are shown as SEQ ID NO.13 and SEQ ID NO.14.
[0082] Using the CRISPR / Cas9 method, gene editing is simultaneously performed on the 2 paralogous genes NtCYP704B1-T and NtCYP704B1-S of the NtCYP704B1 gene to obtain a gene editing vector. Through Agrobacterium-mediated transformation, the NtCYP704B1-T / S double mutant sterile line in which both the NtCYP704B1-T gene and the NtCYP704B1-S gene are edited is obtained;
[0083] After gene editing using the CRISPR / Cas9 method, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown as SEQ ID NO.11 and SEQ ID NO.12 respectively.
[0084] Among them, when gene editing is performed using the CRISPR / Cas9 method, CRISPR / Cas9 vector editing targets with nucleotide sequences shown as SEQ ID NO.15 and SEQ ID NO.16 are designed at the first exon and homologous regions of the NtCYP704B1-T gene and the NtCYP704B1-S gene.
[0085] The constructed gene editing vector is PKSE401-GFP-NtCYP704B1, and the basic vector of the gene editing vector is PKSE401-GFP. This expression vector includes the target (MT1) of the target gene NtCYP704B1-T (LOC107791425) and the target (MT1) of NtCYP704B1-S (LOC107809664), the marker gene Cas9, and the resistance Kana.
[0086] Scanning electron microscopy (SEM) observation of anthers: To deeply analyze the cytological characteristics of the NtCYP704B1-T / S double mutant sterile line, the inner and outer walls of anthers of the wild type and the homozygous double mutant were analyzed by scanning electron microscopy (SEM). The anthers of the wild type WT and the NtCYP704B1-T / S double mutant sterile line after peeling are as Figure 3 and Figure 5 shown. The anthers of the wild type are plump ( Figure 5 ), while the anthers of the NtCYP704B1-T / S double mutant sterile line are shriveled; the inner wall of the wild type anthers is covered with well-developed pollen grains (as shown in Figure 6 ); while there are no mature pollen grains on the inner wall of the anthers of the NtCYP704B1-T / S double mutant sterile line (as shown in Figure 4 ); indicating that the NtCYP704B1-T and NtCYP704B1-S genes jointly control the male development of tobacco, and the NtCYP704B1-T / S double mutant sterile line created by gene editing method is a pollenless sterile line, showing the characteristics of complete abortion.
[0087] The method for SNP genotyping using the KASP38_T / S primer set provided in this example includes:
[0088] Preparation of KASP primer working solution: Take 12 μL (100 μM) of each of the upstream primers (the first upstream primer, the second upstream primer) and 30 μL (100 μM) of the downstream primer, and make up to 100 μL with sterile ultrapure water, and mix well to obtain the KASP primer working solution.
[0089] PCR system: 2 μL of DNA template (about 30 ng / μL), 0.08 μL of KASP primer working solution, 2.5 μL of KASP-TF V4.02X MasterMix (LGC company, product number LGC-KBS-1050-132), and make up to 5 μL with sterile ultrapure water.
[0090] PCR program: First step, pre-denaturation at 95 °C for 15 min; second step, denaturation at 95 °C for 20 s, annealing at 65 - 57 °C (decreasing 1 °C per cycle) for 60 s, a total of 9 cycles; third step, denaturation at 95 °C for 20 s, annealing at 57 °C for 1 min, 32 cycles; store at 10 °C.
[0091] A blank control (NTC) without adding DNA template in the PCR system was set up simultaneously in the experiment, and 1 blank control was set for each primer set.
[0092] The PCR results are as follows: The results of SNP genotyping are as Figure 1As shown, after the reaction ended, a fluorescence microplate reader (FLUOstar OPTIMA, BMGLabtech, Germany) was used to perform fluorescence amplification on the obtained amplification products, and the SNPviewer software was used to read the fluorescence signal data and determine the genotype. If the fluorescence signal data of the amplification products of the tobacco to be tested is analyzed by the SNPviewer software and is close to the X-axis, the genotype of the tobacco to be tested is the K326 parental type; if the fluorescence signal data of the amplification products of the tobacco to be tested is analyzed by the SNPviewer software and is close to the Y-axis, the genotype of the tobacco to be tested is the parental type of the tobacco NtCYP704B1-T / S double mutant male sterile line; if the fluorescence signal data of the amplification products of the tobacco to be tested is analyzed by the SNPviewer software and is close to the diagonal line, the genotype of the tobacco to be tested is the heterozygous type; the fluorescence signal data of the amplification products of the negative control is analyzed by the SNPviewer software and is close to the origin and appears black. It can be seen that the KASP38_T / S primer set provided in this example is used to screen the SNP typing results, which are consistent with the genotype and have good typing effects.
[0093] Verification of SNP markers for screening tobacco genic male sterile lines:
[0094] The SNP markers obtained in Example 1 for screening tobacco genic male sterile lines were verified using the F2 segregation population of the offspring of the cross and self-cross of NtCYP704B1-38 and K326.
[0095] The DNA of 376 plants was subjected to KASP detection using the KASP38_T / S primer set in Example 1, with two homozygous parents (NtCYP704B1-38 and K326) and the F1 generation plants obtained from their cross as controls, and ultrapure water without added DNA as the negative control. The KASP detection method was the same as in Example 1. The detection results are shown in Table 3 and Figure 2 as follows. Figure 2 In it, in the typing results of each primer set, the sample in the upper left corner is the homozygous genotype of NtCYP704B1-38, the sample in the lower right corner is the homozygous genotype of K326, the sample in the middle diagonal position is the heterozygous type, and the sample in the lower left corner is the unamplified sample. There are a total of 384 samples, including 376 DNA samples of F2 tobacco, 2 DNA samples of NtCYP704B1-38, 2 DNA samples of K326, 2 DNA samples of NtCYP704B1-38×K326 F1, and 2 ultrapure waters without added DNA (as negative controls).
[0096] Table 3 KASP detection results using the KASP38_T / S primer set
[0097]
[0098]
[0099] Example 2: Application of a newly created male sterile line in tobacco nucleus created by a method for rapidly creating a male sterile line in tobacco nucleus. Using the newly created male sterile line in Example 1 as the female parent, cross it with the second parental tobacco plant to obtain a new F1 tobacco plant. Self-cross the new F1 tobacco plant to obtain a new F2 tobacco plant. Use molecular marker screening to detect the seedling stage materials of the new F2 tobacco plant. Screen out a male sterile line with the genotype gmst38gmst38 / gmss38gmss38 and other traits similar to the second parental tobacco plant at the seedling stage of the new F2 tobacco plant. This male sterile line can be used for hybrid seed production. This process can convert different tobacco materials into male sterile lines.
[0100] Specifically, the molecular marker screening is detected using a primer combination. The primer combination is a PCR primer combination or a KASP primer combination.
[0101] The PCR primer combination includes a first PCR primer group and a second PCR primer group. The first PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.1-3. The second PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.4-6.
[0102] The KASP primer combination uses the KASP38_T / S primer group. The KASP38_T / S primer group includes the KASP38_T primer group and the KASP38_S primer group. The KASP38_T primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.3. The KASP38_S primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.6.
[0103] Or using the newly created male sterile line created by the method in Example 1 as the female parent and the maintainer line created by the method in Example 1 as the male parent for crossing to obtain the next generation of male sterile line and maintainer line, where the male sterile line can be used for hybrid seed production.
[0104] Specifically, when using the KASP38_T / S primer group as the primer combination to detect the seedling stage materials of the new F2 tobacco plant, according to the detection results of the primer pair, select the single plants with both the KASP38_T primer pair and the KASP38_S primer pair being positive as male sterile lines. Among the KASP38_T primer pair and the KASP38_S primer pair, the single plants with one pair being homozygous positive and one pair being heterozygous are maintainer lines.
[0105] In the present invention, the sterile line and the maintainer line can randomly increase the number of hybridization, backcrossing and screening times according to breeding objectives, and a rich variety of offspring materials can be obtained and applied in cross breeding and seed production. In the present invention, cross breeding and seed production refer to using the male sterile line as the female parent to cross with other male parents to obtain male sterile traits and gene mutation materials.
[0106] Compared with the conventional marker screening in the past, the KASP primer set developed in the present invention has the advantages of high accuracy, low cost, high detection efficiency, etc., and is suitable for large-scale screening of sterile lines and maintainer lines in tobacco breeding. The identification method using the KASP primer set of the present invention can conduct early-generation screening on the cultivation of sterile lines and maintainer lines and cross breeding, greatly shortening the breeding cycle of the conversion of sterile lines and improving the breeding efficiency.
[0107] Based on the co-dominant specific KASP molecular markers of the foreground donor parent and the background backcross parent, the present invention can quickly, accurately, low-cost, high-throughput and automatically detect the background recovery rate of backcross individuals, accelerate the rapid conversion of the sterile line of the main flue-cured tobacco varieties and the configuration and utilization of hybrid seeds, and effectively solve the long-term bottleneck problem in the tobacco seed industry of lacking stable sterile lines and breakthrough large varieties. Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those of ordinary skill in the art, they can still modify or deform the aforementioned technical solutions, and these all belong to the protection scope of the present invention.
Claims
1. A method for quickly creating a tobacco genic male sterile line, characterized in that, The method includes: (1) Hybridizing a first parental tobacco plant and a second parental tobacco plant to obtain an F1 tobacco plant; The first parental tobacco plant is an NtCYP704B1-T / S double mutant sterile line tobacco plant with homozygous mutations in both the NtCYP704B1-T and NtCYP704B1-S gene fragments; the second parental tobacco plant has wild-type NtCYP704B1-T and NtCYP704B1-S gene fragments. The genotype of the first parental tobacco plant is gmst38gmst38 / gmss38gmss38; the genotype of the second parental tobacco plant is GMST38GMST38 / GMSS38GMSS38; the genotype of the F1 tobacco plant is GMST38gmst38 / GMSS38gmss38. (2) Self-crossing the F1 tobacco plant to obtain F2 tobacco plants, and screening with molecular markers to screen out a new sterile line with the genotype gmst38gmst38 / gmss38gmss38, a maintainer line with the genotype gmst38gmst38 / GMSS38 gmss38, or a maintainer line with the genotype GMST38gmst38 / gmss38gmss38 at the seedling stage of the F2 tobacco plants.
2. The method for rapidly creating a tobacco genic male sterile line according to claim 1, characterized in that, In step (2), the molecular marker screening uses a primer combination to detect the seedling stage materials of the F2 tobacco plants; the primer combination is a PCR primer combination or a KASP primer combination.
3. The method for rapidly creating a tobacco genic male sterile line according to claim 2, characterized in that, The PCR primer combination includes a first PCR primer group and a second PCR primer group; The first PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.1-3; the second PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.4-6.
4. The method for rapidly creating a tobacco genic male sterile line according to claim 2, wherein The KASP primer combination uses the KASP38_T / S primer group; The KASP38_T / S primer group includes a KASP38_T primer group and a KASP38_S primer group; the KASP38_T primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.3; the KASP38_S primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.
6.
5. The method for rapidly creating a tobacco genic male sterile line according to claim 2, characterized in that, In step (2), the molecular marker screening uses a kit to detect the seedling stage materials of the F2 tobacco plants; the kit includes the PCR primer combination or the KASP primer combination.
6. The method for quickly creating a tobacco genic male sterile line according to claim 1, characterized in that, In the first parental tobacco plant, the nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO.11 and SEQ ID NO.12 respectively.
7. The method for rapidly creating a tobacco genic male sterile line according to claim 1, characterized in that, The second parental plant includes any one of the tobacco cultivars of K326, Honghuadajinyuan, Yunyan 85, Yunyan 87, Yunyan 97, Yunyan 97, Yunyan 100, Yunyan 105, Yunyan 116, NC89, Zhongyan 100, and Cuibi 1.
8. Use of the new sterile line created by the method according to any one of claims 1-7, characterized in that, Using the new sterile line created by the method according to any one of claims 1-7 as the female parent, crossing with the second parental tobacco plant, obtaining a new F1 tobacco plant, self-crossing the new F1 tobacco plant to obtain a new F2 tobacco plant, and using molecular marker screening to detect the seedling stage materials of the new F2 tobacco plant; screening out a sterile line with the genotype of gmst38gmst38 / gmss38gmss38 and other traits similar to those of the second parental tobacco plant at the seedling stage of the new F2 tobacco plant; The molecular marker screening is detected using a primer combination; the primer combination is a PCR primer combination or a KASP primer combination; The PCR primer combination includes a first PCR primer group and a second PCR primer group; the first PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.1-3; the second PCR primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.4-6; The KASP primer combination uses the KASP38_T / S primer group; the KASP38_T / S primer group includes a KASP38_T primer group and a KASP38_S primer group; the KASP38_T primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.3; the KASP38_S primer group consists of three primers with nucleotide sequences shown in SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.
6.
9. The application according to claim 8, wherein Using the new sterile line created by the method according to any one of claims 1-7 as the female parent and the maintainer line created by the method according to any one of claims 1-7 as the male parent for crossing to obtain the next generation of sterile line and maintainer line, wherein the sterile line can be used for hybrid seed production.