Composite prebiotics-probiotics, preparation method and application in immunity regulation
Through the specific ratio of isomaltose oligosaccharide and galactomannan and Lactobacillus rhamnosaccharide JY027, a complex prebiotic-probiotic bacteria was formed, which solved the problem of lack of synergistic optimization of prebiotic-probiotic combinations in the prior art, and achieved effective regulation and improvement of intestinal immunity.
Patent Information
- Application Number
- CN202510610010.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-01
AI Technical Summary
In the prior art, the combination of prebiotics and probiotics is mostly limited to a single combination, lacking a multi-prebiotic-probiotic complex synergistic optimization system for intestinal immunomodulation, and the therapeutic effect of existing immunomodulatory drugs is limited and there are side effects.
A complex prebiotic-probiotic consisting of the optimal ratio of isomaltose and galactomannan in conjunction with Lactobacillus rhamnosus JY027 was designed to regulate the symptoms of immune depression through a combination of specific proportions. The preparation method includes screening and mixing prebiotics and probiotics.
It achieves synergistic efficacy on intestinal immunity, reduces the release of inflammatory factors, promotes the vitality of immune cells, improves the growth and development of immune organs, and improves intestinal inflammation. Its effect is better than the use of prebiotics or probiotics alone.
Smart Images

Figure CN120391683A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a compound prebiotic - probiotic, a preparation method thereof, and an application thereof in immunomodulation, and belongs to the technical field of functional foods. Background Art
[0002] Immune disorders can manifest as autoimmunity, autoinflammation, allergy, or lymphoproliferation. Intestinal immune disorders can cause inflammatory diseases, including inflammatory bowel disease (IBD), tumors, infections, and allergies, etc. Among them, intestinal inflammatory diseases are the intestinal immune deficiency diseases with the highest incidence and the most common. Immune balance is crucial for protecting the body from inflammatory diseases. Therefore, regulating immune balance plays an important role in human health and disease prevention. The treatment effect of first - line immunomodulator drugs is limited, the effect is incomplete, it is not sufficient to treat diseases and there are side effects. Therefore, safe, effective, and feasible immunomodulators have become the focus of attention of many researchers.
[0003] Prebiotics are a special type of dietary supplement that cannot be digested by endogenous enzymes in the human gastrointestinal tract, can reach the colon, and selectively stimulate the growth and activity of intestinal flora, having a positive impact on host health. Currently, common prebiotics include oligosaccharides, polyphenols, minerals, unsaturated fatty acids, etc. Probiotics are a type of live microorganisms that bring health benefits to the host when ingested in sufficient amounts, mainly exerting probiotic effects by improving the structure and function of the intestinal microbiota. The synbiotic combination of probiotics and prebiotics is also often used to improve the health of the body and diseases.
[0004] Currently, in the field of treating intestinal diseases, there is a need for new and effective solutions for regulating the immunity of the intestinal body. The existing functional products on the market are mainly prebiotics or probiotics, and the functional effects of such products need to be further improved. Therefore, it is necessary to develop products with synergistic effects of the two; in the field of prebiotic - probiotics, the combination of prebiotics and probiotics in the existing technology is mostly limited to single combinations, lacking a multi - prebiotic - probiotic composite synergistic optimization system for intestinal immune regulation. In addition, most technologies use traditional prebiotics (such as fructooligosaccharide, galactooligosaccharide, inulin). Therefore, it is necessary to develop a compound prebiotic combination to broaden the application field of prebiotics. Summary of the Invention
[0005] The object of the present invention is to address the above - mentioned problems existing in the prior art, overcome the deficiencies of the prior art, design an optimal ratio of isomaltooligosaccharide and galactomannan, as well as a compound prebiotic - probiotic that synergistically regulates immune deficiency symptoms with Lactobacillus rhamnosus JY027, a preparation method thereof, and an application thereof in immunomodulation, and solve the problem that the treatment effect of current immunomodulatory drugs on the market is limited and has negative effects.
[0006] The objective of the first aspect of the present invention is to provide a compound prebiotic-probiotic, which is composed of 35-42 wt% of compound prebiotic and 58-65 wt% of Lactobacillus casei rhamnosus; the compound prebiotic-probiotic avoids the competitive inhibition of the metabolic activity of strains by excessive carbon sources and simultaneously exerts an immunological synergistic effect. The compound prebiotic is composed of 1-3 parts by weight of galactomannan and 1-5 parts by weight of isomaltooligosaccharide.
[0007] The inventors of this case found in their research that the combination of Lactobacillus casei rhamnosus, isomaltooligosaccharide, and galactomannan has a synergistic effect on regulating intestinal immunity. Thus, on the one hand, the present invention provides a compound prebiotic-probiotic composed of Lactobacillus casei rhamnosus, isomaltooligosaccharide, and galactomannan.
[0008] According to a specific embodiment of the present invention, in the complex of the present invention, the compound prebiotic includes galactomannan and isomaltooligosaccharide in a weight ratio of (1-3):(1-5), and the preferred embodiment is galactomannan and isomaltooligosaccharide in a weight ratio of (1-3):(1-3).
[0009] According to the above preferred embodiment of the present invention, the compound prebiotic-probiotic includes galactomannan and isomaltooligosaccharide in a weight ratio of 1:(2-3).
[0010] Further, the compound prebiotic-probiotic is composed of 37.5 wt% of compound prebiotic and 62.5 wt% of Lactobacillus casei rhamnosus.
[0011] More preferably, the compound prebiotic is composed of 1 part by weight of galactomannan and 2 parts by weight of isomaltooligosaccharide.
[0012] The second aspect of the present invention is to disclose a nutritional composition capable of regulating intestinal immunity, including the aforementioned compound prebiotic-probiotic.
[0013] The objective of the third aspect of the present invention is to provide a preparation method of a compound prebiotic-probiotic, and the method includes the following steps:
[0014] (1) Pass galactomannan and isomaltooligosaccharide through a 60-mesh sieve respectively, and mix them to obtain a compound prebiotic;
[0015] (2) Pass the Lactobacillus casei rhamnosus powder through a 60-mesh sieve, and then mix it with the compound prebiotic to obtain a compound prebiotic-probiotic.
[0016] The object of the fourth aspect of the present invention is to provide the application of a compound prebiotic-probiotic or a compound prebiotic-probiotic prepared by a preparation method in the preparation of a product for regulating immune function, and the product is targeted at people with low immunity.
[0017] Among them, the functional product is a food, a health product or a medicine. The regulation of immunity includes reducing the production of cellular inflammatory mediators, enhancing the immune response ability of immune cells, and improving the growth and development of immune organs.
[0018] According to a specific embodiment of the present invention, in the application of the composition of the present invention, the regulation of intestinal immunity includes:
[0019] Promote the vitality of immune cells;
[0020] Reduce the levels and expressions of inflammatory factors IL-6, IL-1β, and TNF-α released by immune cells;
[0021] Promote the growth and development of immune organs;
[0022] Improve intestinal inflammation.
[0023] Compared with the prior art, the beneficial effects of the present invention are:
[0024] For the compound prebiotic-probiotic of the present invention, the components are reasonably proportioned. Through experiments, it has the effects of improving low immunity and regulating intestinal immunity. The present invention combines isomaltooligosaccharide and galactomannan, discovers the optimal ratio of isomaltooligosaccharide and galactomannan in regulating immunity, and synergistically regulates the symptoms of low immunity with Lactobacillus rhamnosus JY027.
[0025] Through experiments, it is proved that the compound prebiotic-probiotic of the present invention has the function of regulating immunity, and the functional effect is better than that of compound prebiotics and probiotics. Description of the Drawings
[0026] Figure 1 It is a result graph of macrophage phagocytic activity after treatment with compound prebiotic-probiotics at different ratios in Test Example 2;
[0027] Figure 2 It is a result graph of TNF-α secretion after treatment with compound prebiotic-probiotics at different ratios in Test Example 2;
[0028] Figure 3 It is a result graph of IL-6 secretion after treatment with compound prebiotic-probiotics at different ratios in Test Example 2;
[0029] Figure 4 It is a result graph of IL-1β secretion after treatment with compound prebiotic-probiotics at different ratios in Test Example 2;
[0030] Figure 5It is the result graph of iNOS secretion after treatment with different proportions of compound prebiotics-probiotics in Test Example 2;
[0031] Figure 6 It is the result graph of NO secretion after treatment with different proportions of compound prebiotics-probiotics in Test Example 2;
[0032] Figure 7 It is the result graph of TNF-α secretion after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0033] Figure 8 It is the result graph of IL-6 secretion after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0034] Figure 9 It is the result graph of IL-1β secretion after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0035] Figure 10 It is the result graph of TNF-α mRNA expression level after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0036] Figure 11 It is the result graph of IL-6 mRNA expression level after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0037] Figure 12 It is the result graph of IL-1β mRNA expression level after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0038] Figure 13 It is the result graph of the immune organ index of mice after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0039] Figure 14 It is the result graph of the macrophage phagocytosis index of mice after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0040] Figure 15 It is the result graph of the NK cell activity of mice after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3;
[0041] Figure 16 It is the schematic diagram of HE staining of the colon of mice after treatment with compound prebiotics, probiotics, and compound prebiotics-probiotics in Test Example 3. Specific implementation mode
[0042] The present invention will be further described below in conjunction with the accompanying drawings. The following examples are only used to more clearly illustrate the technical solution of the present invention and cannot be used to limit the protection scope of the present invention.
[0043] The raw materials used in the examples and comparative examples are all conventional commercially available raw materials.
[0044] In the examples and comparative examples, isomaltooligosaccharide was purchased from Shanghai Yuanye Bio-Technology Co., Ltd., and the production batch number was JS238976-S11134.
[0045] In the examples and comparative examples, galactomannan was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., and the production batch number was G1401024-C121024.
[0046] In the examples and comparative examples, the probiotic powder of Lactobacillus rhamnosus JY027 was stored in the KLDS strain bank of the Key Laboratory of Dairy Products of Northeast Agricultural University (this strain has been disclosed in the existing patent - CN117904000B), and the total viable count was 10 9 CFU / g.
[0047] Among them, the preparation process of the probiotic powder of Lactobacillus rhamnosus JY027 is as follows: After activation, Lactobacillus rhamnosus JY027 was inoculated into MRS medium at an inoculation amount of 2% (the concentration of Lactobacillus rhamnosus JY027 in MRS medium after inoculation was 2×10 6 CFU / mL), and cultured in a 37°C incubator for 48 h, centrifuged at 3000 rmp for 20 min at 4°C to obtain the precipitate of Lactobacillus rhamnosus JY027, and dried to obtain the probiotic powder of Lactobacillus rhamnosus JY027.
[0048] In the examples and comparative examples, RAW264.7 is a murine monocyte macrophage, and its full name is murine monocyte macrophage leukemia cell.
[0049] Examples 1-4 are examples for the preparation of prebiotic complexes, Example 5 is an example for the preparation of compound prebiotics-probiotics, and Comparative Examples 1-6 are comparative examples for the preparation of prebiotics-probiotics.
[0050] Example 1
[0051] Galactomannan and isomaltooligosaccharide were respectively passed through a 60-mesh sieve and reserved; 2 parts by weight of galactomannan and 1 part by weight of isomaltooligosaccharide were weighed and mixed to obtain a prebiotic complex. In this article, the weighed components are all after sieving.
[0052] Example 2
[0053] Galactomannan and isomaltooligosaccharide were respectively passed through a 60-mesh sieve and reserved; 3 parts by weight of galactomannan and 1 part by weight of isomaltooligosaccharide were weighed and mixed to obtain a prebiotic complex.
[0054] Example 3
[0055] Galactomannan and isomaltooligosaccharide were each passed through a 60-mesh sieve and set aside. 1 part by weight of galactomannan and 2 parts by weight of isomaltooligosaccharide were weighed and mixed to obtain a prebiotic complex.
[0056] Example 4
[0057] Galactomannan and isomaltooligosaccharide were each passed through a 60-mesh sieve and set aside. 1 part by weight of galactomannan and 3 parts by weight of isomaltooligosaccharide were weighed and mixed to obtain a prebiotic complex.
[0058] Example 5
[0059] Galactomannan, isomaltooligosaccharide, and Lactobacillus rhamnosus powder were each passed through a 60-mesh sieve and set aside. 1 part by weight of galactomannan, 2 parts by weight of isomaltooligosaccharide, and Lactobacillus rhamnosus JY027 powder were weighed and mixed to obtain a composite prebiotic-probiotic complex.
[0060] In Example 5 and Comparative Examples 1-4, the Lactobacillus rhamnosus JY027 powder was 62.5 wt%, and the prebiotic composed of galactomannan and isomaltooligosaccharide was 37.5 wt%.
[0061] Comparative Example 1
[0062] Galactomannan, isomaltooligosaccharide, and Lactobacillus rhamnosus powder were each passed through a 60-mesh sieve and set aside. 1 part by weight of galactomannan, 1 part by weight of isomaltooligosaccharide, and Lactobacillus rhamnosus JY027 powder were weighed and mixed to obtain a composite prebiotic-probiotic complex.
[0063] Comparative Example 2
[0064] Galactomannan, isomaltooligosaccharide, and Lactobacillus rhamnosus powder were each passed through a 60-mesh sieve and set aside. 1 part by weight of galactomannan, 3 parts by weight of isomaltooligosaccharide, and Lactobacillus rhamnosus JY027 powder were weighed and mixed to obtain a composite prebiotic-probiotic complex.
[0065] Comparative Example 3
[0066] Galactomannan, isomaltooligosaccharide, and Lactobacillus rhamnosus powder were each passed through a 60-mesh sieve and set aside. 1 part by weight of galactomannan, 4 parts by weight of isomaltooligosaccharide, and Lactobacillus rhamnosus JY027 powder were weighed and mixed to obtain a composite prebiotic-probiotic complex.
[0067] Comparative Example 4
[0068] Galactomannan, isomaltooligosaccharide, and Lactobacillus rhamnosus powder were each passed through a 60-mesh sieve and set aside. Weigh 1 part by weight of galactomannan, 5 parts by weight of isomaltooligosaccharide, and mix them with Lactobacillus rhamnosus JY027 powder to obtain a composite prebiotic-probiotic complex.
[0069] Comparative Example 5
[0070] Lactobacillus rhamnosus powder JY027 was passed through a 60-mesh sieve and set aside.
[0071] Comparative Example 6
[0072] Galactomannan and isomaltooligosaccharide were each passed through a 60-mesh sieve and set aside. Weigh 1 part by weight of galactomannan and 2 parts by weight of isomaltooligosaccharide, and mix them to obtain a composite prebiotic.
[0073] Experimental Example 1
[0074] 1. Preparation of Test Samples
[0075] Test samples for Example 1 group to Example 4 group: Weigh 20 mg of each of the composite prebiotics prepared in Example 1 to Example 4, add 100 mL of DMEM high-glucose medium (specific composition as shown in 2. Cell Grouping and Drug Administration 1) respectively, and mix well to obtain test samples for Example 1 group, Example 2 group, Example 3 group, and Example 4 group.
[0076] 2. Cell Grouping and Drug Administration 1
[0077] RAW264.7 cells were purchased from Shanghai Enzyme Research Biotechnology Co., Ltd. The culture conditions were: DMEM high-glucose medium supplemented with 10% (v / v) fetal bovine serum, 4 mM L-glutamine, 4500 mg / L glucose, 1% sodium pyruvate, and 1% penicillin-streptomycin solution. When the cells reached 80% confluence in a T25 culture flask, they were inoculated into a 96-well plate at a cell density of 5.0×10 4 cells / mL. 100 μL of DMEM medium (containing 10% fetal bovine serum) and 100 μL of cell suspension were added to each well. After culturing in a cell incubator at 37°C and 5% CO2 for 24 h, the original medium was aspirated, 200 μL of DMEM medium was added to each well, and the cells were starved in a cell incubator at 37°C and 5% CO2 for 2 h. After that, the medium was replaced with a medium containing fetal bovine serum, 200 μL per well. A blank group, a model group, Example 1 group, Example 2 group, Example 3 group, and Example 4 group were set up. 10 μL of 1×PBS solution was added to each well in the blank group, and 10 μL of 1 μg / mL LPS solution was added to each well in the model group, Example 1 group, Example 2 group, Example 3 group, and Example 4 group. After incubating in a cell incubator at 37°C and 5% CO2 for 6 h, drug administration was carried out.
[0078] Replace the culture medium in each well. The blank group and the model group are replaced with 200 μL of DMEM medium, and the groups of Example 1 to Example 4 are replaced with 200 μL of the test sample prepared in part 1. Incubate in a cell culture incubator at 37 °C and 5% CO2 for 8 h.
[0079] 3. Detection of Test Cells
[0080] Detect the proliferation viability of macrophages in each group by the CCK-8 kit to reflect the ability of the composite prebiotics in each group to regulate immune cells.
[0081] After the incubation of the groups of Example 1 to Example 4 is completed, add 20 μL of CCK-8 solution to each well, continue to incubate in the cell culture incubator for 1 h, shake the microplate reader for 10 s, and measure the absorbance value at 450 nm.
[0082] 4. Data Statistics and Analysis
[0083] The experimental data are transformed and statistically analyzed using SPSS 27 and Excel software. The data are expressed as mean ± standard deviation (mean ± SD, n = 5). One-way analysis of variance and significance analysis (p < 0.05) are performed using SPSS software. Groups marked with the same letter indicate no significant difference between groups, and groups marked with different letters indicate significant differences between groups.
[0084] 5. Test Results
[0085] Table 1 Effects of the groups of Example 1 to Example 4 on the viability of immunosuppressed macrophages
[0086]
[0087]
[0088] In Table 1, when comparing all groups pairwise, groups marked with the same letter indicate no significant difference between groups (p > 0.05), and groups marked with different letters indicate significant differences between groups (p < 0.05).
[0089] From the experimental data in Table 1, it can be seen that an immunosuppressed macrophage model was established using LPS. Compared with the model group, after the treatments of Example 1 to 4, the viability of macrophages was enhanced, that is, the immunosuppressed condition of macrophages was alleviated. Among them, the effect of Example 3 was particularly significant, indicating that when the proportion of isomaltooligosaccharide in the composite prebiotic formulation of the present invention is large, the effect of regulating immune cells is better.
[0090] Test Example 2
[0091] 1. Preparation of Test Samples
[0092] Test cell samples of Example 5 group, Comparative Example 1 group to Comparative Example 4 group: Weigh 20 mg of each of the compound prebiotics - probiotics prepared in Example 5 and Comparative Examples 1 - 4 respectively, add 100 mL of high - glucose DMEM medium, and mix well to obtain the test samples of Example 5 group, Comparative Example 1 group, Comparative Example 2 group, Comparative Example 3 group, and Comparative Example 4 group.
[0093] 2. Cell grouping and administration 2
[0094] RAW264.7 cells are cultured in a cell incubator at 37 °C and 5% CO2. The culture conditions are as follows: The high - glucose DMEM medium is added with 10% (v / v) fetal bovine serum, 4 mM L - glutamine, 4500 mg / L glucose, 1% sodium pyruvate, and 1% penicillin - streptomycin solution.
[0095] Set up a blank group, a model group, Example 5 group, Comparative Example 1 group, Comparative Example 2 group, Comparative Example 3 group, and Comparative Example 4 group. Inoculate the cells at a cell density of 5.0×10 4 cells / mL into a 96 - well plate, with 100 μL of cell suspension in each well. Culture in an incubator at 37 °C and 5% CO2 for 24 h, then change the culture medium to 100 μL of DMEM medium per well for starvation treatment for 2 h. Then change the culture medium to 100 μL of DMEM medium (containing 10% fetal bovine serum). Add 10 μL of 1×PBS solution to each well of the blank group, and add 10 μL of LPS solution (final concentration is 1 μg / mL LPS solution) to each well of the model group, Example 5 group, Comparative Example 1 group, Comparative Example 2 group, Comparative Example 3 group, and Comparative Example 4 group. After incubation in a cell incubator at 37 °C and 5% CO2 for 6 h, change the culture medium in each well. Change the culture medium of the blank group and the model group to 200 μL of DMEM medium, and change the culture medium of Example 5 group, Comparative Example 1 group to Comparative Example 4 group to 200 μL of the partially prepared test sample. Incubate in a cell incubator at 37 °C and 5% CO2 for 8 h.
[0096] 3. Detection of test cells
[0097] Detect the proliferation activity of macrophages through the neutral red test; measure the relevant indicators of inflammatory mediators in cells by ELISA to reflect the ability of each group of compound prebiotics - probiotics to regulate immune cells.
[0098] 3.1 Macrophage phagocytosis activity
[0099] After the incubation ends, add 100 μL of 0.1% neutral red reagent, incubate in an incubator at 37 °C and 5% CO2 for 2 h, wash with PBS solution, add 100 μL of cell lysate (ethanol: acetic acid v / v = 1:1) to each well, culture at room temperature for 3 h, and measure the absorbance value at 540 nm.
[0100] 3.2 Macrophage NO secretion content
[0101] After incubation, collect the cell supernatant of each well. Use the Total Nitric Oxide Detection Kit (Shanghai Beyotime S0024) to detect the NO production. Centrifuge the cell culture supernatant of each group at 12,000 rmp for 5 min for 5 min, and take the supernatant. Add 50 μL of supernatant, 50 μL of Griess Reagent I, and 50 μL of Griess Reagent II to each well, and measure the absorbance at 540 nm.
[0102] 3.3 Macrophage iNOS secretion content
[0103] After incubation, collect the cell supernatant of each well. Centrifuge at 3,000 rmp for 10 min, take the supernatant, and use the Inducible Nitric Oxide Synthase ELISA Detection Kit (Enzyme-linked Biology ml057773) to detect the iNOS content, and measure the absorbance at 450 nm.
[0104] 4. Data statistics and analysis
[0105] The experimental data was transformed and statistically analyzed using SPSS 27 and Excel software. The data was expressed as mean ± standard deviation (mean ± SD, n = 5). One-way ANOVA and significance analysis (p < 0.05) were performed using SPSS software. Groups marked with the same letter indicate no significant difference between groups, and groups marked with different letters indicate significant differences between groups.
[0106] 5. Experimental results
[0107] 5.1 Effects of different ratios of compound prebiotics-probiotics on macrophage phagocytic activity
[0108] Table 2 Effects of Example 5, Comparative Example 1 - Comparative Example 4 on macrophage phagocytic activity
[0109] Serial number Group Phagocytic activity 1 Blank group <![CDATA[0.206±0.047 e > 2 Model group <![CDATA[0.330±0.033 d > 3 Comparative example 1 <![CDATA[0.548±0.054 bc > 4 Comparative example 2 <![CDATA[0.634±0.026 a > 5 Comparative example 3 <![CDATA[0.570±0.019 e > 6 Comparative example 4 <![CDATA[0.520±0.019 e > 7 Example 5 <![CDATA[0.708±0.030 a >
[0110] The phagocytic activity of macrophages was measured using the neutral red test, and the results are shown in Table 2, Figure 1 as follows: Compared with the model group, the compound prebiotics-probiotics provided by Example 5, Comparative Example 1 - Comparative Example 4 can improve the phagocytic activity of immunosuppressed macrophages, indicating that the compounds provided by Example 5, Comparative Example 1 - Comparative Example 4 can further activate the immune response of macrophages. Among them, the effect of Example 5 is particularly obvious, showing a significant difference from the other comparative examples. It shows that the compound prebiotics-probiotics provided by Example 5 have the strongest ability to enhance the immune response of macrophages.
[0111] 5.2 Effects of different ratios of compound prebiotics-probiotics on cell inflammatory factors
[0112] Table 3 Effects of Example 5, Comparative Examples 1-4 on Cellular Inflammatory Factors
[0113]
[0114] The content of inflammatory factors secreted by macrophages was measured by ELISA. The results are shown in Table 3, Figures 2-4 as shown. Compared with the model group, the composite prebiotic-probiotic provided by Example 5 and Comparative Examples 1-4 can reduce the secretion of anti-inflammatory factors IL-6, IL-1β, and TNF-α, indicating that the composites provided by Example 5 and Comparative Examples 1-4 can effectively reduce the production of inflammatory mediators, that is, regulate immunosuppressed macrophages. Among them, the effect of Example 5 is particularly obvious, and its reduction effect is significantly different from that of the other comparative example groups. It shows that the composite prebiotic-probiotic provided by Example 5 has the best ability to regulate immune cells to reduce the production of inflammatory mediators.
[0115] 5.3 Effects of Different Proportions of Composite Prebiotic-Probiotic on iNOS Production
[0116] Table 4 Effects of Example 5, Comparative Examples 1-4 on iNOS
[0117] Serial number Group iNOS content (μmol / L) 1 Blank group <![CDATA[8.280±0.325 f > 2 Model group <![CDATA[10.142±0.087 e > 3 Comparative example 1 <![CDATA[12.135±0.264 c > 4 Comparative example 2 <![CDATA[13.414±0.243 b > 5 Comparative example 3 <![CDATA[11.141±0.242 d > 6 Comparative example 4 <![CDATA[10.631±0.133 d > 7 Example 5 <![CDATA[15.939±0.222 a >
[0118] The amount of iNOS secreted by macrophages was measured by ELISA. The results are shown in Table 4, Figure 5 as shown. Compared with the model group, the composite prebiotic-probiotic provided by Example 5 and Comparative Examples 1-4 can promote the production of iNOS, indicating that the composites provided by Example 5 and Comparative Examples 1-4 can improve the ability of macrophages to produce iNOS when stimulated, that is, activate immune cells to produce a response. Among them, the effect of Example 5 is particularly obvious, and its improvement effect is significantly different from that of the other comparative example groups. It shows that the composite prebiotic-probiotic provided by Example 5 has the strongest ability to regulate immune cells to improve the immune response of macrophages.
[0119] 5.4 Effects of Different Proportions of Composite Prebiotic-Probiotic on NO Production
[0120] Table 5 Effects of Example 5, Comparative Examples 1-4 on NO
[0121] Serial number Group NO content (μmol / L) 1 Blank group <![CDATA[1.516±0.201 d > 2 Model group <![CDATA[5.821±0.583 c > 3 Comparative example 1 <![CDATA[9.010±0.466 b > 4 Comparative example 2 <![CDATA[8.269±0.372 b > 5 Comparative example 3 <![CDATA[8.640±0.283 b > 6 Comparative example 4 <![CDATA[8.825±0.185 b > 7 Example 5 <![CDATA[10.112±0.380 a >
[0122] The NO production of macrophages was measured by ELISA. The results are as Figure 6As shown in Table 5, compared with the model group, the composite prebiotic-probiotics provided in Example 5 and Comparative Examples 1-4 can promote the production of NO, indicating that the composites provided in Example 5 and Comparative Examples 1-4 can promote the further synthesis of iNOS by stimulated macrophages to produce NO, that is, promote macrophages to play an immunomodulatory role. Among them, the effect of Example 5 is particularly obvious, and its promoting effect is significantly different from that of the other comparative example groups. It shows that the composite prebiotic-probiotics provided in Example 5 have the best ability to regulate immune cells and promote macrophages to regulate immunity.
[0123] Test Example 3
[0124] 1. Preparation of Test Samples
[0125] Test cell samples of the Example 5 group, Comparative Example 5 group, and Comparative Example 6 group: Weigh 20 mg of the products prepared in Example 5, Comparative Example 5, and Comparative Example 6 respectively, and add 100 mL of high-glucose DMEM medium to obtain test samples.
[0126] 2. Cell Grouping and Drug Administration 3
[0127] RAW264.7 cells are cultured in a cell incubator at 37 °C and 5% CO2. The culture conditions are: high-glucose DMEM medium supplemented with 10% (v / v) fetal bovine serum, 4 mM L-glutamine, 4500 mg / L glucose, 1% sodium pyruvate, and 1% penicillin-streptomycin solution.
[0128] Set up a blank group, a model group, an Example 5 group, a Comparative Example 5 group, and a Comparative Example 6 group. Inoculate at a cell density of 5.0×10 4 cells / mL into a 96-well plate, with 100 μL of cell suspension in each well. Culture in an incubator at 37 °C and 5% CO2 for 24 h, then change the culture medium to 100 μL of DMEM medium per well for starvation treatment for 2 h. Then change the culture medium to 100 μL of DMEM medium (containing 10% fetal bovine serum). Add 10 μL of 1×PBS solution to each well of the blank group, and add 10 μL of LPS solution (final concentration of 1 μg / mL LPS solution) to each well of the model group, Example 5 group, Comparative Example 5 group, and Comparative Example 6 group. After incubating in a cell incubator at 37 °C and 5% CO2 for 6 h, change the culture medium in each well. Change the culture medium of the blank group and the model group to 200 μL of DMEM medium, and change the culture medium of the Example 5 group, Comparative Example 5 group, and Comparative Example 6 group to 200 μL of the partially prepared test sample, and incubate in a cell incubator at 37 °C and 5% CO2 for 8 h.
[0129] 3. Animal Grouping and Drug Administration
[0130] Test animal samples in Example 5 group: Weigh 16 mg of the composite prebiotic-probiotic prepared in Example 5, add 0.2 mL of normal saline, and mix well to obtain the test sample of the Example 5 group; weigh 16 mg of the Lactobacillus casei rhamnosus powder prepared in Comparative Example 5, add 0.2 mL of normal saline, and mix well to obtain the test sample of the Comparative Example 5 group; weigh 16 mg of the composite prebiotic prepared in Comparative Example 6, add 0.2 mL of normal saline, and mix well to obtain the test sample of the Comparative Example 6 group.
[0131] The test animals were BALB / c male mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.). All the test animals used were of clean grade. The test animals were fed in a rack cage, with 6 animals in each cage. Feeding conditions: room temperature 20°C ± 2°C, relative humidity 40% - 60%, 12-hour alternation of light and darkness. During the test, the animals were given ordinary feed and free access to water. After 7 days of adaptive feeding, they were randomly divided into 6 groups for modeling and drug administration.
[0132] Table 6 Modeling and drug administration of test animals
[0133]
[0134]
[0135] Among them, the dose is the daily dose.
[0136] 4. Detection of test cells
[0137] The relevant indicators of inflammatory mediators in cells were measured by ELISA; the expression levels of inflammatory mediator mRNAs were measured by RT-qPCR to reflect the regulatory effect of the composite prebiotic-probiotic on immune-deficient cells.
[0138] 4.1 Secretion levels of inflammatory factors IL-6, IL-1β, and TNF-α
[0139] After the incubation was completed, the cell supernatant of each well was collected, centrifuged at 3000 rmp for 20 min, and the supernatant was taken. The cytokine levels of IL-6, IL-1β, and TNF-α were detected using ELISA kits for cytokines (AD2764M, AD2772M, AD2726M from Beijing Chenglin), and the absorbance values were measured at 450 nm.
[0140] 4.2 Expression levels of IL-6, IL-1β, and TNF-α mRNAs
[0141] The mRNA levels of IL-6, IL-1β, and TNF-α secreted by cells were detected by real-time fluorescence quantitative PCR: After incubation, a total RNA extraction kit (purchased from Nanjing Novoprotein, RC112-01) was used. After the incubation ended, Buffer R was added for lysis, and the lysed cells were collected by pipetting, vortexed briefly, and centrifuged at high speed to extract RNA. After measuring the RNA content and ensuring that the purity met the requirements, a reverse transcription kit was used to synthesize cDNA (purchased from Nanjing Novoprotein, R323). β-actin was used as an internal reference gene, and the primers for IL-6, IL-1β, and TNF-α were synthesized by Shanghai Sangon Biotech Co., Ltd. The sequences are shown in the following table, and the mRNA expression levels of each group were calculated according to ΔΔCт.
[0142] Table 7 Primer sequences of inflammatory mediators IL-6, IL-1β, and TNF-α
[0143] Primer Fp Rp IL-1β TGCCACCTTTTGACAGTGATG AAGGTCCACGGGAAAGACAC IL-6 CAACGATGATGCACTTGCAGA TGTGACTCCAGCTTATCTCTTGG TNF-α ACCCTCACACTCACAAACCA ATAGCAAATCGGCTGACGGT β-actin CACTGTCGAGTCGCGTCC TCATCCATGGCGAACTGGTG
[0144] In Table 3, the forward and reverse primers of IL-1β are SEQ ID NO.1-2 in sequence, the forward and reverse primers of IL-6 are SEQ ID NO.3-4 in sequence, the forward and reverse primers of TNF-α are SEQ ID NO.5-6 in sequence, and the forward and reverse primers of β-actin are SEQ ID NO.7-8 in sequence.
[0145] 5. Detection of test animals
[0146] After continuous administration for 16 days, tissues of mice in each group were collected, stored, and detected.
[0147] 5.1 Changes in immune organ indices
[0148] After euthanizing the mice by cervical dislocation, the spleen and thymus were quickly isolated aseptically, the surface fat and fascia were removed, rinsed thoroughly with physiological saline, blotted dry with filter paper, weighed, and the immune organ index was calculated, i.e., spleen or thymus weight / body weight * 100%.
[0149] 5.2 Macrophage phagocytosis index
[0150] Before euthanasia, C-group mice were selected from each group. India ink diluted with physiological saline was injected into the mice via the tail vein (10 μL / g). Blood samples of 20 μL were taken from the ophthalmic plexus vein at 2 min and 10 min respectively, and immediately mixed in 2 mL of 0.1% Na2CO3 solution. Using 0.1% Na2CO3 solution as the blank, the absorbance value at 600 nm was measured. After anesthetizing the mice, they were euthanized by cervical dislocation, and the liver and spleen were taken and accurately weighed to calculate the phagocytosis index.
[0151] 5.3 NK cell activity of splenocytes
[0152] After anesthetizing the mice, they were sacrificed by cervical dislocation, immersed in 75% ethanol, the spleens were taken out, passed through a 200-mesh sieve, the spleens were minced and ground thoroughly, PBS was added to form a spleen cell suspension, RPMI-1640 culture medium was added, and the cells were inoculated into a 96-well plate at a density of 5×10 5 cells per well. K562 cells were inoculated into a 96-well plate at a density of 1×10 4 cells per well. After culturing for 24 h, 8 μL of CCK-8 solution was added to each well, and after culturing for 4 h, the absorbance value at 450 nm was measured.
[0153] 5.4 Histopathological examination of colon tissue
[0154] After sacrifice, a part of the mouse colon was excised. Randomly select 3 mice and cut a section at the proximal colon position, rinse and soak it in 10% formalin, embed it in paraffin and section it, and stain it with hematoxylin-eosin. The specific method is as follows: fix it with 4% paraformaldehyde for 24 h, then dehydrate it, embed it in paraffin, cut into tissue sections with a thickness of 4 μm, place them in xylene solution, dewax for 10 min, replace the xylene solution for secondary dewaxing, hydrate with ethanol solutions of different concentrations, then immerse them in hematoxylin solution, differentiate with 1% hydrochloric acid alcohol for 10 s, rinse, put them into eosin solution for staining, dehydrate the sections with ethanol solutions of different concentrations and xylene solution, air dry, and seal the sections with neutral balsam. Observe and take pictures under a microscope.
[0155] 6. Data statistics and analysis
[0156] The experimental data were transformed and statistically analyzed using SPSS 27 and Excel software. The data were expressed as mean ± standard deviation (mean ± SD, n = 5). Homogeneity of variance analysis, one-way ANOVA, and significance analysis (p < 0.05) were performed using SPSS software. The same letter annotation indicates no significant difference between groups, and different letter annotations indicate significant differences between groups.
[0157] 7. Experimental results
[0158] 7.1 Effects of compound prebiotics-probiotics on inflammatory mediators in the immunosuppressed RAW264.7 model
[0159] Table 8 Effects of Example 5 group, Comparative Example 5 group, and Comparative Example 6 group on the secretion amount of cellular inflammatory factors
[0160]
[0161]
[0162] The content of inflammatory factors secreted by macrophages was determined by ELISA, and the results were as Figures 7-9As shown, compared with the model group, the substances provided by Example 5 group, Comparative Example 5 group, and Comparative Example 6 group can significantly reduce the secretion levels of anti-inflammatory factors IL-6, IL-1β, and TNF-α, indicating that the compound prebiotics, Lactobacillus casei rhamnosus, and compound prebiotic-probiotic can effectively reduce the production of inflammatory mediators, that is, regulate immunosuppressed macrophages. Among them, the effect of Example 5 is particularly obvious, and there are significant differences in the reduction effect compared with the Comparative Example 5 group and the Comparative Example 6 group. It shows that the compound prebiotic-probiotic provided by Example 5 has a better ability to regulate immune cells and reduce the production of inflammatory mediators than the results of treating with compound prebiotics and probiotics alone.
[0163] Table 9 Effects of Example 5 group, Comparative Example 5 group, and Comparative Example 6 group on the relative expression levels of cellular inflammatory factors
[0164] Serial number Group Relative expression level of IL-6 Relative expression level of IL-1β Relative expression level of TNF-α 1 Blank group <![CDATA[1±0.042 a > <![CDATA[1±0.132 a > <![CDATA[1±0.042 d > 2 Model group <![CDATA[22.048±0.151 b > <![CDATA[3.209±0.109 b > <![CDATA[1.921±0.003 a > 3 Positive group <![CDATA[6.505±0.743 c > <![CDATA[1.212±0.129 c > <![CDATA[1.109±0.049 c > 4 Example 5 <![CDATA[10.600±0.283 c > <![CDATA[1.556±0.182 e > <![CDATA[1.137±0.015 c > 5 Comparative example 5 <![CDATA[16.500±0.234 d > <![CDATA[2.436±0.177 d > <![CDATA[1.675±0.013 b > 6 Comparative example 6 <![CDATA[15.925±0.287 d > <![CDATA[2.309±0.094 d > <![CDATA[1.542±0.023 b >
[0165] The expression levels of inflammatory factors IL-6, IL-1β, and TNF-α mRNA were measured by RT-qPCR, and the results are shown in Table 9. Figures 10-12 As shown, compared with the model group, the Example 5 group, Comparative Example 5 group, and Comparative Example 6 group can reduce the mRNA expression levels of IL-6, IL-1β, and TNF-α. Among them, the reduction effect of Example 5 is particularly obvious, and there are significant differences compared with the Comparative Example 5 group and the Comparative Example 6 group, indicating that the compound prebiotic-probiotic provided by Example 5 has the function of regulating immunity and improving inflammation, and its effect is better than that of treating with compound prebiotics and probiotics alone.
[0166] 7.2 Effects of compound prebiotic-probiotic on immune organs of immunosuppressed mice
[0167] Table 10 Effects of Example 5 group, Comparative Example 5 group, and Comparative Example 6 group on the weights of immune organs
[0168]
[0169]
[0170] The immune organ indexes were calculated by weighing the body weight, thymus, and spleen, and the results are shown in Table 10. Figure 13As shown, compared with the model group, the thymus index and spleen index of mice increased to a certain extent after intragastric administration of the positive drug, Example 5 group, Comparative Example 5 group, and Comparative Example 6 group. Among them, the immune organ index of the Example 5 group increased significantly (p<0.05), and there was no significant difference from the positive group, indicating that the compound prebiotics and probiotics provided by the Comparative Example 5 group and the Comparative Example 6 group could improve the growth and development of the immune organs of mice, but the effect was not obvious. The compound prebiotic-probiotic provided by the Example 5 group played a synergistic effect and enhanced the improvement effect, that is, the compound prebiotic-probiotic provided by the Example 5 group could regulate the body's immune function by restoring the growth and development status of the body's immune organs and playing a synergistic role.
[0171] 7.3 Effects of Compound Prebiotic-Probiotic on Phagocytosis Index of Macrophages in Immunocompromised Mice
[0172] Table 11 Effects of Example 5 Group, Comparative Example 5 Group, and Comparative Example 6 Group on Phagocytosis Index
[0173] Serial number Group Phagocytosis index 1 Blank group <![CDATA[4.003±0.083 a > 2 Model group <![CDATA[2.321±0.085 d > 3 Positive group <![CDATA[3.843±0.091 ab > 4 Example 5 <![CDATA[3.729±0.058 b > 5 Comparative example 5 <![CDATA[3.385±0.085 c > 6 Comparative example 6 <![CDATA[3.438±0.084 c >
[0174] The phagocytosis index of mouse macrophages was measured by the carbon clearance test, and the results are shown in Table 11. Figure 14 As shown. Compared with the model group, the phagocytosis indexes of the Example 5 group, Comparative Example 5 group, and Comparative Example 6 group all increased. Among them, the recovery effect of the Example 5 group was the best, and there was no significant difference from the positive group (p>0.05); while the Comparative Example 5 group and the Comparative Example 6 group were significantly different from the Example 5 group, indicating that the compound prebiotic-probiotic provided by the Example 5 group improved the ability of prebiotics and probiotics to enhance the non-specific immunity of immunocompromised mice, and had the effect of regulating the body's immune system and promoting health.
[0175] 7.4 Effects of Compound Prebiotic-Probiotic on NK Cell Activity in Immunocompromised Mice
[0176] Table 12 Effects of Example 5 Group, Comparative Example 5 Group, and Comparative Example 6 Group on NK Cell Activity
[0177]
[0178]
[0179] The NK cell activity in mouse spleen cells was measured by the CCK-8 test, and the results are as Figure 15As shown in Table 12. Compared with the model group, the NK cell activity can be increased in the Example 5 group, Comparative Example 5 group, and Comparative Example 6 group. Among them, the enhancing effect in the Example 5 group is significantly higher than that in the Comparative Example 5 group and Comparative Example 6 group, and is similar to the effect of the positive group. That is, the promotion effects on NK cell activity in the Comparative Example 5 group and Comparative Example 6 group are relatively low, while the Example 5 group improves the influence of prebiotics and probiotics on the NK cell immune function of immunocompromised mice, indicating that the composite prebiotic-probiotic provided by the Example 5 group can play a role in synergistically regulating non-specific immunity by affecting NK cell activity, which is beneficial for the body to better resist the invasion of bacteria, viruses, etc. when in an immunocompromised state.
[0180] 7.5 Effect of Composite Prebiotic-Probiotic on Intestinal Tissue Pathological Changes in Immunocompromised Mice
[0181] Figure 16 The HE staining schematic diagrams of each group of test animals are shown. From Figure 16 it can be seen that the crypt depth of the blank group is moderate, the intestinal wall structure is clear and the thickness is uniform, the mucosal epithelial structure is complete, there are a large number of intestinal glands in the lamina propria, which are straight tubular, densely arranged, the goblet cell count is rich, the submucosa is loose connective tissue, and the muscular layer structure is clear. In the model group, multiple focal erosions can be seen in the intestinal tissue, and the crypt branches are reduced; the muscular layer is hypertrophied, the mucosal layer is thinned, the mucus secretion is insufficient resulting in a decrease in goblet cells, and a small amount of scattered necrotic cell debris can be seen indicating an increase in epithelial cell apoptosis, a decrease in lamina propria lymphocytes, a small amount of connective tissue hyperplasia around, accompanied by a small amount of lymphocyte infiltration; occasional vascular congestion is seen. Compared with the model group, the crypt depth increases, the goblet cell count increases, the muscular layer becomes thinner, and the mucosal layer thickness increases in the Comparative Example 5 group; some crypt branches are restored and the goblet cell count increases in the Comparative Example 6 group; while in the Example 5 group, crypt regeneration occurs, the depth increases and the branch structure normalizes, the goblet cell count significantly increases, the epithelial proliferation ability is enhanced, the mucosal layer thickness increases, the abnormal hyperplasia of smooth muscle is reduced, the muscular layer hypertrophy is relieved, and the intestinal lumen diameter is restored, approaching the colon state of the positive group; it is significantly better than the Comparative Example 5 group and Comparative Example 6 group.
[0182] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the technical principle of the present invention, several improvements and deformations can be made, and these improvements and deformations should also be regarded as the protection scope of the present invention.
Claims
1. A compound prebiotic-probiotic, characterized in that: The composite prebiotic-probiotic consists of 35-42 wt% of composite prebiotic and 58-65 wt% of Lactobacillus rhamnosus; the composite prebiotic consists of 1-3 parts by weight of galactomannan and 1-5 parts by weight of isomaltooligosaccharide.
2. A composite prebiotic-probiotic according to claim 1, characterized in that: The composite prebiotic consists of 1 part by weight of galactomannan and 2-3 parts by weight of isomaltooligosaccharide.
3. A composite prebiotic-probiotic according to claim 1, wherein: The composite prebiotic-probiotic consists of 37.5 wt% of composite prebiotic and 62.5 wt% of Lactobacillus rhamnosus.
4. A composite prebiotic-probiotic according to claim 1, characterized in that: The composite prebiotic consists of 1 part by weight of galactomannan and 2 parts by weight of isomaltooligosaccharide.
5. A nutritional composition capable of adjusting intestinal immune capacity, characterized in that: It includes the composite prebiotic-probiotic according to any one of claims 1-4.
6. The preparation method of the composite prebiotic-probiotic according to any one of claims 1 to 4, characterized in that: The method includes the following steps: (1) The galactomannan and isomaltooligosaccharide are respectively sieved through a 60-mesh sieve and mixed to obtain the composite prebiotic; (2) The Lactobacillus rhamnosus powder is sieved through a 60-mesh sieve and then mixed with the composite prebiotic to obtain the composite prebiotic-probiotic.
7. Use of the composite prebiotic-probiotic according to any one of claims 1-4 or the composite prebiotic-probiotic prepared by the method according to claim 6 in the preparation of a product for regulating immune function.
8. The application according to claim 7, characterized in that, The functional product is a food, a health product or a medicine.
9. The application according to claim 7, wherein: The regulation of immunity includes reducing the production of cellular inflammatory mediators, enhancing the immune response ability of immune cells, and improving the growth and development of immune organs.