Mulberry phellinus igniarius and method for cultivating phellinus igniarius through internal circulation heat and humidity exchange system
Through the combination of the mulberry mulberry strain CKS-327 and the internal circulation heat and humidity exchange system, the problem of efficient artificial domestication and large-scale production of authentic mulberry yellow is solved, and the active ingredients of mulberry yellow is significantly improved and the production stability of the medicinal value is enhanced.
Patent Information
- Application Number
- CN202510564447.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2045-04-30
AI Technical Summary
It is difficult for the existing technology to achieve efficient artificial domestication and large-scale production of authentic mulberry trees, mulberry yellow, which leads to a flood of counterfeit and inferior products on the market, affecting the stability of the medicinal value of mulberry yellow and market development.
The mulberry mulberry strain CKS-327 was used for cultivation in combination with the internal circulation heat and humidity exchange system. Through continuous stress stimulation and acclimation of the parent species, stress stimulation culture of the mulberry mulberry solid-liquid mixed fermentation agent and fresh mulberry branch segment cultivation, the internal circulation heat and humidity exchange system was used to provide an accurate temperature difference and humidity environment to ensure the stability of mulberry and yellow growth and the efficient accumulation of active ingredients.
The content of active ingredients such as polysaccharides, sterols, triterpenes, flavonoids, polyphenols, alkaloids, glycoproteins in the fruiting bodies of mulberry yellow has been significantly improved, and the problem of unstable medicinal value of mulberry yellow has been solved, and efficient and stable mulberry yellow production has been achieved, reducing management costs and risk of contamination of miscellaneous bacteria.
Smart Images

Figure CN120399892A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, and more specifically, to a Phellinus linteus of mulberry tree and a method for cultivating Phellinus linteus by an internal circulation heat and humidity exchange system. Background Art
[0002] Sanghuangporus sanghuang is an extremely rare perennial large medicinal fungus parasitized on Morus L., and is known as the "forest gold". With the increasingly in-depth research on the anti-cancer mechanism and medicinal value of Sanghuangporus sanghuang by domestic and foreign experts, Sanghuangporus sanghuang has been widely recognized by people. Currently, it is one of the medicinal fungi with the best anti-cancer efficiency recognized internationally. In the medical books of successive dynasties in China since the Han Dynasty, such as "Shennong Ben Cao Jing" in the Han Dynasty, "Ming Yi Bie Lu" by Tao Hongjing in the Wei and Jin Dynasties, and "Yao Xing Lun" by Zhen Quan in the early Tang Dynasty, etc., there are all records of the use of Sanghuangporus sanghuang. Its main functions include treating dysentery, night sweats, metrorrhagia, hematuria, abdominal pain with astringency, rectal prolapse with bloody diarrhea, leukorrhea, amenorrhea, diarrhea, prolonging life, etc. Modern research shows that Sanghuangporus sanghuang has significant anti-tumor, antioxidant, immune-enhancing, preventive and therapeutic effects on rheumatoid arthritis, lipid-lowering, uric acid inhibition and other effects, and has high medicinal value. Especially in the aspect of anti-tumor, it has been proven to be superior to medicinal fungi such as Ganoderma lucidum, and has become a hot spot in the research and development of domestic and foreign pharmaceutical preparations and health products, with good economic and social benefits.
[0003] Despite the limitations of ancient technological conditions, the records of Sanghuang by the ancients were often rather rough, with different descriptions of its name, texture, usage methods, etc. However, all the Sanghuang recorded in ancient books was closely related to mulberry trees. Contemporary scholars such as Wu Shenghua and Dai Yucheng have made a detailed classification of Sanghuang fungi, and it has been clarified that only the Sanghuang growing on mulberry trees, namely "Sanghuangporus sanghuang", is the authentic Sanghuang. Authentic wild Sanghuangporus sanghuang is extremely rare, with extremely irregular fruiting body shapes, and its growth is extremely demanding on natural environments and mulberry tree varieties and other conditions. In the past two decades, due to its excellent medicinal value, Sanghuang has received increasing attention from researchers in the United States, South Korea, Japan and other countries as well as in China. Due to commercial interests, the vast majority of the so-called "Sanghuang" on the market, such as Poplar Sanghuang, Syringa reticulata var. mandshurica Sanghuang and other miscellaneous tree Sanghuang, have various shapes and actually have no mulberry tree attributes at all, but are sold as "Sanghuang" or "Sanghuangporus sanghuang" at high prices, making it difficult for consumers to identify, which has gradually caused market chaos. These so-called "Sanghuang" can basically be classified into two categories: one is the fruiting bodies of the family Hymenochaetaceae, such as: Syringa reticulata var. mandshurica Sanghuang, Lonicera Sanghuang, Quercus Sanghuang, Poplar Sanghuang, Inonotus hispidus Sanghuang, etc. belonging to the genus Inonotus; the other is the fruiting bodies of the family Polyporaceae, such as: Rhus verniciflua Sanghuang belonging to Pyrofomes, Pinus yunnanensis Sanghuang belonging to the genus Phellinus, and some miscellaneous tree Sanghuang, etc. At present, the confusion in the understanding of Sanghuang in the consumer market and academia has severely restricted the development of this ancient and miraculous traditional Chinese medicine in China, making it difficult for Sanghuangporus sanghuang to become a stable traditional Chinese medicine formula in China.
[0004] The modern people's health awareness has given rise to the craze for Sanghuang, and the price has also been rising steadily. The resources of wild Sanghuangporus sanghuang are very limited, which has prompted people to start exploring the artificial cultivation methods of Sanghuang. At present, it is very difficult to artificially domesticate the authentic Sanghuangporus sanghuang. Even if successful domestication can be achieved, the yield and quality of the fruiting bodies are very unstable, and it is difficult to achieve large-scale production and commercialization in the true sense. Most of the successfully cultivated Sanghuang on the market are Poplar Sanghuang, Inonotus hispidus, etc. whose shapes and appearances are very similar to those of Sanghuangporus sanghuang. They are usually sold as "Sanghuang" or "Sanghuangporus sanghuang", but their medicinal properties are very different from those of the authentic Sanghuangporus sanghuang.
[0005] Therefore, artificially domesticating the authentic Sanghuangporus sanghuang, making full use of the huge amount of annual mulberry branches resources generated by the spring and summer pruning of large-scale mulberry orchards at present, and establishing a high-yield and stable-yield cultivation and production technology system for Sanghuangporus sanghuang are of great significance for the healthy and stable development of the authentic Sanghuangporus sanghuang industry and for promoting the development of this ancient and miraculous traditional Chinese medicine formula in China. Summary of the Invention
[0006] In view of this, the purpose of the present invention is to provide a method for cultivating Sanghuangporus sanghuang on a mulberry tree and an internal circulation heat and humidity exchange system, so as to solve the deficiencies in the prior art.
[0007] To achieve the above purpose, the present invention adopts the following technical solutions:
[0008] A strain of Sanghuangporus sanghuang, obtained by separating the fruiting bodies of authentic perennial wild mulberry trees, named Sanghuangporus sanghuang CKS-327, with a preservation number of CCTCC NO: M 20242849, was preserved at the China Center for Type Culture Collection on December 18, 2024, and the preservation address is Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
[0009] Isolation, screening and identification of the Sanghuangporus sanghuang strain CKS-327 of the present invention: The Sanghuangporus sanghuang strain was obtained by separating the fruiting bodies of perennial wild mulberry trees, named Sanghuangporus sanghuang CKS-327. Combining the morphological characteristics of the fruiting bodies of perennial wild mulberry trees, the morphological characteristics of the isolated and cultured mycelia, microscopic characteristics, and ITS alignment results showing the highest homology of the ITS sequence with Sanghuangporus sanghuang, and other identification data analysis, it was determined that this Sanghuang strain belongs to the genus Sanghuangporus of the family Hymenochaetaceae, Sanghuangporus sanghuang strain. It was preserved at the China Center for Type Culture Collection on December 18, 2024, and the preservation address is Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with a preservation number of CCTCC NO: M 20242849. After years of continuous purification and screening of this Sanghuangporus sanghuang strain and attempts to domesticate and cultivate authentic Sanghuangporus sanghuang using an internal circulation heat and humidity exchange system, at the initial stage of its growth on the plate medium, the mycelia often showed a significant separation of light yellow and golden yellow colors, with other biological characteristics being consistent. The mycelia grew rapidly and vigorously, the strain was stable and not easily mutated. Using fresh mulberry twig segments for cultivation and production, the agronomic traits of the Sanghuangporus sanghuang fruiting bodies were excellent, and the content of active ingredients was high, significantly superior to authentic wild Sanghuangporus sanghuang.
[0010] The 736bp ITS sequence of Sanghuangporus sanghuang CKS-327 is shown in Sequence Listing SEQ ID No.1.
[0011] The present invention also proposes a method for cultivating Sanghuang using an internal circulation heat and humidity exchange system, which specifically includes the following steps:
[0012] (1) Continuous stress stimulation and domestication of the Sanghuang mother strain
[0013] After activating the above-mentioned mother culture of Phellinus igniarius, inoculate it at the left end of the Phellinus igniarius mother culture continuous stress stimulation and domestication plate medium. After culturing, domesticating, and improving the quality, select the strains with fast growth rate, thick and vigorous growth, and neat edges. Under aseptic conditions, open the lid of the plate every day and blow sterile air for 2 - 5 minutes for air-drying tolerance domestication. Repeat the domestication multiple times until the mycelium covers the plate. Then, select the strains with neat edges, thick and vigorous growth at the right end for standby.
[0014] (2) Stress stimulation culture of the solid-liquid mixed fermentation agent of Phellinus igniarius
[0015] Under aseptic conditions, inoculate the strain domesticated from the mother culture into the solid-liquid mixed fermentation agent medium of Phellinus igniarius, and culture it statically in the dark environment, and then ferment and culture it under magnetic stirring to obtain a high-quality and stable solid-liquid mixed fermentation agent of Phellinus igniarius for standby.
[0016] (3) Cultivation of fresh mulberry twig segment cultivation species
[0017] Under aseptic conditions, inoculate the homogeneous and stable solid-liquid mixed fermentation agent of Phellinus igniarius into the fresh mulberry twig segment cultivation species medium, and then transfer it to the mushroom spawn room for cultivation under constant temperature, constant humidity, and constant carbon dioxide conditions. When more than 80% of the mushroom spawn bags show light yellow tumor-like protrusions after the mycelium of the cultivation species covers them, transfer the cultivation species to the fruiting room for site adaptation management.
[0018] (4) Yellowing management inside the internal circulation heat and humidity exchange system
[0019] After the cultivation species complete color transformation and adapt to the site, make incisions on the side of the mushroom bag to prepare for yellowing, and at the same time make an incision in the center of the bottom of the mushroom bag to wait for continuous humidification by the internal circulation heat and humidity exchange system. Then, bury the bottom of the cultivation species 5 - 6 cm deep in the sand bed of the internal circulation heat and humidity exchange system, and precisely control the yellowing conditions. The water temperature at the bottom of the internal circulation heat and humidity exchange system is 30 - 40 °C, the external environment of the internal circulation heat and humidity exchange system is 25 - 30 °C, the humidity in the space above the sand bed inside the internal circulation heat and humidity exchange system is above 90%, the CO2 concentration is 800 - 1500 ppm, with scattered light, and keep ventilation. When the fruiting body of Phellinus igniarius turns from orange-yellow to dark yellow and the edge hardens, obtain fresh fruiting bodies of Phellinus igniarius, pick the large ones and leave the small ones.
[0020] Furthermore, in the above step (1), each 1 L of the left end of the Phellinus igniarius mother culture continuous stress stimulation and domestication plate medium contains the following raw materials by weight: 210 - 230 g of potatoes, 20 - 22 g of glucose, 0.8 - 1.0 g of MgSO4, 1.0 - 1.5 g of KH2PO4, 0.3 - 0.5 g of mulberrin, 18.0 g of agar, and the balance is water. After the medium solidifies, make a hole at the center position.
[0021] Further, in the above step (1), for every 1 L of the mother culture of Phellinus igniarius, the right end of the plate medium for continuous stress stimulation and domestication contains the following raw materials by weight: 210 - 230 g of potatoes, 20 - 22 g of glucose, 0.8 - 1.0 g of MgSO4, 1.0 - 1.5 g of KH2PO4, 1.0 - 1.5 g of hydrolyzed tannin, 18.0 g of agar, and the balance is water.
[0022] Further, in the above step (1), the method for preparing the plate medium for continuous stress stimulation and domestication of the mother culture of Phellinus igniarius is as follows: Place the petri dish obliquely, pour the left-end solid medium into the petri dish, and under sterile conditions, use a sterile scalpel to remove the left-end solid medium at the bottom that exceeds the semi-circle diameter. Raise and place the blank end of the petri dish obliquely, pour the right-end solid medium into the blank end of the petri dish, so that the right-end solid medium covers a part of the left-end solid medium at the joint, and solidify to obtain the plate medium for continuous stress stimulation and domestication of the mother culture of Phellinus igniarius. Use a sterile punch to punch a hole at the center position of the left end for inoculation.
[0023] Further, in the above step (1), the culture temperature is 26 °C and the time is 6 - 7 d.
[0024] Further, in the above step (2), for every 1 L of the solid-liquid mixed fermentation agent medium of Phellinus igniarius, it contains the following raw materials by weight: 220 - 240 g of potatoes, 20 - 22 g of glucose, 5 - 8 g of water-soluble soybean cake powder, 0.03 - 0.05 g of Na2SeO3, 1.1 - 1.3 g of MgSO4, 1.3 - 1.5 g of KH2PO4, 0.3 - 0.5 g of mulberry root bark extract, 0.5 - 0.8 g of hydrolyzed tannin, the balance is water, and the pH is 6.5.
[0025] Further, in the above step (2), the temperature for static culture is 23 °C and the time is 12 h; the rotation speed of magnetic stirring is 620 rpm; the temperature for fermentation culture is 26 - 28 °C and the time is 9 - 11 d.
[0026] Further, in the above step (3), the method for preparing the culture medium for the fresh mulberry branch segment cultivation species is as follows: First, cut the freshly harvested long mulberry branches from the mulberry tree into 18 - 20 cm wooden strip segments, then bundle the mulberry wooden strip segments into a mulberry wooden strip bundle with two rubber bands as the main material for the cultivation species, and soak one end in a saturated aqueous solution of gypsum powder. Soak both ends of the mulberry wooden strip bundle for 6 h respectively for later use; then prepare the auxiliary material for the cultivation species according to 80% - 83% of Phellodendron amurense sawdust, 15% - 18% of wheat bran, 1.0% of gypsum powder, 1.0% of lime powder, and a water content of 45% - 50%; finally, complete the bagging production of the culture medium for the fresh mulberry branch segment cultivation species according to the structure of 2 - 3 cm of the auxiliary material for the cultivation species at the bottom, 18 - 20 cm of the main material for the cultivation species in the middle, and 2 - 3 cm of the auxiliary material for the cultivation species at the top.
[0027] The further beneficial effect of adopting the above method is that the cultivation culture medium of fresh mulberry branch segments of the present invention is extremely close to the supply of nutrition and active ingredients of living mulberry trees. Through the dual promotion of continuous stress stimulation domestication of the mother species and stress stimulation cultivation of Phellinus igniarius solid-liquid mixed fermentation agent, it significantly promotes the erosion and transformation of Phellinus igniarius on fresh mulberry branch bark and strengthens the resistance of Phellinus igniarius to stagnation or termination of growth caused by insufficient air humidity during cultivation management.
[0028] The cultivation culture medium of the fresh mulberry branch segments of the present invention adopts the auxiliary of Cortex Phellodendri sawdust at both ends, and the three-layer roujiamo-like structure of the fresh mulberry branch segment in the middle is combined with the characteristics of the solid-liquid mixed fermentation agent of Phellinus igniarius, which invisibly achieves the characteristics of inoculation at one end and fungus growth at both ends. The fungus growth at both ends is stable and the fungus growth speed is fast, and the addition of Cortex Phellodendri active ingredients makes it more diverse and rich.
[0029] The invention inoculates one end of the cultivation medium of the fresh mulberry branch segment, and the two ends almost simultaneously germinate toward the middle of the cultivation medium, thereby shortening the germination time, reducing the ineffective consumption of the culture material, and effectively avoiding the contamination of miscellaneous bacteria.
[0030] Furthermore, in the above step (3), the culturing time after inoculation is 50-65 days.
[0031] Furthermore, in the above step (4), the internal circulation heat and moisture exchange system is constructed by three modular units, wherein the first modular unit is shaped like a grain storage warehouse, with a pointed top and a thick bottom, hollow in the middle, a handle ring at the top, a dust-proof air inlet on the side near the top, and an exhaust device on the opposite side near the bottom; the second modular unit is shaped like a transparent water basin, with a backflow hole with a diameter of 5mm around the side near the top eaves, four water diversion devices connecting the upper and lower parts at the bottom, and a sand bed containing 5%-8% gypsum powder at the bottom; the third modular unit is shaped like a transparent water bucket, with a heating rod with precise temperature control fixed at the bottom, and the third modular unit is filled with pure water.
[0032] The above further beneficial effect is that the internal circulation heat and moisture exchange system of the present invention can realize the growth and cultivation of wild mulberry lindera imitation life, not only providing a regulated continuous and precise internal and external continuous circulation temperature difference environment for the growth of mulberry lindera, but also providing humidity circulation discharge and replenishment from the two spatial dimensions of inside and outside, while realizing infinite internal circulation of water inside the device to save water, without the need for external water mist humidification, significantly reducing the contamination of bacteria, effectively producing yellowing rate, mulberry mulberry lindera fruiting body continuous growth and development stable, yield and quality volatility is small, and management cost is low. In addition, the continuous, precise and regulated internal and external temperature difference environment provides convenience for studying how to improve the accumulation of mulberry lindera medicinal ingredients.
[0033] It can be seen from the above technical solution that compared with the prior art, the beneficial effects of the present invention are as follows:
[0034] 1. The mulberry Phellinus igniarius CKS-327 strain of the present invention is obtained by separating the authentic fruiting body of mulberry Phellinus igniarius. After further quality improvement and domestication, the active ingredients of the Phellinus igniarius fruiting body cultivated by combining with the internal circulation heat and humidity exchange cultivation system are significantly higher than the contents of polysaccharides, sterols, triterpenes, flavonoids, polyphenols, alkaloids, glycoproteins, etc. in the wild Phellinus igniarius fruiting body, and it has high medicinal development value.
[0035] 2. The present invention further solves a series of key technical problems, such as domesticating the perennial mulberry Phellinus igniarius from the mother strain to the stress stimulation culture of the solid-liquid mixed fermentation agent of Phellinus igniarius and cultivating and producing the Phellinus igniarius fruiting body by using the internal circulation heat and humidity exchange cultivation system. It makes full use of fresh mulberry twig segments in the internal circulation heat and humidity exchange system to provide the nutritional components, active components and the cultivation conditions of water circulation exchange from the inside to the outside that are closest to the living mulberry tree for the perennial mulberry Phellinus igniarius, ensuring the effective active components closest to the wild perennial living Phellinus igniarius, enhancing the medicinal value of Phellinus igniarius. At the same time, it maximally continuously transforms and utilizes mulberry branch resources and water resources to produce mulberry Phellinus igniarius, and solves the problems of high management difficulty and low conversion efficiency in cultivating mulberry Phellinus igniarius with high-content mulberry branch sawdust bag materials. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 is a three-dimensional view of the internal circulation heat and humidity exchange system of the present invention;
[0037] Among them, 1 - the first module unit, 2 - the second module unit, 3 - the third module unit, 4 - the lifting handle, 5 - the dust-proof air inlet, 6 - the exhaust equipment, 7 - the backflow hole, 8 - the water guiding equipment, 9 - the sand bed, 10 - the heating rod, 11 - pure water. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0038] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0039] Example 1 [[ID=2']]
[0040] Isolation, screening and identification of the mulberry Phellinus igniarius strain CKS-327
[0041] The Sanghuangporus sanghuang strain of the present invention is isolated from the fruiting bodies of perennial wild mulberry trees, named Sanghuangporus sanghuang CKS-327. Combining the morphological analysis of the fruiting bodies of perennial wild mulberry trees, the morphological analysis of the isolated and cultured mycelia, microscopic characteristics, and ITS alignment results showing the highest homology of ITS sequences with Sanghuangporus sanghuang, through the identification data analysis, it is determined that this Sanghuang strain belongs to the Sanghuangporus sanghuang strain of the family Hymenochaetaceae and the genus Sanghuangporus, with the preservation number of CCTCC NO: M 20242849. It was preserved in the China Center for Type Culture Collection on December 18, 2024, and the preservation address is Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. After years of continuous purification and screening of this Sanghuangporus sanghuang strain and attempts to domesticate and cultivate authentic Sanghuangporus sanghuang using an internal circulation heat and humidity exchange system, during the initial growth stage of its culture on a plate medium, the mycelia often show a significant separation of light yellow and golden yellow colors, with other biological characteristics being consistent. The mycelia grow rapidly and vigorously, the strain is stable and not easily mutated. When using fresh mulberry twig segments for cultivation to produce the fruiting bodies of Sanghuangporus sanghuang, the agronomic traits are excellent and the active ingredient content is high, significantly superior to authentic wild Sanghuangporus sanghuang.
[0042] The 736bp ITS sequence of Sanghuangporus sanghuang CKS-327 is as follows:
[0043] AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAAAGCGAGACCTGCTGCTGGTGCGAAATCGCGCATGTGCACGGTCTTCGCGCTCAAATCCAACTCAAACCCCTGTGCACCTTATATATCGCGAGTCGAAGTTAGTAGCCTGAGGTCTTGTAAGTAATTAGTAGAAGGGCGAAAGCGAGTCTTGCTCGTTAGGTAGCCTTTCGAAAATGAAAGCGAGTGCGTCGGGTGAAGACTTCGGCTTGTCGTTACAAAACACCTTATATTGTCTTTGTGAATGTAATGCTCCTTGTGGGCGAAAATAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTTATCTCAAACCGCTCGTCTTTCTTAATTGAAGGGCTTGAGGTTTGGACTTGGAGGTTTACTGCTGGCGCCTTTCGAGGGGTCGGCTCCTCTTAAATACATTAGCTGGGCTTTGGCTCGCGTTTACGGTGTAATAGTTGATTCCATTCACCAACGAGCGCTTGCCTGACGAGCTTGCTTCTAGCCGTCCGCGTCGTCGGACAAGGAGTCACCTCCTTCTTGACACCTTTGACCTCAAATCAGGTAGGATTACCCGCCGAACTTAA。
[0044] Example 2
[0045] [[ID=[6]]Cultivation experiment of authentic Phellinus linteus using the strain Phellinus linteus CKS-327 of mulberry tree with an internal circulation heat and humidity exchange system
[0046] (1) Continuous stress stimulation and domestication of the mother culture of Phellinus linteus
[0047] The slant mother culture of the Sanghuang mushroom strain CKS-327 in Example 1 was activated and inoculated at the left end of the Sanghuang mother culture continuous stress stimulation domestication plate medium. After culturing at 26°C for 6 days for domestication and quality improvement, the strains with fast growth rate, thick and vigorous growth, and neat edges were selected. Under sterile conditions, the lid of the plate was opened and sterile air was blown for 2 minutes every day for air-drying tolerance domestication. After repeating domestication many times until the mycelium covered the plate, the strains with neat edges and thick and vigorous growth at the right end were selected for standby;
[0048] Among them, every 1 L of the left end of the Sanghuang mother culture continuous stress stimulation domestication plate medium contains the following raw materials by weight: 230 g of potatoes, 20 g of glucose, 1.0 g of MgSO4, 1.5 g of KH2PO4, 0.3 g of mulberrocin, 18.0 g of agar, and the balance is water. After the medium solidifies, a hole is punched at the center position;
[0049] Every 1 L of the right end of the Sanghuang mother culture continuous stress stimulation domestication plate medium contains the following raw materials by weight: 230 g of potatoes, 20 g of glucose, 1.0 g of MgSO4, 1.5 g of KH2PO4, 1.5 g of hydrolyzed tannins, 18.0 g of agar, and the balance is water;
[0050] The preparation method of the Sanghuang mother culture continuous stress stimulation domestication plate medium is as follows: The culture dish is placed obliquely, the left-end solid medium is poured into the culture dish. Under sterile conditions, the left-end solid medium with the bottom layer exceeding the semi-circular diameter is removed with a sterile scalpel. The blank end of the culture dish is raised and placed obliquely, and the right-end solid medium is poured into the blank end of the culture dish, so that the right-end solid medium covers a part of the left-end solid medium at the joint, and after solidification, the Sanghuang mother culture continuous stress stimulation domestication plate medium is obtained. A hole is punched at the center position of the left end with a sterile puncher for inoculation;
[0051] (2) Stress stimulation culture of the solid-liquid mixed fermentation agent of Sanghuang mushroom
[0052] Under sterile conditions, the strain domesticated through the mother culture is inoculated into the Sanghuang mushroom solid-liquid mixed fermentation agent medium. In the dark environment, it is statically cultured at 23°C for 12 h, and then fermented and cultured at 26°C under magnetic stirring at 620 rpm for 11 d to obtain a high-quality and stable Sanghuang mushroom solid-liquid mixed fermentation agent for standby;
[0053] Among them, every 1 L of the Sanghuang mushroom solid-liquid mixed fermentation agent medium contains the following raw materials by weight: 220 g of potatoes, 2 Twenty-two grams of glucose, 8 g of water-soluble soybean cake powder, 0.03 g of Na2SeO3, 1.1 g of MgSO4, 1.3 g of KH2PO4, 0.3 g of mulberrocin, 0.8 g of hydrolyzed tannins, and the balance is water, and the pH is 6.5;
[0054] (3) Cultivation of fresh mulberry twig segment cultivation species
[0055] Under aseptic conditions, inoculate the homogeneous and stable solid-liquid mixed fermentation agent of Phellinus linteus into the fresh mulberry branch segment cultivation medium, and then transfer it to the spawn-running room for cultivation under constant temperature, constant humidity, and constant carbon dioxide conditions for 65 days. When more than 80% of the spawn bags show light yellow tumor-like protrusions after the spawn mycelium has filled the bags, transfer the spawn to the fruiting room for site adaptation management;
[0056] Among them, the preparation method of the fresh mulberry branch segment cultivation medium is as follows: First, cut the long mulberry branches just cut from the mulberry tree into 20-cm wooden strips, and then tie the mulberry wooden strips into a bundle with two rubber bands as the main material for cultivation. Soak one end in a saturated aqueous solution of gypsum powder, and soak both ends of the mulberry wooden strip bundle for 6 hours for standby; then prepare the cultivation auxiliary material according to 83% Phellodendron amurense sawdust, 15% wheat bran, 1.0% gypsum powder, 1.0% lime powder, and 50% water content; finally, complete the bagging of the fresh mulberry branch segment cultivation medium according to the structure of 2 cm of cultivation auxiliary material at the bottom, 20 cm of cultivation main material in the middle, and 2 cm of cultivation auxiliary material at the top;
[0057] (4) Yellowing management inside the internal circulation heat and humidity exchange system
[0058] As Figure 1 shown, the internal circulation heat and humidity exchange system is composed of three module units. Among them, the first module unit 1 is shaped like a storage granary, with a pointed top and a thick bottom, hollow in the middle, with a lifting handle 4 at the top, a dust-proof air inlet 5 near the bottom on the side close to the top, and an exhaust device 6 on the opposite side near the top on the bottom; the second module unit 2 is shaped like a transparent water basin, with a reverse flow hole 7 with a diameter of 5 mm around the side near the top eaves, four water guiding devices 8 connecting the upper and lower parts at the bottom, and a sand bed 9 containing 5% gypsum powder laid at the bottom; the third module unit 3 is shaped like a transparent water bucket, with a heating rod 10 that can accurately control the temperature fixed at the bottom, and the third module unit 3 is filled with pure water 11;
[0059] After the spawn has completed color transformation and adapted to the site, make incisions on the side of the spawn bag to prepare for yellowing, and at the same time make an incision in the center of the bottom of the spawn bag to wait for the internal circulation heat and humidity exchange system to continuously replenish moisture; then bury the bottom of the spawn 5 cm deep in the sand bed of the internal circulation heat and humidity exchange system, accurately control the yellowing conditions, with the water temperature at the bottom of the internal circulation heat and humidity exchange system being 40 °C, the external environment of the internal circulation heat and humidity exchange system being 30 °C, the humidity above the sand bed in the internal circulation heat and humidity exchange system being more than 90%, the CO2 concentration being 1500 ppm, with scattered light, and keep ventilation; when the Phellinus linteus fruit body turns from orange-yellow to dark yellow and the edge hardens, obtain fresh Phellinus linteus fruit bodies, pick the large ones and leave the small ones.
[0060] Example 3
[0061] Cultivation experiment of authentic Phellinus linteus using the internal circulation heat and humidity exchange system with the Phellinus linteus strain CKS-327 of mulberry tree
[0062] (1) Continuous stress stimulation domestication of Phellinus igniarius mother culture
[0063] The slant mother culture of the Phellinus igniarius strain CKS-327 in Example 1 was activated and inoculated at the left end of the Phellinus igniarius mother culture continuous stress stimulation domestication plate medium. After culturing at 26 °C for 7 days for domestication and quality improvement, the strains with fast growth rate, thick and vigorous growth, and neat edges were selected. Under aseptic conditions, the lid of the plate was opened every day and sterile air was blown for 4 minutes for air-drying tolerance domestication. After repeating domestication many times until the mycelium covered the plate, the strains with neat edges and thick and vigorous growth at the right end were selected for standby;
[0064] Among them, each 1 L of the left end of the Phellinus igniarius mother culture continuous stress stimulation domestication plate medium contains the following raw materials by weight: 210 g of potatoes, 22 g of glucose, 0.8 g of MgSO4, 1.0 g of KH2PO4, 0.5 g of mulberry root bark extract, 18.0 g of agar, and the balance is water. After the medium solidifies, a hole is punched at the center position;
[0065] Each 1 L of the right end of the Phellinus igniarius mother culture continuous stress stimulation domestication plate medium contains the following raw materials by weight: 210 g of potatoes, 22 g of glucose, 0.8 g of MgSO4, 1.0 g of KH2PO4, 1.0 g of hydrolyzed tannins, 18.0 g of agar, and the balance is water;
[0066] The preparation method of the Phellinus igniarius mother culture continuous stress stimulation domestication plate medium is as follows: The culture dish is placed obliquely, the left-end solid medium is poured into the culture dish. Under aseptic conditions, the left-end solid medium exceeding the semicircle diameter at the bottom layer is removed with a sterile scalpel. The blank end of the culture dish is raised and placed obliquely, and the right-end solid medium is poured into the blank end of the culture dish, so that the right-end solid medium covers a part of the left-end solid medium at the joint, and the Phellinus igniarius mother culture continuous stress stimulation domestication plate medium is obtained after solidification. A hole is punched at the center position of the left end with a sterile puncher for inoculation;
[0067] (2) Stress stimulation culture of Phellinus igniarius solid-liquid mixed fermenter
[0068] Under aseptic conditions, the strain domesticated through the mother culture was inoculated into the Phellinus igniarius solid-liquid mixed fermenter medium. In the dark environment, it was statically cultured at 23 °C for 12 h, and then fermented and cultured at 28 °C with magnetic stirring at 620 rpm for 9 d to obtain a high-quality and stable Phellinus igniarius solid-liquid mixed fermenter for standby;
[0069] Among them, each 1 L of the Phellinus igniarius solid-liquid mixed fermenter medium contains the following raw materials by weight: 240 g of potatoes, 20 g of glucose, 5 g of water-soluble soybean cake powder, 0.05 g of Na2SeO3, 1.3 g of MgSO4, 1.5 g of KH2PO4, 0.5 g of mulberry root bark extract, 0.5 g of hydrolyzed tannins, and the balance is water, and the pH is 6.5;
[0070] (3) Cultivation of fresh mulberry twig segments spawn
[0071] Under aseptic conditions, a homogeneous and stable solid-liquid mixed fermentation agent of Phellinus linteus is inoculated into a fresh mulberry branch segment cultivation medium, and then transferred to an incubation room for cultivation under constant temperature, constant humidity, and constant carbon dioxide conditions for 60 days. When more than 80% of the mushroom bags show light yellow tumor-like protrusions after the cultivation species mycelium has filled the bags, the cultivation species is transferred to the fruiting room for site adaptation management;
[0072] Among them, the preparation method of the fresh mulberry branch segment cultivation medium is as follows: First, cut the long mulberry branches just cut from the mulberry tree into 18-cm wooden strips, and then tie the mulberry wooden strips into a bundle with two rubber bands as the main material for the cultivation species. One end is soaked in a saturated aqueous solution of gypsum powder, and both ends of the mulberry wooden strip bundle are soaked for 6 hours for standby; then prepare the cultivation species auxiliary material according to 80% Phellodendron amurense sawdust, 18% wheat bran, 1.0% gypsum powder, 1.0% lime powder, and 45% water content; finally, complete the bagging production of the fresh mulberry branch segment cultivation medium according to the structure of 3 cm of cultivation species auxiliary material at the bottom, 18 cm of cultivation species main material in the middle, and 3 cm of cultivation species auxiliary material at the top;
[0073] (4) Yellowing management inside the internal circulation heat and humidity exchange system
[0074] As Figure 1 shown, the internal circulation heat and humidity exchange system is composed of three module units. Among them, the first module unit 1 is shaped like a storage granary, with a pointed top and a thick bottom, hollow inside, with a lifting handle 4 at the top, a dust-proof air inlet 5 near the lower part of the side close to the top, and an exhaust device 6 near the upper part of the opposite side close to the bottom; the second module unit 2 is shaped like a transparent water basin, with a reverse flow hole 7 with a diameter of 5 mm around the side close to the top eaves, four water guiding devices 8 connecting the upper and lower parts at the bottom, and a sand bed 9 containing 8% gypsum powder laid at the bottom; the third module unit 3 is shaped like a transparent water bucket, with a temperature-raising rod 10 that can accurately control the temperature fixed at the bottom, and pure water 11 filled inside the third module unit 3;
[0075] After the cultivation species has completed color transformation and adapted to the site, make incisions on the side of the mushroom bag to prepare for yellowing, and at the same time make an incision in the center of the bottom of the mushroom bag to wait for the internal circulation heat and humidity exchange system to continuously replenish moisture; then bury the bottom of the cultivation species 6 cm deep in the sand bed of the internal circulation heat and humidity exchange system, accurately control the yellowing conditions, with the water temperature at the bottom of the internal circulation heat and humidity exchange system being 30 °C, the external environment of the internal circulation heat and humidity exchange system being 25 °C, the humidity above the sand bed in the internal circulation heat and humidity exchange system being more than 90%, the CO2 concentration being 800 ppm, with scattered light, and keep ventilation; when the Phellinus linteus fruit body turns from orange-yellow to dark yellow and the edge hardens, obtain fresh Phellinus linteus fruit bodies, pick the large ones and leave the small ones.
[0076] Example 4
[0077] Cultivation experiment of authentic Phellinus linteus using the internal circulation heat and humidity exchange system with the Phellinus linteus strain CKS-327 of mulberry tree
[0078] (1) Continuous stress stimulation domestication of Phellinus linteus mother culture
[0079] The slant mother culture of the Phellinus linteus strain CKS-327 in Example 1 was activated and inoculated at the left end of the Phellinus linteus mother culture continuous stress stimulation domestication plate medium. After culturing for 6 days at 26°C for domestication and quality improvement, select the strain with fast growth rate, thick and vigorous growth, and neat edges. Under sterile conditions, open the lid of the plate and blow sterile air for 5 minutes every day for air-drying tolerance domestication. Repeat the domestication multiple times until the mycelium covers the plate, and then select the strain with neat edges and thick and vigorous growth at the right end for standby;
[0080] Among them, every 1L of the left end of the Phellinus linteus mother culture continuous stress stimulation domestication plate medium contains the following raw materials by weight: 220g of potatoes, 21g of glucose, 0.9g of MgSO4, 1.4g of KH2PO4, 0.4g of mulberry root bark element, 18.0g of agar, and the balance is water. After the medium solidifies, make a hole at the center position;
[0081] Every 1L of the right end of the Phellinus linteus mother culture continuous stress stimulation domestication plate medium contains the following raw materials by weight: 220g of potatoes, 21g of glucose, 0.9g of MgSO4, 1.4g of KH2PO4, 1.3g of hydrolyzed tannin, 18.0g of agar, and the balance is water;
[0082] The preparation method of the Phellinus linteus mother culture continuous stress stimulation domestication plate medium is: place the culture dish obliquely, pour the left-end solid medium into the culture dish, and under sterile conditions, use a sterile scalpel to remove the left-end solid medium whose bottom layer exceeds the semi-circle diameter. Raise and tilt the blank end of the culture dish, pour the right-end solid medium into the blank end of the culture dish, so that the right-end solid medium covers a part of the left-end solid medium at the joint, and solidify to obtain the Phellinus linteus mother culture continuous stress stimulation domestication plate medium. Use a sterile punch to make a hole at the center position of the left end for inoculation;
[0083] (2) Stress stimulation culture of Phellinus linteus solid-liquid mixed fermentation agent
[0084] Under sterile conditions, inoculate the strain domesticated through the mother culture into the Phellinus linteus solid-liquid mixed fermentation agent medium. In the dark environment, statically culture at 23°C for 12 hours, and then ferment and culture at 27°C under magnetic stirring at 620 rpm for 10 days to obtain a high-quality and stable Phellinus linteus solid-liquid mixed fermentation agent for standby;
[0085] Among them, every 1L of the Phellinus linteus solid-liquid mixed fermentation agent medium contains the following raw materials by weight: 230g of potatoes, 21g of glucose, 7g of water-soluble soybean cake powder, 0.04g of Na2SeO3, 1.2g of MgSO4, 1.4g of KH2PO4, 0.4g of mulberry root bark element, 0.6g of hydrolyzed tannin, and the balance is water, and the pH is 6.5;
[0086] (3) Cultivation of fresh mulberry branch segment cultivation species
[0087] Under aseptic conditions, the homogeneous and stable solid-liquid mixed fermentation agent of Phellinus igniarius is inoculated into the fresh mulberry branch segment cultivation medium, and then transferred to an incubation room for cultivation under constant temperature, constant humidity, and constant carbon dioxide conditions for 63 days. When more than 80% of the cultivation bags show light yellow tumor-like protrusions after the cultivation species mycelium has grown full, transfer the cultivation species to the fruiting room for site adaptation management;
[0088] Among them, the preparation method of the fresh mulberry branch segment cultivation medium is as follows: First, cut the long mulberry branches just cut from the mulberry tree into 19 cm wooden strips, and then tie the mulberry wooden strips into a bundle with two rubber bands as the main material of the cultivation species. Soak one end in a saturated gypsum powder aqueous solution, and soak both ends of the mulberry wooden strip bundle for 6 hours respectively for standby; then prepare the cultivation species auxiliary material according to 82% Phellodendron amurense sawdust, 16% wheat bran, 1.0% gypsum powder, 1.0% lime powder, and 48% water content. Finally, complete the bagging production of the fresh mulberry branch segment cultivation medium according to the structure of 2 cm cultivation species auxiliary material at the bottom, 19 cm cultivation species main material in the middle, and 3 cm cultivation species auxiliary material at the top;
[0089] (4) Management of fruiting inside the internal circulation heat and humidity exchange system
[0090] As Figure 1 shown, the internal circulation heat and humidity exchange system is composed of three module units. Among them, the first module unit 1 is shaped like a storage granary, with a sharp top and a thick bottom, hollow, with a lifting handle 4 at the top, a dust-proof air inlet 5 near the lower part of the side close to the top, and an exhaust device 6 near the upper part of the opposite side close to the bottom; the second module unit 2 is shaped like a transparent water basin, with a reverse flow hole 7 with a diameter of 5 mm around the side close to the top eaves, four water guiding devices 8 connecting the upper and lower parts at the bottom, and a sand bed 9 containing 6% gypsum powder laid at the bottom; the third module unit 3 is shaped like a transparent water bucket, with a heating rod 10 that can accurately control the temperature fixed at the bottom, and the third module unit 3 is filled with pure water 11;
[0091] After the cultivation species has completed color transformation and adapted to the site, make a cut on the side of the cultivation bag to prepare for fruiting, and at the same time make a cut at the center of the bottom of the cultivation bag to wait for continuous humidification by the internal circulation heat and humidity exchange system; then bury the bottom of the cultivation species 6 cm deep in the sand bed of the internal circulation heat and humidity exchange system, accurately control the fruiting conditions, the water temperature at the bottom of the internal circulation heat and humidity exchange system is 38 °C, the external environment of the internal circulation heat and humidity exchange system is 28 °C, the humidity in the space above the sand bed inside the internal circulation heat and humidity exchange system is above 90%, the CO2 concentration is 1200 ppm, with scattered light, and keep ventilation; when the Phellinus igniarius fruit body turns from orange-yellow to dark yellow and the edge hardens, obtain fresh Phellinus igniarius fruit bodies, pick the large ones and leave the small ones.
[0092] Example 5
[0093] Cultivation Experiment of Authentic Phellinus linteus with Phellinus linteus Strain CKS-327 on Mulberry Trees Using an Internal Circulation Heat and Humidity Exchange System
[0094] (1) Continuous Stress Stimulation and Domestication of Phellinus linteus Mother Culture
[0095] The slant mother culture of Phellinus linteus strain CKS-327 in Example 1 was activated and inoculated at the left end of the Phellinus linteus mother culture continuous stress stimulation and domestication plate medium. After culturing at 26°C for 7 days for domestication and quality improvement, the strain with fast growth rate, thick and vigorous growth, and neat edges was selected. Under sterile conditions, the lid of the plate was opened every day to blow sterile air for 3 minutes for air-drying tolerance domestication. After repeated domestication until the mycelium covered the plate, the strain with neat edges, thick and vigorous growth at the right end was selected for standby;
[0096] Among them, each 1L of the left end of the Phellinus linteus mother culture continuous stress stimulation and domestication plate medium contains the following raw materials by weight: 225g of potatoes, 20g of glucose, 1.0g of MgSO4, 1.3g of KH2PO4, 0.5g of mulberrochromene, 18.0g of agar, and the balance is water. After the medium solidifies, a hole is punched at the center position;
[0097] Each 1L of the right end of the Phellinus linteus mother culture continuous stress stimulation and domestication plate medium contains the following raw materials by weight: 225g of potatoes, 20g of glucose, 1.0g of MgSO4, 1.3g of KH2PO4, 1.4g of hydrolyzed tannins, 18.0g of agar, and the balance is water;
[0098] The preparation method of the Phellinus linteus mother culture continuous stress stimulation and domestication plate medium is: place the culture dish obliquely, pour the left-end solid medium into the culture dish, and under sterile conditions, use a sterile scalpel to remove the left-end solid medium at the bottom exceeding the semi-circle diameter. Raise and place the blank end of the culture dish obliquely, pour the right-end solid medium into the blank end of the culture dish, so that the right-end solid medium covers a part of the left-end solid medium at the joint, and solidify to obtain the Phellinus linteus mother culture continuous stress stimulation and domestication plate medium. Use a sterile punch to punch a hole at the center position of the left end for inoculation;
[0099] (2) Stress Stimulation Culture of Phellinus linteus Solid-Liquid Mixed Fermenter
[0100] Under sterile conditions, the strain domesticated through the mother culture was inoculated into the Phellinus linteus solid-liquid mixed fermenter medium. In the dark environment, it was statically cultured at 23°C for 12h, and then fermented and cultured at 26°C under magnetic stirring at 620rpm for 9d to obtain a high-quality and stable Phellinus linteus solid-liquid mixed fermenter for standby;
[0101] Among them, each 1 L of the solid-liquid mixed fermentation agent culture medium of Phellinus igniarius contains the following raw materials by weight: 220 g of potatoes, 22 g of glucose, 6 g of water-soluble soybean cake powder, 0.03 g of Na2SeO3, 1.1 g of MgSO4, 1.2 g of KH2PO4, 0.5 g of mulberrochromene, 0.7 g of hydrolyzed tannin, the balance being water, and the pH being 6.5;
[0102] (3) Cultivation of fresh mulberry branch segments as inoculum
[0103] The homogeneous and stable solid-liquid mixed fermentation agent of Phellinus igniarius is inoculated into the fresh mulberry branch segment inoculum culture medium under sterile conditions, and then transferred to an incubation room for cultivation under constant temperature, constant humidity and constant carbon dioxide conditions for 62 d. When more than 80% of the inoculum bags show light yellow tumor-like protrusions after the inoculum mycelium has grown fully, the inoculum is transferred to the fruiting room for site adaptation management;
[0104] Among them, the preparation method of the fresh mulberry branch segment inoculum culture medium is as follows: First, cut the long mulberry branches just cut from the mulberry tree into 19-cm wooden strips, and then tie the mulberry wooden strips into a bundle with two rubber bands as the main material of the inoculum. One end is immersed in a saturated aqueous solution of gypsum powder, and both ends of the mulberry wooden strip bundle are immersed for 6 h for standby; then prepare the auxiliary material of the inoculum according to 81% of Phellodendron amurense sawdust, 17% of wheat bran, 1.0% of gypsum powder, 1.0% of lime powder, and 47% of water content; finally, complete the bagging production of the fresh mulberry branch segment inoculum culture medium according to the structure of 3 cm of the auxiliary material of the inoculum at the bottom, 19 cm of the main material of the inoculum in the middle, and 2 cm of the auxiliary material of the inoculum at the top;
[0105] (4) Management of fruiting inside the internal circulation heat and humidity exchange system
[0106] As Figure 1 shown, the internal circulation heat and humidity exchange system is composed of three modular units. Among them, the first modular unit 1 is shaped like a storage granary, with a hollow upper part that is pointed and a thick lower part, with a lifting handle 4 at the top, a dust-proof air inlet 5 on the side near the middle of the top, and an exhaust device 6 on the opposite side near the upper part of the bottom; the second modular unit 2 is shaped like a transparent water basin, with a reverse flow hole 7 with a diameter of 5 mm around the side near the top eaves, four water guiding devices 8 that connect the upper and lower parts at the bottom, and a sand bed 9 containing 7% of gypsum powder laid at the bottom; the third modular unit 3 is shaped like a transparent water bucket, with a heating rod 10 that can accurately control the temperature fixed at the bottom, and pure water 11 filled in the third modular unit 3;
[0107] After the cultivated species have completed color transformation and adapted to the site, make incisions on the sides of the mushroom bags to prepare for yellowing. At the same time, make an incision in the center of the bottom of the mushroom bags and wait for the internal circulation hot and humid exchange system to continuously replenish moisture. Then, bury the bottom of the cultivated species 5 cm deep in the sand bed of the internal circulation hot and humid exchange system, precisely control the yellowing conditions, with the water temperature at the bottom of the internal circulation hot and humid exchange system being 35°C, the external environment of the internal circulation hot and humid exchange system being 30°C, the humidity above the sand bed in the internal circulation hot and humid exchange system being over 90%, the CO2 concentration being 1000 ppm, with scattered light, and keep ventilation. When the fruiting bodies of Phellinus linteus turn from orange-yellow to dark yellow and the edges harden, obtain fresh fruiting bodies of Phellinus linteus, pick the large ones and leave the small ones.
[0108] Performance test
[0109] 1. Take the fruiting bodies of Phellinus linteus prepared in Examples 2-5, as well as wild perennial Phellinus linteus from Qinling Mountains (commercially available 1) and wild perennial Phellinus linteus from Tibet (commercially available 2), and test the content of their effective active ingredients and main agronomic traits respectively. The results are shown in Table 1.
[0110] Table 1 Comparative analysis of the content of effective active ingredients and main agronomic traits of the fruiting bodies of Phellinus linteus in Examples 2-5 with commercially available 1-2
[0111]
[0112] As can be seen from Table 1, the content of effective active ingredients and main agronomic traits of the fruiting bodies of Phellinus linteus in Examples 2-5 are all superior to those of commercially available 1-2.
[0113] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather will be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A Sanghuangporus sanghuang strain of mulberry tree, characterized in that, The Sanghuangporus sanghuang strain is isolated from the authentic perennial wild Sanghuangporus sanghuang fruit body, named Sanghuangporus sanghuang CKS-327, with the preservation number of CCTCC NO: M20242849. It was preserved in the China Center for Type Culture Collection on December 18, 2024, and the preservation address is Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
2. A method for cultivating Phellinus igniarius using an internal circulation heat and moisture exchange system, characterized in that, Specifically, it includes the following steps: (1) Continuous stress stimulation and domestication of Sanghuang mother culture After activating the Sanghuang mother culture described in Claim 1, inoculate it at the left end of the Sanghuang mother culture continuous stress stimulation and domestication plate medium. After culturing, domesticating, and improving the quality, select the strain with fast growth rate, thick and vigorous growth, and neat edges. Under sterile conditions, open the lid of the plate every day and blow sterile air for 2-5 minutes for air-drying tolerance domestication. Repeat the domestication multiple times until the mycelium covers the plate, and then select the strain with neat edges, thick and vigorous growth at the right end for standby. (2) Stress stimulation culture of Sanghuang solid-liquid mixed fermentation agent Under sterile conditions, inoculate the strain domesticated from the mother culture into the Sanghuang solid-liquid mixed fermentation agent medium, and culture it statically in the dark environment, and then ferment and culture it under magnetic stirring to obtain a high-quality and stable Sanghuang solid-liquid mixed fermentation agent for standby. (3) Cultivation of fresh mulberry twig segment cultivation species Under sterile conditions, inoculate the homogeneous and stable Sanghuang solid-liquid mixed fermentation agent into the fresh mulberry twig segment cultivation species medium, and then transfer it to the mushroom spawn room for cultivation under constant temperature, constant humidity, and constant carbon dioxide conditions. When more than 80% of the mushroom spawn bags show light yellow tumor-like protrusions after the mycelium of the cultivation species covers them, transfer the cultivation species to the fruiting room for site adaptation management. (4) Yellowing management in the internal circulation heat and humidity exchange system After the cultivation species complete color transformation and adapt to the site, make a cut on the side of the mushroom bag to prepare for yellowing, and at the same time make a cut in the center of the bottom of the mushroom bag to wait for continuous humidification by the internal circulation heat and humidity exchange system; then bury the bottom of the cultivation species 5-6 cm deep in the sand bed of the internal circulation heat and humidity exchange system, and precisely control the yellowing conditions. The water temperature at the bottom of the internal circulation heat and humidity exchange system is 30-40 °C, the external environment of the internal circulation heat and humidity exchange system is 25-30 °C, the humidity in the space above the sand bed in the internal circulation heat and humidity exchange system is above 90%, the CO2 concentration is 800-1500 ppm, with scattered light, and keep ventilation; when the Sanghuang fruit body turns from orange-yellow to dark yellow and the edge hardens, obtain fresh Sanghuang fruit bodies, pick the large ones and leave the small ones.
3. A method for cultivating Phellinus igniarius using an internal circulation heat and moisture exchange system according to claim 2, characterized in that, In step (1), each 1 L of the left end of the Sanghuang mother culture continuous stress stimulation and domestication plate medium contains the following raw materials by weight: 210-230 g of potatoes, 20-22 g of glucose, 0.8-1.0 g of MgSO4, 1.0-1.5 g of KH2PO4, 0.3-0.5 g of mulberrin, 18.0 g of agar, and the balance is water. After the medium solidifies, make a hole at the center position.
4. The method for cultivating Phellinus igniarius by using an internal circulation heat and moisture exchange system according to claim 2, characterized in that, In step (1), for every 1 L of the continuous stress stimulation and domestication plate medium of the Phellinus igniarius mother strain, it contains the following raw materials by weight: 210 - 230 g of potatoes, 20 - 22 g of glucose, 0.8 - 1.0 g of MgSO4, 1.0 - 1.5 g of KH2PO4, 1.0 - 1.5 g of hydrolyzed tannin, 18.0 g of agar, and the balance is water.
5. The method for cultivating Phellinus igniarius by using an internal circulation heat and humidity exchange system according to claim 2, wherein, In step (1), the preparation method of the continuous stress stimulation and domestication plate medium of the Phellinus igniarius mother strain is as follows: Place the culture dish obliquely, pour the left-end solid medium into the culture dish, under sterile conditions, use a sterile scalpel to remove the left-end solid medium at the bottom that exceeds the semi-circle diameter, raise and place the blank end of the culture dish obliquely, pour the right-end solid medium into the blank end of the culture dish, so that the right-end solid medium covers a part of the left-end solid medium at the joint, and solidify to obtain the continuous stress stimulation and domestication plate medium of the Phellinus igniarius mother strain. Use a sterile punch to punch a hole at the center position of the left end for inoculation.
6. A method for cultivating Phellinus igniarius using an internal circulation heat and humidity exchange system according to claim 2, characterized in that, In step (1), the temperature of the cultivation is 26 °C and the time is 6 - 7 d.
7. A method for cultivating Phellinus igniarius using an internal circulation heat and moisture exchange system according to claim 2, characterized in that, In step (2), for every 1 L of the solid-liquid mixed fermentation agent medium of the Phellinus igniarius, it contains the following raw materials by weight: 220 - 240 g of potatoes, 20 - 22 g of glucose, 5 - 8 g of water-soluble soybean cake powder, 0.03 - 0.05 g of Na2SeO3, 1.1 - 1.3 g of MgSO4, 1.3 - 1.5 g of KH2PO4, 0.3 - 0.5 g of mulberry root bark element, 0.5 - 0.8 g of hydrolyzed tannin, the balance is water, and the pH is 6.
5.
8. A method for cultivating Phellinus igniarius using an internal circulation heat and moisture exchange system according to claim 2, characterized in that, In step (2), the temperature of the static cultivation is 23 °C and the time is 12 h; the rotation speed of the magnetic stirring is 620 rpm; the temperature of the fermentation cultivation is 26 - 28 °C and the time is 9 - 11 d.
9. A method for cultivating Phellinus igniarius by using an internal circulation heat and moisture exchange system according to claim 2, characterized in that, In step (3), the preparation method of the fresh mulberry twig segment cultivation medium is as follows: First, cut the freshly harvested long mulberry twigs from the mulberry tree into 18 - 20 cm wooden strip segments, then tie the mulberry wooden strip segments into a mulberry wooden strip bundle with two rubber bands as the main material for cultivation, soak one end in a saturated gypsum powder aqueous solution, and soak both ends of the mulberry wooden strip bundle for 6 h for standby; then prepare the cultivation auxiliary material according to 80% - 83% of Phellodendron amurense sawdust, 15% - 18% of wheat bran, 1.0% of gypsum powder, 1.0% of lime powder, and a water content of 45% - 50%; finally, complete the bagging production of the fresh mulberry twig segment cultivation medium according to the structure of 2 - 3 cm of cultivation auxiliary material at the bottom, 18 - 20 cm of cultivation main material in the middle, and 2 - 3 cm of cultivation auxiliary material at the top; the mycelium growth cultivation time after inoculation is 50 - 65 d.
10. A method for cultivating Phellinus igniarius using an internal circulation heat and moisture exchange system according to claim 2, characterized in that, In step (4), the internal circulation heat and moisture exchange system is constructed by three module units. Among them, the first module unit is shaped like a grain storage bin, with a pointed top, thick bottom, and hollow inside. There is a lifting handle at the top, a dust-proof air inlet near the lower part of the side close to the top, and an exhaust device near the upper part of the opposite side close to the bottom; the second module unit is shaped like a transparent water basin, with reverse flow holes with a diameter of 5 mm around the side close to the top eaves, four water guiding devices connecting the upper and lower parts at the bottom, and a sand bed containing 5%-8% gypsum powder laid at the bottom; the third module unit is shaped like a transparent water bucket, with a heating rod that can precisely control the temperature fixed at the bottom, and pure water is filled in the third module unit.
Citation Information
Patent Citations
Mulberry bark powder, as well as preparation method and application of mulberry bark powder
CN105029431A
Hydrolysable tannin compound, pharmaceutical composition and use thereof
CN106065023A
Phellinus igniarius (L.ex Fr.) cultivating seed preparation method
CN106472104A
Method for cultivating phellinus igniarius by using mulberry twig wood sections
CN112586271A
Method for improving phellinus igniarius cultivation efficiency through laboratory intelligent cultivation management
CN112616556A