Cotinus coggygria drought inducible promoter and application thereof

Abstract

The invention discloses a cotinus coggygria drought inducible promoter and application thereof, the DNA sequence of the promoter is as shown in SEQ ID No.1, proCcDT1 is cloned from a cotinus coggygria CcDT1 gene promoter region, and experimental verification is carried out. Firstly, promoter region elements are analyzed, and a result shows that the promoter region elements contain a plurality of cis-acting elements possibly participating in response to abiotic stress. Afterwards, a proCcDT1-GUS transgenic plant is subjected to 10% PEG (polyethylene glycol) simulated drought treatment, and the GUS dyeing degree of the transgenic plant is enhanced, so that the GUS expression level driven by the promoter under a drought induction condition is increased, and the promoter is proved to be induced by drought stress. The promoter proCcDT1 is introduced into an arabidopsis thaliana genome through a genetic transformation technology, so that the promoter proCcDT1 can be stably induced by drought stress in heterologous plants, and the practical application of the promoter proCcDT1 has important value for cultivating drought-tolerant cotinus coggygria varieties.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to a promoter that is induced by drought in Cotinus coggygria Scop. Background Art

[0002] A promoter is a DNA sequence that participates in the initiation and regulation of gene expression and is an important element for gene expression regulation. According to the action mode and function, it can be divided into three categories: constitutive promoters, inducible promoters, and tissue-specific promoters. The expression of inducible promoters is induced by certain specific physical or chemical signal stimuli, and the transcription level of genes will be greatly increased under the regulation of this promoter under induction conditions. Some stress-inducible promoters such as cold, heat, light, and drought have been reported in previous studies. Stress-inducible promoters will be activated when receiving stress signal stimuli and promote the expression of related transcription factors, and then regulate the expression of downstream genes so that plants can respond to stress and resist stress to protect themselves. Therefore, by exploring the expression of foreign genes regulated by inducible promoters in plants, technical means can be provided for crop breeding.

[0003] Cotinus coggygria Scop. belongs to the genus Cotinus in the family Anacardiaceae, also known as red leaves, red-leaved Cotinus coggygria Scop., etc., and is a deciduous small tree or shrub. It is an important landscape plant in China, famous for its red leaves, and has high ornamental and economic value. At the same time, wild Cotinus coggygria Scop. is also an important resource tree species, which can be used to extract yellow industrial dyes, and its leaves can also be used to prepare spices, etc.

[0004] Plants will have different degrees of physiological and ecological changes after being stressed. Drought stress will affect the synthesis of plant chlorophyll and thus affect the formation of plant leaf color. In severe cases, plants may turn chlorotic or fade. And leaf color is one of the important characteristics of landscape plants. As an important red-leaf landscape plant, effectively maintaining the leaf color of Cotinus coggygria Scop. can enhance its ornamental value as a landscape plant. The increase in arid land is undoubtedly a huge challenge for maintaining the leaf color of Cotinus coggygria Scop. and ensuring tree yield. Therefore, excavating drought stress-related resistance genes in Cotinus coggygria Scop. can provide a theoretical basis for the genetic breeding of Cotinus coggygria Scop., and its practical application also has important value for cultivating drought-tolerant Cotinus coggygria Scop. varieties. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an inducible promoter that initiates the transcription of downstream genes under drought stress conditions.

[0006] The technical solution of the present invention is: a drought-inducible promoter proCcDT1, and the nucleotide sequence of the promoter proCcDT1 is as shown in SEQ ID No.1.

[0007] A primer pair for amplifying the above-mentioned promoter proCcDT1, wherein the upstream primer sequence of the primer pair is as shown in SEQ ID No. 2, and the downstream primer sequence is as shown in SEQ ID No. 3.

[0008] A recombinant vector containing the above-mentioned promoter proCcDT1.

[0009] The application of the above-mentioned promoter proCcDT1 in initiating the expression of a target gene.

[0010] The application of the above-mentioned promoter proCcDT1 in regulating plant drought tolerance.

[0011] The application of the above-mentioned promoter proCcDT1 in drought-resistant plant breeding.

[0012] Furthermore, the plant is Cotinus coggygria or Arabidopsis thaliana.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The promoter proCcDT1 was cloned from the promoter region of the Cotinus coggygria CcDT1 gene. Through the analysis of this promoter region, it contains multiple cis-acting elements that may be involved in responding to abiotic stresses. When drought treatment was performed on Arabidopsis transgenic plants containing proCcDT1::GUS, it was found that the promoter proCcDT1 drove the expression of the GUS gene in Arabidopsis. Compared with the untreated plants, the staining degree of the Arabidopsis transgenic plants was significantly deeper after drought treatment, proving that the promoter proCcDT1 can respond to drought stress. The promoter proCcDT1 can stably function in heterologous plants and can enhance the expression level of downstream genes under drought stress conditions. Therefore, this promoter can be used as an inducible promoter in the research on improving crop stress resistance, and its practical application has important value for genetic engineering breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Electrophoresis diagram of the proCcDT1 promoter fragment.

[0016] Figure 2 Analysis of the proCcDT1 promoter sequence.

[0017] Figure 3 GUS staining analysis of proCcDT1::GUS transgenic Arabidopsis under 10% PEG simulated drought treatment conditions. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0018] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from commercial channels unless otherwise specified.

[0019] 1. Promoter Cloning

[0020] Search for and download the Pistacia chinensis Bunge DT1 promoter region sequence from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database, design primers (Table 2) and add restriction enzyme sites KpnⅠ and SalⅠ at both ends. Use Pistacia chinensis Bunge genomic DNA as a template for PCR amplification of the proCcDT1 promoter fragment, and detect the amplification result by 1% agarose gel. After recovering this DNA, ligate it to the GUS expression vector, and determine the sequence of the proCcDT1 promoter fragment by sequencing alignment. The result shows that the length of this promoter region is 1479 bp.

[0021] Table 1 The promoter amplification system is as follows (total 20 μL)

[0022]

[0023] Table 2 Primer sequences of promoter proCcDT1

[0024] Primer name Primer sequences (5`-3`) pCcDT1-F(Kpn I) GGGGTACCTGGCTCGGGTATTGTCTG(SEQ ID No.2) pCcDT1-R(Sal I) GCGTCGACGTCAGCAAGTGAAACG(SEQ ID No.3)

[0025] Experimental results:

[0026] The amplification product with a size of 1479 bp was detected by agarose gel electrophoresis, and the result is as Figure 1 shown, and its nucleotide sequence is as shown in SEQ ID No.1.

[0027] 2. Promoter Sequence Analysis

[0028] Use the PLACE (http: / / www.dna.affrc.go.jp / PLACE / ) database for promoter regulatory element analysis( Figure 2 ).

[0029] Experimental results:

[0030] The cis - acting elements contained in the promoter proCcDT1 are shown in Table 3.

[0031] Table 3 Summary table of essential promoter elements and elements responding to environmental stress contained in promoter proCcDT1

[0032]

[0033]

[0034] 3. Transgenic Arabidopsis thaliana Plants

[0035] The successfully constructed proCcDT1::GUS vector was transferred into wild-type Arabidopsis thaliana (Col-0) by Agrobacterium-mediated floral dip method, and the T0 generation seeds were collected. The seeds were plated on 1 / 2 MS medium containing hygromycin for screening of transgenic plants. The plants with normal growth on the resistant medium were transplanted and then identified by PCR and GUS staining. GUS histochemical staining was observed in the transgenic Arabidopsis plants, demonstrating that the proCcDT1 promoter could initiate the expression of the exogenous gene GUS vector.

[0036] 4. Drought stress treatment experiment

[0037] The proCcDT1 transgenic Arabidopsis plants grown on 1 / 2 MS medium for 8 days were selected and immersed in 10% PEG for simulated drought treatment. After 3 hours, the materials were collected for GUS staining. The staining results are shown in Figure 3 , and compared with the control group, the GUS staining degree of the transgenic Arabidopsis seedlings under the 10% PEG drought treatment condition was significantly deepened, indicating that the proCcDT1 promoter was induced by drought stress.

Claims

1. A drought-inducible promoter proCcDT1, the nucleotide sequence of the promoter proCcDT1 is shown in SEQ ID No.

1.

2. The primer pair for amplifying the promoter proCcDT1 described in claim 1, characterized in that, The upstream primer sequence of the primer pair is shown in SEQ ID No. 2, and the downstream primer sequence is shown in SEQ ID No.

3.

3. A recombinant vector containing the promoter proCcDT1 described in claim 1.

4. The application of the promoter proCcDT1 described in claim 1 in initiating the expression of a target gene.

5. The application of the promoter proCcDT1 described in claim 1 in regulating plant drought tolerance.

6. The application of the promoter proCcDT1 described in claim 1 in drought-tolerant plant breeding.

7. The application according to claim 5 or 6, characterized in that, The plant is Cotinus coggygria or Arabidopsis thaliana.

Images