MiRNA-A for inhibiting Zika virus and application of miRNA-A

Abstract

The invention discloses miRNA-A for inhibiting Zika virus and application of the miRNA-A, and belongs to the technical field of biology. The sequence of the miRNA-A is as follows: a positive chain is 5 '-UUAGUGUUGUCAGGCCUGCUA-3', and a negative chain is 5 '-UAGCAGGCCUGCACAACACA-3'. Compared with the known vsiRNA-1 sequence in the prior art, the vsiRNA-A provided by the invention has a better effect of inhibiting the Zika virus, and provides more choices for the treatment of diseases related to the Zika virus.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an miRNA-A for inhibiting Zika virus and its application. Background Art

[0002] Zika virus can cross the blood-fetal barrier and enter the fetus, resulting in abnormal proliferation and differentiation of neural stem cells in the fetal brain, causing massive death of neurons and leading to a serious complication - microcephaly in newborns.

[0003] Zika virus (Zikavirus, ZIKV) is a single-stranded positive-sense RNA virus of the genus Flavivirus in the family Flaviviridae; it was first discovered in rhesus monkeys in the Zika Forest of Uganda in 1947 and was named accordingly. The ZIKV virus is an icosahedron enveloped by a capsid with a diameter of about 40 - 60 nm. Mature ZIKV contains an inner nucleocapsid composed of a linear positive-sense genomic RNA and multiple copies of the viral capsid protein C, and an outer envelope composed of two viral proteins: the M protein (Viral Membrane), the E protein (Viral Envelope), and a lipid bilayer derived from the cell membrane. The M protein is formed by proteolytic cleavage of the viral prM protein precursor. During the assembly of virus particles, the prM protein and the E protein of ZIKV interact and form a dimer in the endoplasmic reticulum of the host. At this time, the RNA genome of the virus is recognized and encapsulated by the viral capsid protein C, and then recognized and further encapsulated by the dimer formed by the prM protein and the E protein and the lipid bilayer of the cell membrane to form an immature ZIKV virus. Subsequently, the prM protein is recognized and cleaved by furin protease on the Golgi apparatus to become the mature M protein, thereby triggering the release of ZIKV virus particles, and the mature ZIKV virus particles are released outside the cell.

[0004] The genome of the ZIKV virus is a single-stranded positive-sense RNA containing a single open reading frame, with a length of approximately 11,000 bp, consisting of a coding region and two non-coding regions (UTRs) at the 5'-end and 3'-end; it encodes approximately 3,500 amino acids. The RNA genome of the ZIKV virus encodes three structural proteins of ZIKV from the N-terminus to the C-terminus: capsid protein C, envelope protein E, membrane precursor protein prM, and seven non-structural proteins: NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5.

[0005] Zika virus can replicate in the epithelial cells of Aedes aegypti and Aedes albopictus, and circulate in their blood and saliva; Zika virus is mainly transmitted widely through bites, and can be transmitted to adults and newborns through mosquito vectors and sexual contact, which can cause a variety of neurological diseases, such as encephalopathy, meningoencephalitis, myelitis and Guillain-Barré syndrome, etc. More seriously, Zika virus has a strong tropism for human neural stem cells, can penetrate the blood-brain barrier, leading to abnormal proliferation and differentiation of neural stem cells in the embryonic brain, causing a large number of neurons to die, resulting in a serious complication - microcephaly in newborns, and even leading to fetal miscarriage and death.

[0006] Zika virus has become a potential factor threatening global human health and has been recognized by the World Health Organization (WHO) as a public health emergency of international concern; Zika virus infection remains a major and persistent health challenge at present. However, the current research on the replication and pathogenic mechanism of Zika virus is still insufficient, and there is still a lack of approved vaccines or specific treatment methods to prevent or treat Zika virus infection; therefore, how to cope with the severe challenges brought by Zika virus infection to human society and develop specific anti-ZIKV drugs for the treatment of related diseases caused by ZIKV infection is the most effective strategy. Summary of the Invention

[0007] One object of the present invention is to provide a miRNA for inhibiting Zika virus, and the sequence of the miRNA is as follows:

[0008] Positive strand: 5’-UUAGUGUUGUCAGGCCUGCUA-3’;

[0009] Negative strand: 5’-UAGCAGGCCUGACAACACUAA-3’.

[0010] Another object of the present invention is to provide a vector containing the above miRNA.

[0011] Preferably, the vector is a viral vector or a liposome vector.

[0012] More preferably, the viral vector is an adenovirus vector.

[0013] A third object of the present invention is to provide the application of the above miRNA or vector in the preparation of products for inhibiting Zika virus.

[0014] Preferably, the product is a reagent or a kit.

[0015] More preferably, the product is a drug.

[0016] A fourth object of the present invention is to provide a product for inhibiting Zika virus, and the product contains the above miRNA or vector.

[0017] Preferably, the product is a reagent or a kit.

[0018] Preferably, the product is a drug.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The vsiRNA-A provided by the present invention has a better effect of inhibiting Zika virus, providing more options for the treatment of Zika virus-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a diagram showing the results of the expression of the encoded protein E of Zika virus strains MR766 and PRVABC.59 inhibited by transfection of vsiRNA-A in SK-N-BE(2) cells in Example 1.

[0022] Figure 2 It is a diagram showing the results of the mRNA expression of the encoded gene E of Zika virus strains MR766 and PRVABC.59 inhibited by transfection of vsiRNA-A in SK-N-BE(2) cells in Example 1.

[0023] Figure 3 It is a diagram showing the results of the mRNA expression of the encoded genes NS5 and E of Zika virus strains MR766 and PRVABC.59 inhibited by transfection of vsiRNA-A and vsiRNA-1 and comparing the two vsiRNAs in SK-N-BE(2) cells in Example 1.

[0024] Figure 4 It is a diagram showing the results of the expression of the encoded gene E and dsRNA of Zika virus strains MR766 and PRVABC.59 inhibited by transfection of vsiRNA-A and vsiRNA-1 and comparing by confocal experiment in SK-N-BE(2) cells in Example 1, where dsRNA refers to the double-stranded RNA complex during virus replication and is generally used to indicate virus replication.

[0025] Figure 5 It is a diagram showing the results of comparing the replication inhibition of Zika virus strains MR766 and PRVABC.59 by virus plaque assay after transfection of vsiRNA-A and vsiRNA-1 in SK-N-BE(2) cells in Example 1.

[0026] Figure 6 It is a diagram showing the results of observing the morbidity and mortality of mice after infecting with Zika virus by injecting vsiRNA-A and vsiRNA-1 into the brain regions of C57 neonatal mice in Example 1.

[0027] Figure 7 This is the result graph of detecting the virus quantity in the brains of neonatal C57 mice by virus plaque assay on Day 9 after infecting with Zika virus after separately injecting vsiRNA-A and vsiRNA-1 into the brain regions of neonatal C57 mice in Example 1. Detailed implementation mode

[0028] The vsiRNA-A sequence used in the following examples is:

[0029] Sense strand (SEQ ID NO.1): 5’-UUAGUGUUGUCAGGCCUGCUA-3’;

[0030] Antisense strand (SEQ ID NO.2): 5’-UAGCAGGCCUGACAACACUAA-3’.

[0031] The vsiRNA-1 sequence of the positive control group (patent applied for previously, application number 202210331697.5):

[0032] Sense strand (SEQ ID NO.3): 5’-AACGAGAGUUUCUGGUCAUGA-3’;

[0033] Antisense strand (SEQ ID NO.4): 5’-UCAUGACCAGAAACUCUCGUU-3’.

[0034] The sequence of Scramble mimic is as follows:

[0035] Sense strand (SEQ ID NO.5): UGCCUUCAAUUGUGUUAACCUC;

[0036] Antisense strand (SEQ ID NO.6): GAGGUUAACACAAUUGAAGGCA.

[0037] Example 1

[0038] 1 Cell RNA transfection:

[0039] When transfecting RNA into cells, the contamination of RNase needs to be strictly controlled. All pipette tips and opti-MEM reagents need to be RNase-free.

[0040] (1) SK-N-BE(2) cells were separately infected with Zika virus strains MR766 and PRVABC.59, and then the SK-N-BE(2) cells were plated in 6-well plates 24 h in advance. When the cell confluence reached 50 - 60%, transfection was carried out;

[0041] (2) Take two RNase-free EP tubes and add 100 μl of RNase-free opti-MEM medium to each tube respectively;

[0042] (3) Add an appropriate amount of RNA transfection reagent to one tube, and add 5 μl of lipo-2000 transfection reagent to the other tube (transfect vsiRNA-Amimic, vsiRNA-1mimic, and Scramble mimic separately, and the transfection amount is 60 pmol for each). After mixing them respectively, mix the media in the two tubes, gently pipette to mix well, and let it stand at room temperature for 15 min;

[0043] (4) Take out the cells to be transfected from the cell culture incubator, gently drip the medium in (3) into the cell supernatant, shake the culture plate to disperse it evenly, and put it back into the incubator for further culture for 12 h;

[0044] (5) Discard the cell supernatant, replace it with fresh complete medium, continue to culture for 36 h, and then perform subsequent operations.

[0045] 2 Total protein extraction and quantification of cells

[0046] Take out the treated cells from the cell culture incubator and place them on the cell ultra-clean workbench; use a 1 ml pipette to aspirate the cell supernatant (if the supernatant is from cells infected with a virus, the supernatant needs to be placed in a waste liquid cylinder containing 84 disinfectant for 24 - 48 h to kill pathogens).

[0047] (1) Aspirate 1 ml of PBS and gently rinse the cells once, then discard the supernatant;

[0048] (2) Resuspend the cells with 1 ml of PBS. If the cells are adherent tightly, the cells can be scraped off with a cell scraper and transferred into a 1.5 ml EP tube; centrifuge at 500 g for 5 min;

[0049] (3) Discard the supernatant, add 50 - 100 μl of RIPA lysis buffer containing protease inhibitor according to the cell pellet amount to resuspend the cells, and lyse the cells on ice for 30 - 60 min; then centrifuge at 13000 rpm / min for 15 min;

[0050] (4) Transfer the supernatant of the lysate into a new EP tube, take 5 μl of the protein for protein quantification, and add the remaining protein to 5x loading buffer to prepare 1x loading buffer for loading samples; incubate in a 100 °C water bath for 10 min and store at -80 °C for later use;

[0051] (5)Quantify the protein samples according to the protocol of Beyotime BCA Protein Assay Kit (Beyotime, #P0010S); the specific operation is as follows: ① Add BCA standards to the 96-well plate at standard concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / ml; ② Add 2 μl of the sample to the sample wells of the 96-well plate. If the sample is less than 20 μl, supplement it to 20 μl with the standard diluent. Please note the sample volume; ③ Add 200 μl of BCA working solution to each well and incubate at 37 °C for 30 - 45 min; ④ Measure A562 with an enzyme-linked immunosorbent assay (ELISA) reader, or measure the absorbance at a wavelength between 540 - 595 nm; ⑤ Calculate the protein concentration of the sample based on the standard curve and the volume of the sample used.

[0052] 3 Western blot

[0053] (1) Prepare the protein electrophoresis gel: After preparing the protein electrophoresis samples, prepare the protein gel according to the experimental steps of the SDS-PAGE Protein Gel Kit of Enzyme Art Biotechnology Co., Ltd. (take the 10% 1.0 mm 10-well protein gel as an example):

[0054] ① Wash the gel-making glass plates with deionized water, dry them, and install them in the gel-making fixing plate;

[0055] ② Prepare about 5 ml of 10% lower layer gel, mix well, and slowly add it to the gel plate with a pipette, avoiding air bubbles. Add 1 ml of ethanol to press the line to isolate air and flatten the gel surface, and let it stand at room temperature for 30 - 60 min;

[0056] ③ After the lower layer gel solidifies, drain the ethanol, wash it with deionized water, and blot the residual moisture;

[0057] ④ Prepare about 2 ml of upper layer gel, slowly add it to the middle of the gel plate, avoiding air bubbles. Gently add the sample loading comb to the well plate, and let it stand at room temperature for 30 min to complete the preparation of the protein electrophoresis gel;

[0058] (2) Loading: Install the prepared protein electrophoresis gel into the Bio-Rad electrophoresis tank, add 1x SDS protein electrophoresis buffer to the inner and outer tanks respectively, and gently pull out the comb; according to the experimental requirements, slowly add the denatured protein samples to the corresponding holes at a rate of 20 - 40 μg per well, and reserve a loading well to add a prestained protein marker to determine the protein size;

[0059] (3) Electrophoresis: Connect the electrophoresis instrument to the power supply, first use a constant voltage power supply of 70 V for about 30 min. When the sample runs into the lower layer gel, adjust the voltage to 110 V and continue electrophoresis for about 1.5 - 2 h. Stop electrophoresis when the target band runs to the appropriate position;

[0060] (4) Transfer membrane: Cut the PVDF membrane to an appropriate size and immerse it completely in methanol solution for about 30 s to activate the membrane surface. Then transfer the protein gel into the transfer buffer, gently take out the protein gel, and form a "sandwich" transfer membrane structure by tightly fitting the protein gel and PVDF membrane in the order of black side - sponge pad - filter paper - protein gel - PVDF membrane - filter paper - white side. After removing air bubbles, place the transfer clamp in the transfer tank according to the corresponding electrode direction. Add transfer buffer to the scale line and then transfer the transfer tank into the cold storage, and transfer the membrane at a constant current of 200 mA for 2 - 3 h.

[0061] (5) Membrane blocking: Prepare 5% skim milk or BSA membrane blocking solution with TBST, completely immerse the transferred PVDF membrane in the blocking solution, and block it at room temperature for 1 h.

[0062] (6) Antibody incubation: ① Wash the blocked PVDF membrane 3 times with TBST, 5 min each time. ② After trimming the target band, add it to the corresponding primary antibody solution and incubate overnight at 4 °C. ③ Remove the antibody and wash 3 times with TBST, 10 min each time. ④ Add the prepared secondary antibody solution to the corresponding membrane and incubate at room temperature for 45 - 60 min. ⑤ Wash 3 times with TBST, 10 min each time.

[0063] (7) ECL development: Place the PVDF membrane with the protein side up, add ECL chemiluminescent solution, incubate for 1 - 2 min, and then develop with a hypersensitive chemiluminescent imager. Save the image results for data analysis.

[0064] 4 Cell RNA extraction

[0065] Extract RNA using the Trizol method. The whole process needs to be completed on ice, and all consumables used are RNase-free.

[0066] (1) Discard the cell supernatant medium in the 6-well plate, wash it once with PBS, add 1 ml of Trizol solution to each well, gently blow down the cells, and transfer them to a 1.5 ml RNase-free EP tube.

[0067] (2) Place the EP tube in a vibrating rotary instrument and vortex for a few seconds, or first freeze the EP tube in an -80 °C refrigerator and thaw it once to better promote cell lysis.

[0068] (3) Add 200 μl of chloroform to the tube at a ratio of 1:5, vortex for 5 - 10 s, let it stand on ice for 5 min, then invert and mix up and down 3 - 5 times, and centrifuge at 13000 rpm / min at 4 °C for 15 min.

[0069] (4) Take out the EP tube and place it on ice. At this time, the liquid in the tube has stratified. Slowly aspirate the upper transparent liquid into a new 2 ml RNase-free EP tube (about 500 - 600 μl). Add 2.5 - 3 volumes of absolute ethanol to each tube (add 10 μl of sodium acetate and 1 μl of glycogen to every 600 μl of absolute ethanol). Immediately invert the EP tube gently to mix well, and then store it at -80 °C overnight.

[0070] (5) Take out the EP tube and place it on ice for 5 - 10 min, then centrifuge at 13,000 rpm at 4 °C for 15 min, and discard the supernatant.

[0071] (6) Add 1.0 ml of 75% absolute ethanol (prepared with DEPC water), and continue to centrifuge at 13,000 rpm at 4 °C for 15 min.

[0072] (7) Gently aspirate the supernatant, open the tube cap to allow the residual ethanol in the tube to volatilize, then add 30 - 50 μl of DEPC water to dissolve it. After measuring the concentration, continue to use it for subsequent experiments or store it at -80 °C.

[0073] 5 RT-PCR:

[0074] Total RNA was extracted from experimental cells for cDNA synthesis and real-time PCR, and reverse transcription was performed using a cDNA synthesis kit (Takara):

[0075] cDNA was obtained from 1 μg of RNA, and then quantitative PCR (RT-qPCR) analysis was performed on 20 μl of cDNA using SYBR Green Supermix reagent (Bio-Rad). The results are shown in Figure 2 and Figure 3 . The gene expression level was normalized to GAPDH. The relative mRNA expression was calculated by the change in cycle threshold method as 2 -△△C(t) . The specificity of RT-qPCR amplification was evaluated by melting curve analysis.

[0076] 6 Cell immunofluorescence assay

[0077] (1) Culture the cells in a confocal cell culture dish in advance for 12 h until the cells are completely adherent.

[0078] (2) Aspirate the cell supernatant, add 1 ml of room temperature PBS solution to wash away the non-adherent cells in the upper layer of the cells.

[0079] (3) Add 1 ml of 4% paraformaldehyde and incubate at room temperature for 15 min.

[0080] (4) Discard the paraformaldehyde, add 1 ml of PBS to wash away the residual liquid.

[0081] (5) Prepare a cell permeabilization solution (PBS solution containing 0.5% Triton X-100), add it to the culture dish, and perform permeabilization treatment at room temperature for 15 min;

[0082] (6) Discard the supernatant and wash once with PBS;

[0083] (7) Add 1 ml of PBS blocking solution containing 2% BSA and incubate at room temperature for 1 h;

[0084] (8) Prepare the primary antibody with PBST solution containing 1% BSA at a ratio of 1:100 - 500, and incubate overnight at 4 °C in a wet box;

[0085] (9) Aspirate the primary antibody solution and wash 3 times with PBS containing 0.2% on a shaker, 5 min each time;

[0086] (10) Prepare the secondary antibody solution with PBST solution containing 1% BSA and incubate for 30 min at 4 °C in the dark;

[0087] (11) Discard the secondary antibody solution and continue to wash 3 times with PBS containing 0.2% on a shaker, 5 min each time,

[0088] (12) Add the nuclear dye DAPI dilution and incubate for 10 min in the dark;

[0089] (13) Wash 3 times with PBS containing 0.2% on a shaker, 5 min each time, and the cell immunofluorescence staining is completed. Then immediately use a confocal microscope to photograph the sample, and the results are shown in Figure 4 .

[0090] 7. Determination of ZIKV virus titer (plaque assay)

[0091] Culture Vero cells in a 24-well plate. After culturing to about 90% confluence, dilute the virus solution to be tested (Zika virus strains MR766 and PRVABC.59) with DMEM medium at a 10-fold gradient, and continuously dilute for 7 gradients (10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7),500 μl of each gradient virus solution was added to the cells respectively, and the cells were further cultured at 37 °C for 2 h. The supernatant was discarded, and then 1% FBS and agar-containing fresh MEM medium was added to each well. After the agar solidified, the 12-well plate was inverted and cultured for 3 - 5 days to observe the occurrence of CPE in the cells. When obvious CPE appeared, the supernatant was discarded, and 500 μl of 4% paraformaldehyde solution was added to fix the cells at room temperature for 1 h. The supernatant was discarded, and the gel in the well plate was gently washed away with sterile water. 500 μl of staining solution containing 1.5% crystal violet was added and stained for 30 min. The dye was discarded, and the residual dye was gently washed with water. The formation of cell plaques was observed under white light. The cell wells with appropriate dilution were selected for plaque counting. According to the formula: virus titer = (number of plaques) x (dilution factor x 2) PFU / ml, the final virus titer was calculated. The results are shown in Figure 5 .

[0092] 8. ZIKV Infection Experiment in Newborn Mice

[0093] We used the PRVABC.59 strain of ZIKV to conduct experiments on a ZIKV infection model in newborn mice. Newborn C57 mice were injected with 4 μl of 10 mg / ml murine IFNR-1 antibody into the left and right brain regions of each mouse on the first day after birth. Subsequently, the newborn mice were randomly divided into 3 groups, with 10 mice in each group. Then, vsiRNA-Amimic, vsiRNA-1mimic, or Scramble mimic was injected into the left and right brain regions of the newborn mice in each group, with an injection dose of 2 nmol per mouse. The injection was repeated on the 4th day. 12 h later, 2 μl of ZIKV (1*10 5 PFU) was injected into the left and right brain regions of the newborn mice in each group, with only one injection. The newborn mice were continuously raised, and data such as the body weight, health score, and mortality rate of the newborn mice were detected every day. The death of the newborn mice was used as the experimental endpoint (9 d). The results are shown in Figure 6 .

[0094] At the experimental endpoint, the mice were dissected, weighed, and photographed. 1 / 4 of the brain was taken for RNA extraction to detect the viral load in the brain (see Figure 7 ) and the change of vsiRNA. Another 1 / 4 of the brain was stored in liquid nitrogen for later use. Finally, the remaining 1 / 2 of the brain was fixed and sectioned, and immunohistochemistry and in situ hybridization techniques were used to analyze the development and differentiation of the mouse brain, the viral load, and the expression differences of vsiRNA.

[0095] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A miRNA for inhibiting Zika virus, characterized in that, The sequence of the miRNA is as follows: Sense strand: 5’-UUAGUGUUGUCAGGCCUGCUA-3’; Antisense strand: 5’-UAGCAGGCCUGACAACACUAA-3’.

2. A vector comprising the miRNA according to claim 1.

3. The carrier according to claim 2, characterized in that, The vector is a viral vector or a liposomal vector.

4. The carrier according to claim 3, characterized in that, The viral vector is an adenoviral vector.

5. Use of the miRNA according to claim 1 or the vector according to any one of claims 2-4 in the preparation of a product for inhibiting Zika virus.

6. The application according to claim 5, wherein The product is a reagent or a kit.

7. The application according to claim 5, wherein The product is a drug.

8. A product for inhibiting Zika virus, characterized in that, The product contains the miRNA according to claim 1 or the vector according to any one of claims 2-4.

9. The product according to claim 8, characterized in that, The product is a reagent or a kit.

10. The product according to claim 8, characterized in that, The product is a drug.

Images