Application of BnaC01.CCT8 gene associated with pod length and grain weight in Brassica napus breeding
By screening and regulating the rapeseed BnaC01.CCT8 gene, and utilizing the CRISPR/Cas9 system and Hap1 haplotype, the molecular mechanism of regulating rapeseed pod length and grain weight was solved, thereby increasing rapeseed yield.
Patent Information
- Application Number
- CN202510558160.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2045-04-29
AI Technical Summary
The molecular mechanisms underlying rapeseed pod length and grain weight are not fully understood in current technologies, and there is a lack of effective regulatory means to increase rapeseed yield.
By screening and identifying the BnaC01.CCT8 gene in rapeseed, the CRISPR/Cas9 system was used to regulate the silique length and grain weight of rapeseed. The expression level of the BnaC01.CCT8 gene was regulated by overexpression or knockout methods, and breeding screening was carried out using the Hap1 haplotype.
Significantly increasing or decreasing the length of rapeseed pods and grain weight provides a new way to improve rapeseed yield, and the use of the Hap1 haplotype provides excellent genetic resources for breeding.
Smart Images

Figure HDA0005383904940000011 
Figure HDA0005383904940000012 
Figure HDA0005383904940000021
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of oilseed rape breeding, and particularly relates to application of the gene BnaC01.CCT8 related to silique length and seed weight in oilseed rape breeding. BACKGROUND
[0002] Improving crop yield has always been the core goal of breeding. Seed weight, as one of the three main factors affecting yield, directly affects the yield of oilseed rape. Oilseed rape silique, as a photosynthetic organ, continuously provides nutrients for seed development, and protects seeds from biotic and abiotic stress. There is a significant positive correlation between silique length and seed weight (Cai et al., 2014; Qi et al., 2013). Longer silique can provide more environmental space and more nutrients for developing seeds, which can increase seed weight. In-depth understanding of the molecular mechanisms of oilseed rape silique length and seed weight development is of great significance to improve the yield of oilseed rape.
[0003] Some genes that simultaneously regulate silique length and seed weight have been cloned in oilseed rape, such as auxin response transcription factor BnaA09.ARF18 (AUXIN-RESPONSE FACTOR 18) (Liu et al., 2015), P450 monooxygenase BnaA09.CYP78A9 (CYTOCHROME P450 78A9) (Shen et al., 2019; Shi et al., 2019; Ye et al., 2023), BnaA02.SE (SILIQUE ELONGATION) (Zhang et al., 2024), BnaA05.DAD1 (DEFECTIVE IN ANTHER DEHISCENCE 1) (Liu et al., 2021), and BnaEOD3s (ENHANCER 3 OF DA1 / CYP78A6) (Khan et al., 2020). However, there is no report on the molecular chaperone BnaC01.CCT8 protein regulating the development of silique length and seed weight.
[0004] The present application found that mutation of AtCCT8 gene in Arabidopsis thaliana and BnaC01.CCT8 gene in oilseed rape led to a significant decrease in silique length and thousand seed weight. Overexpression of BnaC01.CCT8 gene in Arabidopsis thaliana and oilseed rape increased silique length and thousand seed weight. Haplotype analysis showed that Hap1 was an excellent haplotype of BnaC01.CCT8 gene, providing a new gene resource for oilseed rape yield breeding. SUMMARY
[0005] The application aims to provide application of a gene BnaC01.CCT8 related to silique length and seed weight in Brassica napus breeding. The gene encodes a protein as shown in SEQ ID NO. 2, and the breeding traits include plant silique length or / and seed weight. In order to achieve the above-mentioned purpose, the application adopts the following technical solutions.
[0006] Screening and identification of BnaC01.CCT8 gene for regulating silique length and seed weight of Brassica napus:
[0007] Through screening of EMS (ethyl methane sulfonate) mutants of D11, a mutant Shorter silique length (ssl) with reduced silique length and seed weight is identified. 9D290 is crossed with ssl and a recombinant inbred line (RIL) population is constructed 2:5 Phenotypic segregation of silique length is observed in Line 120. Through Bulked Segregant Analysis (BSA) and fine mapping, BnaC01.CCT8 is finally determined as a target gene for regulating silique length and seed weight. Overexpression of BnaC01.CCT8 gene (the gene encodes a protein as shown in SEQ ID NO. 2) in Arabidopsis and Brassica napus can increase silique length and thousand seed weight, while frameshift mutation of BnaC01.CCT8 in Brassica napus leads to significant reduction of silique length and thousand seed weight. According to haplotype analysis of BnaC01.CCT8 in Brassica napus BnIR database, Hap1 is an excellent haplotype of BnaC01.CCT8 gene (i.e. the genotype shown in SEQ ID NO. 1), and Hap2 is an unfavorable haplotype thereof.
[0008] The protection scope of the application includes:
[0009] Application of a gene BnaC01.CCT8 isolated from Brassica napus in controlling plant silique length or / and seed weight, the gene encodes a protein as shown in SEQ ID NO. 2, and the plant is Brassica napus or Arabidopsis.
[0010] The application described above specifically includes:
[0011] Increasing expression amount of BnaC01.CCT8 gene in plants to increase plant silique length or / and seed weight;
[0012] Reducing expression amount of BnaC01.CCT8 gene or its homologous gene in plants to reduce plant silique length or / and seed weight;
[0013] Knocking out, inhibiting or silencing BnaC01.CCT8 gene in plants to reduce plant silique length or / and seed weight;
[0014] In the above-mentioned application, preferably, the knockout is performed by using a CRISPR / Cas9 system, and the target site of gRNA in the system is TGGTAACTCAATCTCTACAG.
[0015] In the above-mentioned application, the Brassica napus with reduced pod length and / or seed weight edited by the CRISPR / Cas9 system has the polynucleotide shown in SEQ ID NO. 3 or SEQ ID NO. 4.
[0016] The application of BnaC01.CCT8 gene in creating plants with increased pod length and / or seed weight, specifically, introducing a substance capable of increasing the expression of BnaC01.CCT8 gene in plants into the plants, and the plants are Brassica napus or Arabidopsis thaliana.
[0017] Preferably, in the above-mentioned application, the substance is a nucleic acid molecule containing BnaC01.CCT8 gene, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.
[0018] The BnaC01.CCT8 gene is shown in SEQ ID NO. 1.
[0019] The application of Hap1 haplotype of BnaC01.CCT8 gene in Brassica napus in the screening of superior breeding of pod length and / or seed weight of Brassica napus, and the Hap1 haplotype includes the gene shown in SEQ ID NO. 1.
[0020] Compared with the prior art, the application has the following advantages:
[0021] The application identifies the BnaC01.CCT8 gene capable of regulating the pod length and seed weight of Brassica napus by screening EMS mutants of D11 and using the map-based cloning technology. This finding has an important driving effect on the molecular mechanism research of plant yield regulation. Although the sequence of BnaC01.CCT8 gene in Brassica napus has been disclosed, the specific biological function is still unclear. The Brassica napus BnaC01.CCT8 gene cloned in the application has a positive regulation on the pod length and seed weight, and the haplotype Hap1 is an excellent haplotype thereof. This finding provides an important basis for improving the pod length and seed weight to increase the yield of Brassica napus. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 A schematic diagram of the map-based cloning process of the gene BnaC01.CCT8;
[0023] Wherein, (a) and (b) are the phenotypes of pod length (a) and thousand seed weight (b) of D11, F1 (D11xssl), ssl and 9D290, and the scale is 1cm in (a) and 2mm in (b).
[0024] (c) and (d) are the statistical data of silique length (c) and thousand seed weight (d) in Figure (a) and Figure (b), respectively;
[0025] (e) shows the preliminary mapping of ssl gene on chromosome C01 by BSA;
[0026] (f) shows the fine mapping of ssl gene, the numbers in the brackets represent the number of recombinant single plants detected by the corresponding markers;
[0027] (g) is the genotype of important recombinant single plants, black, white and gray bars represent homozygous target fragments from 9D290, ssl and heterozygous fragments, respectively;
[0028] (h) is the statistical data of silique length of the offspring of important recombinant single plants in Figure (g);
[0029] (i) is the candidate gene annotated by reference ZS11 v0 genome (Song et al., 2020), the annotated gene is indicated by an arrow, the direction of the arrow indicates the direction of transcription, and the red arrow indicates the candidate gene BnaC01G0509300ZS;
[0030] In the figure, ns, p>0.05; *, p<0.05; **, p<0.01; ***, p<0.001.
[0031] Figure 2 Silique length and thousand seed weight phenotypes of overexpression of BnaC01.CCT8 in Arabidopsis thaliana;
[0032] Wherein: (a) and (b) are the silique length and thousand seed weight of the strains overexpressing BnaC01.CCT8 gene in Brassica napus (OE-BnaC01.CCT8 #1, #2) in Arabidopsis thaliana, the scale is 0.5 cm in (a) and 2 mm in (b);
[0033] (c) and (d) are the statistical data of silique length (c) and thousand seed weight (d) in Figure (a) and Figure (b), respectively;
[0034] In the figure, **, p<0.01.
[0035] Figure 3 Silique length and thousand seed weight phenotypes of bnac01.cct8 mutant and overexpression of BnaC01.CCT8 in Brassica napus.
[0036] (a) and (b) are the silique length and 1000-grain weight of bnac01.cct8 mutant (CR-bnac01.cct8#1, #2) and overexpression BnaC01.CCT8 gene strain (OE-BnaC01.CCT8#1, #2) in Brassica napus, the scale is 1cm in (a) and 2mm in (b);
[0037] (c) and (d) are the statistical data of silique length (c) and 1000-grain weight (d) in (a) and (b), respectively; **, p<0.01 in the figure.
[0038] Figure 4 Schematic diagram for haplotype analysis of BnaC01.CCT8 in Brassica napus;
[0039] Wherein: (a) is the SNP position and variation information of haplotype Hap1 and Hap2 in Brassica napus;
[0040] (b) is the statistical data of silique length between haplotype Hap1 and Hap2, and the number in the bracket represents the number of materials corresponding to the haplotype. DETAILED DESCRIPTION
[0041] The technical solutions described in the present application are all conventional technologies in the art if not specifically stated; the reagents or materials are all from commercial channels if not specifically stated. The present application refers to Brassica napus genome ZS11v0 annotation sequence (http: / / cbi.hzau.edu.cn / bnapus / index.php).
[0042] Example 1:
[0043] Screening and obtaining of Brassica napus silique length and grain weight related gene BnaC01.CCT8:
[0044] Through screening of EMS mutants of Brassica napus D11, a mutant Shorter silique length (ssl) with reduced silique length and grain weight was identified. 9D290 was crossed with ssl and a recombinant inbred line (RIL) population was constructed 2:5 Phenotypic segregation of silique length was observed in Line120. Through Bulked Segregant Analysis (BSA) and fine mapping, the candidate interval was narrowed down to 170kb. Based on the parent resequencing difference analysis in the candidate interval and Arabidopsis homologous gene annotation, BnaC01.CCT8 was preliminarily determined as the target gene for regulating silique length and grain weight. Figure 1
[0045] Example 2:
[0046] Application of BnaC01.CCT8 gene in increasing silique length and thousand seed weight of Arabidopsis thaliana and Brassica napus:
[0047] The steps of constructing overexpression vector of Brassica napus and Arabidopsis thaliana are as follows:
[0048] (1) Design primers that can amplify the coding region sequence of BnaC01.CCT8 (shown in SEQ ID NO. 1), left primer sequence (5'-3'): CTGACAAGCTGACTCTAGCAGATCTATGCAGCCGTACGGAATC, right primer sequence (5'-3'): TCTCCTTTGCCCATGGCTCTAGAGTCTTCCTCTGCGCCAG, wherein the 5' end of the left and right primer sequences are respectively provided with BglII and XbaI enzyme cutting sites. The PCR reaction program is as follows: 95℃, 3min; 95℃, 15sec; 55℃, 20sec; 72℃: 2min; a total of 35 cycles; 72℃: 5min. The CDS sequence of BnaC01.CCT8 is connected with PCAMBIA1300 vector carrying 35S promoter, and transformed into Escherichia coli DH5α. Primers (5'-ACTATCCTTCGCAAGACCCTTCCTC-3' and 5'-TTGTGCCCATTAACATCACCATCTA-3') are used for PCR positive clone identification.
[0049] (2) The successfully sequenced recombinant plasmid vector is transformed into Agrobacterium tumefaciens GV3101, and the coding region sequence of BnaC01.CCT8 is introduced into Arabidopsis thaliana Col and Brassica napus Westar varieties by Agrobacterium-mediated method. Primers (5'-ACTATCCTTCGCAAGACCCTTCCTC-3' and 5'-TTGTGCCCATTAACATCACCATCTA-3') are used for identification of positive transformation lines.
[0050] (3) Phenotypic identification is performed on homozygous lines (OE-BnaC01.CCT8) of transgenic materials in Arabidopsis thaliana Col. The results show that the silique length of transgenic lines overexpressing BnaC01.CCT8 in Arabidopsis thaliana (OE-BnaC01.CCT8#1: 1.56±0.1cm and OE-BnaC01.CCT8#2: 1.53±0.05cm) is significantly greater than that of wild type Col (1.45±0.04cm) Figure 2) and the 1000-grain weight of the transgenic lines overexpressing BnaC01.CCT8 in Arabidopsis (OE-BnaC01.CCT8#1: 0.0311 ± 0.0043 g and OE-BnaC01.CCT8#2: 0.0308 ± 0.0022 g) were significantly higher than that of wild type Col (0.0200 ± 0.0023 g) Figure 2 ).
[0051] (4) Phenotypic identification was performed on homozygous lines of transgenic materials (OE-BnaC01.CCT8) in Brassica napus Westar. The results showed that the silique length of the transgenic lines overexpressing BnaC01.CCT8 in Brassica napus Westar (OE-BnaC01.CCT8#1: 6.75 ± 0.55 cm and OE-BnaC01.CCT8#2: 6.42 ± 0.38 cm) was significantly longer than that of the control Westar (5.90 ± 0.5 cm); the 1000-grain weight of the transgenic lines overexpressing BnaC01.CCT8 (OE-BnaC01.CCT8#1: 4.30 ± 0.29 g and OE-BnaC01.CCT8#2: 3.74 ± 0.54 g) was significantly higher than that of the control Westar (3.23 ± 0.17 g) Figure 3 ).
[0052] Example 3:
[0053] Application of BnaC01.CCT8 gene in reducing the silique length and 1000-grain weight of Brassica napus:
[0054] The steps for constructing the Brassica napus gene editing vector are as follows:
[0055] (1) Design sgRNA in CRISPR-P database (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the sequence is (5'-3'): TGGTAACTCAATCTCTACAG. Generate Oligo sequence online on the One-lab website www.biogle.cn ) : UP: 5'-TGATTGTGGTAACTCAATCTCTACAG-3'; LOW: 5'-AAACCTGTAGAGATT GAGTTACCACA-3'; heat at 95°C for 3 min to prepare Oligo dimer. Construct Oligo dimer to CRISPR / Cas vector (BGK01).
[0056] (2) The successfully constructed plasmid was transformed into E. coli DH5a, and PCR positive clone identification was performed using a sequencing primer (5'-CCCAGTCACGACGTTGTAAA-3'). The successfully sequenced recombinant plasmid vector was transformed into Agrobacterium GV3101, and the coding region sequence of BnaC01.CCT8 was introduced into the Westar variety of Brassica napus by Agrobacterium-mediated method. The primer (5'-CCCAGTCACGACGTTGTAAA-3' and 5'-AAACCTGTAGAGATTGAGTT ACCACA-3') was used to identify the positive transformation lines. The target region was amplified using primers (5'-GGGTATTTTGAAGTATGGTTGT GG-3' and 5'-ACCCAGCAAAGATTACCTTGT-3') and sequenced to determine the editing type.
[0057] (3) The strain with frameshift mutation (CR-bnac01.cct8#1: -2bp, CR-bnac01.cct8#2: +1bp) was screened out, and the mutant sequence contained in CR-bnac01.cct8#1 is shown in SEQ ID NO. 3, and the mutant sequence contained in CR-bnac01.cct8#2 is shown in SEQ ID NO. 4. Phenotypic identification was performed on the homozygous strain (CR-bnac01.cct8) of the gene edited material in Brassica napus Westar. The results showed that the silique length of the gene edited CR-BnaC01.CCT8 strain in Brassica napus Westar (CR-bnac01.cct8#1: 4.99±0.59 cm and CR-bnac01.cct8#2: 5.34±0.74 cm) was significantly smaller than that of the control Westar (5.90±0.5 cm); the thousand seed weight of the gene edited CR-BnaC01.CCT8 strain (CR-bnac01.cct8#1: 1.82±0.16 g and CR-bnac01.cct8#2: 2.56±0.11 g) was significantly smaller than that of the control Westar (3.23±0.17 g) Figure 3 )。
[0058] Example 4:
[0059] Application of Brassica napus silique length and seed weight related gene BnaC01.CCT8 in Brassica napus breeding:
[0060] The haplotype Hap1 and Hap2 of BnaC01.CCT8 were analyzed in Brassica napus BnIR database (https: / / yanglab.hzau.edu.cn / BnIR / single_locus) Figure 4). Based on the phenotypic data of silique length in the database, Hapl was identified as the superior haplotype of BnaC01.CCT8 gene (i.e. the genotype shown in SEQ ID NO. 1), and Hap2 was identified as the inferior haplotype of BnaC01.CCT8 gene Figure 4 ).
Claims
1. A gene isolated from Brassica napus BnaC01.CCT8 In use for positively regulating pod length or / and seed weight in plants, said gene encodes a protein with an amino acid sequence as shown in SEQ ID NO. 2, said plants are Brassica napus or Arabidopsis thaliana.
2. Use according to claim 1, characterized in that, The application process is to increase the length of the pod or / and the grain weight of the plant by increasing the expression level of the gene in the plant BnaC01.CCT8 in the plant.
3. Use according to claim 1, characterized in that, The application process is to reduce the length of the silique or / and grain weight of the plant by reducing the expression of the gene in the plant BnaC01.CCT8 in the plant.
4. Use according to claim 3, characterized in that, The reduction is specifically by knocking out, suppressing or silencing a gene in the plant that reduces the pod length or / and seed weight of the plant. BnaC01.CCT8 The reduction is specifically by knocking out, suppressing or silencing a gene in the plant that reduces the pod length or / and seed weight of the plant.
5. Use according to claim 4, characterized in that, The knockout uses a CRISPR / Cas9 system, and the target site of gRNA in the system is TGGTAACTCAATCTCTACAG.
6. Use according to claim 5, characterized in that, The reduced pod length or / and seed weight of Brassica napus edited by the CRISPR / Cas9 system has a polynucleotide shown in SEQ ID NO. 3 or SEQ ID NO.
4.
7. BnaC01.CCT8 The use of a gene in creating a plant with increased pod length and / or seed weight, specifically, introducing into a plant, which is Brassica napus or Arabidopsis thaliana, a substance that increases the expression of a gene encoding a protein with an amino acid sequence as set forth in SEQ ID NO.
2. BnaC01.CCT8 The use of a gene in creating a plant with increased pod length and / or seed weight, specifically, introducing into a plant, which is Brassica napus or Arabidopsis thaliana, a substance that increases the expression of a gene encoding a protein with an amino acid sequence as set forth in SEQ ID NO.
2. BnaC01.CCT8 The use of a gene in creating a plant with increased pod length and / or seed weight, specifically, introducing into a plant, which is Brassica napus or Arabidopsis thaliana, a substance that increases the expression of a gene encoding a protein with an amino acid sequence as set forth in SEQ ID NO.
2.
8. The haplotype of SEQ ID NO. 1 in Brassica napus. BnaC01.CCT8 Application of Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype Haplotype H