HLA high-resolution typing method

Abstract

The invention provides an HLA (human leukocyte antigen) high-resolution typing method, and particularly provides a method for determining an HLA genotype, and the method comprises the following steps: constructing a sequencing library containing an HLA gene nucleic acid sequence by using a single-tube long fragment sequence method; carrying out sequencing treatment on the sequencing library; and carrying out comparison processing on the sequencing processing result and a preset reference sequence so as to determine the genotype of the HLA. By adopting the method disclosed by the invention, the sequencing flux can be improved, the accuracy and precision of HLA typing are remarkably improved, and the sequencing cost is reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a method for high-resolution HLA typing. Background Art

[0002] Human leukocyte antigen (HLA), also known as major histocompatibility complex (MHC), is related to allogeneic tissue and organ transplantation and the rejection reaction of grafts. HLA molecules present on the cell membrane can bind peptides from inside or outside the cell to form HLA-peptide complexes, and antigen-presenting cells present the complexes to T cells to cause a series of immune reactions. With the in-depth study of HLA, organ transplantation and hematopoietic stem cell transplantation technologies born in the mid-20th century have become important means for clinical treatment and saving patients' lives, and millions of patients have obtained new lives through organ transplantation and hematopoietic stem cell transplantation. In the past two decades, with the understanding of survival rate influencing factors such as immunosuppressants, HLA typing, HLA antibody detection and monitoring, the survival rates of organ transplantation and hematopoietic stem cell transplantation have been significantly improved. HLA tissue typing is one of the important factors affecting the survival rate of organ transplantation and hematopoietic stem cell transplantation and the quality of life of recipients.

[0003] For HLA region typing, traditional Sanger sequencing can meet the requirements of high-precision HLA typing. However, due to the low sequencing throughput, it is mainly used for final typing in clinical practice and has not been widely promoted in the population.

[0004] For the HLA typing needs of the population, HLA typing schemes based on SNP typing chips or synthetic high-throughput sequencing can be used. In this scheme, the HLA region is captured on the typing chip by probes, and SNP types are determined using fluorescence. Then, the types are aligned to the HLA type database IMGT, and type speculation is performed through a high alignment rate of a certain type. The typing accuracy can reach 4 digits, but the resolution for rare types and types carrying mutations is relatively low.

[0005] In recent years, some new technologies have emerged that can be used for HLA typing. 1) The circular consensus sequencing (CCS, trade name HiFi Reads) scheme of PacBio converts the molecule to be tested into a dumbbell-shaped closed circular molecule, and obtains multiple copies of continuous sequences through single-molecule sequencing of this molecule, so as to obtain a high-precision consensus sequence of the original molecule, and its HLA typing can reach 8-bit precision. However, due to its insufficient original accuracy, a large amount of consensus data is required to improve the accuracy, so the sequencing cost is relatively high. 2) The Linked Reads technology of 10×Genomics uses long molecule co-tag sequencing and a CRISPR-based reverse enrichment strategy (using the CRISPR editing tool to remove all sequences outside the HLA region, thereby enriching the HLA region sequences), and realizes diploid phased typing (8-bit precision) of the 6M full-length HLA region. However, the pre-library reaction is relatively complex, and the Linked Reads reagent of 10×Genomics has been discontinued and is difficult to obtain.

[0006] Therefore, there is a great need to develop new HLA typing strategies that are simpler, faster, and more cost-effective and can be routinely used in clinical laboratories. Summary of the Invention

[0007] The object of the present invention is to provide an improved high-resolution HLA typing method, which can unambiguously distinguish HLA class I (HLA-A, -B, -C) and class II (HLA-DRB1, -DQA1, -DQB1, DPA1, and -DPB1) alleles at a resolution level of up to 6 bits and is simple and cost-effective enough for routine use in clinical laboratories. The method described in the present invention combines the long-fragment co-labeling library construction method and the high-throughput parallel sequencing method for HLA gene typing. Compared with the traditional Sanger sequencing scheme, the throughput is higher, and it can specifically perform diploid typing on the main HLA genes. At the same time, the present invention uses the assembled sequence for database comparison, and the typing accuracy and precision are significantly improved. Compared with the PacBio circular consensus sequencing scheme, the method described in the present invention has a lower cost.

[0008] Therefore, the present invention proposes a method for determining HLA genotypes. According to an embodiment of the present invention, the method includes: constructing a sequencing library containing HLA gene nucleic acid sequences using a single-tube long-fragment reading library construction method; performing sequencing processing on the sequencing library; and performing comparison processing on the sequencing processing results with a predetermined reference sequence to determine the genotype of the HLA. The method provided by the present invention can significantly improve the accuracy and precision of HLA typing while increasing the sequencing throughput, and at the same time reduces the sequencing cost.

[0009] According to an embodiment of the present invention, the method for determining the HLA genotype may further include at least one of the following additional technical features:

[0010] According to an embodiment of the present invention, before comparing the sequencing result with a predetermined reference sequence, it further includes independently assembling the sequencing sequences with the same molecular tag in the sequencing result to obtain a contig sequence.

[0011] According to an embodiment of the present invention, the comparison process includes performing a first comparison of the contig sequence with the human reference genome to obtain a contig sequence that coincides with the human leukocyte antigen region; and performing a second comparison of the contig sequence with the IPD-IMGT database to determine the genotype of the HLA.

[0012] According to an embodiment of the present invention, the starting DNA for constructing the sequencing library is obtained in the following manner: using the genome as a template, performing an amplification process in the presence of HLA gene primers to obtain an amplification product; adding a polyA tail to the 3' end of the amplification product to obtain an amplification product with a polyA tail; ligating the amplification product with a polyA tail to a circular adapter to obtain a ligation product; circularizing the ligation product to obtain a circular product; using the circular product as a template, performing a rolling circle amplification process in the presence of dNTPs to obtain a rolling circle amplification product; performing a double-strand generation process on the rolling circle amplification product to obtain a double-strand generation product; and using the double-strand generation product as the starting DNA. By using this method to construct the starting DNA of the sequencing library, that is, using the circularized molecule for rolling circle amplification, multiple tandem copies can be formed, thereby improving the physical coverage of a single original molecule. In addition, there may be a certain sequence overlap between the sequencing sequences from different copies; this lays the foundation for subsequent realization of the effect of assembling and restoring the sequencing sequences from the same molecular tag into the original single molecule, that is, obtaining the full-length sequence of the HLA gene. In contrast, although the single-tube long fragment read technology (stLFR) can be used to obtain long fragment information of the genome, due to the limitation of the capture efficiency, the original sequencing coverage depth of each long fragment cannot reach 100%, and from the published data, it is about 10%-20%. If the stLFR technology is directly used to type the HLA region, whether it is based on direct sequence comparison typing (as shown in Table 17), or based on co-labeled assembly and then typing with the assembled contigs (as shown in Table 18), the typing accuracy is difficult to reach 100%.

[0013] According to an embodiment of the present invention, the HLA genotype is selected from at least one of HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1.

[0014] According to an embodiment of the present invention, the primers are selected from at least one group of nucleotide sequences shown in SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16.

[0015] Among them, the primers corresponding to HLA-A have a forward primer with the nucleotide sequence shown in SEQ ID NO: 1 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 2; the primers corresponding to HLA-B have a forward primer with the nucleotide sequence shown in SEQ ID NO: 3 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 4; the primers corresponding to HLA-C have a forward primer with the nucleotide sequence shown in SEQ ID NO: 5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 6; the primers corresponding to HLA-DPA1 have a forward primer with the nucleotide sequence shown in SEQ ID NO: 7 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 8; the primers corresponding to HLA-DPB1 have a forward primer with the nucleotide sequence shown in SEQ ID NO: 9 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 10; the primers corresponding to HLA-DQA1 have a forward primer with the nucleotide sequence shown in SEQ ID NO: 11 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 12; the primers corresponding to HLA-DQB1 have a forward primer with the nucleotide sequence shown in SEQ ID NO: 13 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 14; the primers corresponding to HLA-DRB1 have a forward primer with the nucleotide sequence shown in SEQ ID NO: 15 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 16.

[0016] It should be noted that the "HLA gene primers" described in the present invention include, but are not limited to, the above primers, and other primers can also be used for amplification as long as they can cover all gene loci in the entire HLA region.

[0017] According to an embodiment of the present invention, the amplification treatment is carried out in a PCR system.

[0018] According to an embodiment of the present invention, the PCR system includes a DNA sample carrying the genome, PrimeStar GXL polymerase, PrimeStar buffer, dNTPs, dH2O, and the primers.

[0019] According to an embodiment of the present invention, the final concentration of the DNA sample carrying the genome in the PCR system is 0.5 ng / μL to 20 ng / μL, such as 0.5 ng / μL, 1 ng / μL, 2 ng / μL, 3 ng / μL, 4 ng / μL, 5 ng / μL, 6 ng / μL, 7 ng / μL, 8 ng / μL, 9 ng / μL, 10 ng / μL, 11 ng / μL, 12 ng / μL, 13 ng / μL, 14 ng / μL, 15 ng / μL, 16 ng / μL, 17 ng / μL, 18 ng / μL, 19 ng / μL, 20 ng / μL.

[0020] The DNA sample used in the method of the present invention comprises or consists of human genomic DNA that can be obtained from any suitable source. Generally, genomic DNA is obtained from a blood sample or a buccal swab sample. Preferably, the genomic DNA sample is extracted from peripheral blood mononuclear cells. Numerous methods are available and known to those skilled in the art for isolating and purifying genomic DNA samples. Any method suitable for providing a DNA sample that can be used in an amplification reaction such as PCR or a sequencing reaction can be used in the present invention. Preferably, the DNA sample should be free of any proteins or other contaminants that may inhibit the amplification or sequencing reaction.

[0021] According to an embodiment of the present invention, the final concentration of the PrimeStar GXL polymerase in the PCR system is 0.02 - 0.03 U / μL, such as 0.02 U / μL, 0.021 U / μL, 0.022 U / μL, 0.023 U / μL, 0.024 U / μL, 0.025 U / μL, 0.026 U / μL, 0.027 U / μL, 0.028 U / μL, 0.029 U / μL, 0.030 U / μL, preferably 0.025 U / μL.

[0022] According to an embodiment of the present invention, the final concentration of the PrimeStar buffer in the PCR system is 1×.

[0023] According to an embodiment of the present invention, the final concentration of the dNTPs in the PCR system is 180 - 220 μM, such as 180 μM, 183 μM, 185 μM, 187 μM, 190 μM, 193 μM, 195 μM, 197 μM, 200 μM, 203 μM, 205 μM, 207 μM, 210 μM, 213 μM, 215 μM, 217 μM, 220 μM, preferably 200 μM.

[0024] According to an embodiment of the present invention, the final concentration of the primers in the PCR system is 0.1 - 0.3 μM, such as 0.1 μM, 0.2 μM, 0.3 μM, preferably 0.2 μM.

[0025] According to an embodiment of the present invention, the addition of a poly A tail to the 3' end of the amplified product is performed in an A addition reaction system.

[0026] According to an embodiment of the present invention, the A-addition reaction system includes dH2O, PNK buffer, dATP and klenowexo-fragment.

[0027] According to an embodiment of the present invention, the final concentration of the PNK buffer in the A-addition reaction system is 1×.

[0028] According to an embodiment of the present invention, the final concentration of the dATP in the A-addition reaction system is 0.6-0.7 mM, for example, 0.61 mM, 0.615 mM, 0.62 mM, 0.625 mM, 0.63 mM, 0.635 mM, 0.64 mM, 0.645 mM, 0.65 mM, 0.66 mM, 0.67 mM, 0.68 mM, 0.69 mM, 0.7 mM, and preferably 0.625 mM.

[0029] According to an embodiment of the present invention, the final concentration of the klenow exo-fragment in the A-addition reaction system is 5 to 15 U / μL, for example, 5 U / μL, 6 U / μL, 7 U / μL, 8 U / μL, 9 U / μL, 10 U / μL, 11 U / μL, 12 U / μL, 13 U / μL, 14 U / μL, 15 U / μL, preferably 10 U / μL.

[0030] According to an embodiment of the present invention, the poly A tail is added to the 3' end of the amplified product by reacting at 35-40° C. for 20-40 minutes.

[0031] According to an embodiment of the present invention, the connection process is performed in a connection system.

[0032] According to an embodiment of the present invention, the ligation system includes dH2O, HB buffer, a circularized linker primer and T4 DNA ligase.

[0033] According to an embodiment of the present invention, the HB buffer comprises dH2O, PEG-8000, Tris-HCl, MgCl2, ATP, DTT and BSA.

[0034] According to an embodiment of the present invention, the volume fraction of the PEG-8000 in the HB buffer is 55-65%, for example, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, preferably 60%.

[0035] According to an embodiment of the present invention, the final concentration of Tris-HCl in the HB buffer is 140-160 mM, such as 140 mM, 142 mM, 144 mM, 146 mM, 148 mM, 150 mM, 152 mM, 154 mM, 156 mM, 158 mM, 160 mM, and preferably 150 mM.

[0036] According to an embodiment of the present invention, the final concentration of MgCl2 in the HB buffer is 25-35 mM, such as 25 mM, 26 mM, 27 mM, 28 mM, 29 mM, 30 mM, 31 mM, 32 mM, 33 mM, 34 mM, 35 mM, and preferably 30 mM.

[0037] According to an embodiment of the present invention, the final concentration of ATP in the HB buffer is 1-5 mM, such as 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, and preferably 3 mM.

[0038] According to an embodiment of the present invention, the final concentration of DTT in the HB buffer is 1-2 μM, such as 1 μM, 1.1 μM, 1.2 μM, 1.3 μM, 1.4 μM, 1.5 μM, 1.6 μM, 1.7 μM, 1.8 μM, 1.9 μM, 2 μM, and preferably 1.5 μM.

[0039] According to an embodiment of the present invention, the final concentration of BSA in the HB buffer is 140-160 μg / mL, such as 140 μg / mL, 142 μg / mL, 144 μg / mL, 146 μg / mL, 148 μg / mL, 150 μg / mL, 152 μg / mL, 154 μg / mL, 156 μg / mL, 158 μg / mL, 160 μg / mL, and preferably 150 μg / mL.

[0040] According to an embodiment of the present invention, the circular adapter primer includes a first primer and a second primer. The first primer has the nucleotide sequence shown in SEQ ID NO:17, and the second primer has the nucleotide sequence shown in SEQ ID NO:18.

[0041] According to an embodiment of the present invention, the final concentration of the first primer in the circular adapter primer is 20-30 μM, such as 20 μM, 21 μM, 22 μM, 23 μM, 24 μM, 25 μM, 26 μM, 27 μM, 28 μM, 29 μM, 30 μM, and preferably 25 μM.

[0042] According to an embodiment of the present invention, the final concentration of the second primer in the circularized linker primer is 20-30 μM, such as 20 μM, 21 μM, 22 μM, 23 μM, 24 μM, 25 μM, 26 μM, 27 μM, 28 μM, 29 μM, 30 μM, and preferably 25 μM.

[0043] According to an embodiment of the present invention, the volume fraction of the HB buffer in the ligation system is 60-70%, such as 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, and preferably 66%.

[0044] According to an embodiment of the present invention, the final concentration of the circularized linker primer in the ligation system is 1-2 μM, such as 1 μM, 1.1 μM, 1.2 μM, 1.3 μM, 1.4 μM, 1.5 μM, 1.6 μM, 1.7 μM, 1.8 μM, 1.9 μM, 2 μM, and preferably 1.43 μM.

[0045] According to an embodiment of the present invention, the final concentration of the T4 DNA ligase in the ligation system is 65-75 U / μL, such as 65 U / μL, 66 U / μL, 67 U / μL, 68 U / μL, 69 U / μL, 70 U / μL, 71 U / μL, 72 U / μL, 73 U / μL, 74 U / μL, 75 U / μL, and preferably 68.6 U / μL.

[0046] According to an embodiment of the present invention, the ligation treatment is carried out at 17-23 °C for 20-40 min.

[0047] According to an embodiment of the present invention, before subjecting the ligation product to circularization treatment, it further includes subjecting the ligation product to extension treatment and enzyme excision treatment.

[0048] According to an embodiment of the present invention, the extension treatment is carried out in an extension reaction solution.

[0049] According to an embodiment of the present invention, the extension reaction solution includes H2O, PfuCx reaction mixture, ds PCR primer-2, and PfuTurbo polymerase.

[0050] According to an embodiment of the present invention, the ds PCR primer-2 has the nucleotide sequence shown in SEQ ID NO: 19.

[0051] According to an embodiment of the present invention, the PfuCx reaction mixture includes PfuTurbo buffer, DMSO, betaine, MgSO4, dNTPs, and NF H2O.

[0052] According to an embodiment of the present invention, the final concentration of the PfuTurbo buffer in the PfuCx reaction mixture is 2×.

[0053] According to an embodiment of the present invention, the volume fraction of DMSO in the PfuCx reaction mixture is 2-7%, such as 2%, 3%, 4%, 5%, 6%, 7%, preferably 5%.

[0054] According to an embodiment of the present invention, the final concentration of betaine in the PfuCx reaction mixture is 0.5-1.5 M, such as 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, preferably 1 M.

[0055] According to an embodiment of the present invention, the final concentration of MgSO4 in the PfuCx reaction mixture is 4-8 mM, such as 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, preferably 6 mM.

[0056] According to an embodiment of the present invention, the final concentration of dNTPs in the PfuCx reaction mixture is 0.1-1 mM, such as 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM, preferably 0.6 mM.

[0057] According to an embodiment of the present invention, the volume fraction of NF H2O in the PfuCx reaction mixture is 50-55%, such as 50%, 51%, 52%, 53%, 54%, 55%, preferably 52%.

[0058] According to an embodiment of the present invention, the volume fraction of the PfuCx reaction mixture in the extension reaction solution is 70-80%, such as 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, preferably 76.9%.

[0059] According to an embodiment of the present invention, the final concentration of the ds PCR primer-2 in the extension reaction solution is 0.05-0.1 μM, such as 0.05 μM, 0.06 μM, 0.07 μM, 0.08 μM, 0.09 μM, 0.1 μM, preferably 0.0769 μM.

[0060] According to an embodiment of the present invention, the final concentration of the PfuTurbo polymerase in the extension reaction solution is 0.15 - 0.25 U / μL, such as 0.15 U / μL, 0.16 U / μL, 0.17 U / μL, 0.18 U / μL, 0.19 U / μL, 0.20 U / μL, 0.21 U / μL, 0.22 U / μL, 0.23 U / μL, 0.24 U / μL, 0.25 U / μL, and preferably 0.192 U / μL.

[0061] According to an embodiment of the present invention, the reaction conditions for the extension treatment are successively 95°C for 3 minutes, 55°C for 1 minute, and 72°C for 20 minutes.

[0062] According to an embodiment of the present invention, the enzyme excision treatment is carried out in an enzyme reaction solution.

[0063] According to an embodiment of the present invention, the enzyme reaction solution includes TA buffer, H2O, and USER.

[0064] According to an embodiment of the present invention, the final concentration of the TA buffer in the enzyme reaction solution is 2 - 2.5×, such as 2×, 2.1×, 2.2×, 2.3×, 2.4×, 2.5×, and preferably 2.38×.

[0065] According to an embodiment of the present invention, the final concentration of the USER in the enzyme reaction solution is 0.05 - 0.15 U / μL, such as 0.05 U / μL, 0.06 U / μL, 0.07 U / μL, 0.08 U / μL, 0.09 U / μL, 0.1 U / μL, 0.11 U / μL, 0.12 U / μL, 0.13 U / μL, 0.14 U / μL, 0.15 U / μL, and preferably 0.1 U / μL.

[0066] According to an embodiment of the present invention, the enzyme excision treatment is carried out at 35 - 40°C for 0.5 h - 1.5 h.

[0067] According to an embodiment of the present invention, the cyclization treatment includes performing a first incubation treatment on the ligation product with a cyclization reaction solution, and performing a second incubation treatment on the product of the first incubation treatment with T4 DNA ligase to obtain the cyclization product.

[0068] According to an embodiment of the present invention, the cyclization reaction solution includes H2O, TA buffer, and ATP.

[0069] According to an embodiment of the present invention, the final concentration of the TA buffer in the cyclization reaction solution is 1×.

[0070] According to an embodiment of the present invention, the final concentration of ATP in the cyclization reaction solution is 1-2 mM, such as 1 mM, 1.1 mM, 1.2 mM, 1.3 mM, 1.4 mM, 1.5 mM, 1.6 mM, 1.7 mM, 1.8 mM, 1.9 mM, 2 mM, and preferably 1.55 mM.

[0071] According to an embodiment of the present invention, the final concentration of the T4 DNA ligase in the first incubation treatment product is 580-620 U / μL, such as 580 U / μL, 583 U / μL, 585 U / μL, 587 U / μL, 590 U / μL, 593 U / μL, 595 U / μL, 597 U / μL, 600 U / μL, 603 U / μL, 605 U / μL, 607 U / μL, 610 U / μL, 613 U / μL, 615 U / μL, 617 U / μL, 620 U / μL, and preferably 600 U / μL.

[0072] According to an embodiment of the present invention, the first incubation treatment is to react at 70 °C for 10-20 min first, and then react at 25 °C for 3-7 min.

[0073] According to an embodiment of the present invention, the second incubation treatment is to react at 25 °C for 50-70 min.

[0074] According to an embodiment of the present invention, the rolling circle amplification treatment is carried out in a mixed solution of a first rolling circle amplification reaction solution, a second rolling circle amplification reaction solution, a phi29 buffer solution, and nuclease-free water.

[0075] According to an embodiment of the present invention, the first rolling circle amplification reaction solution includes a phi29 buffer solution, dNTPs, PF68, and H2O.

[0076] According to an embodiment of the present invention, the final concentration of the phi29 buffer solution in the first rolling circle amplification reaction solution is 1×.

[0077] According to an embodiment of the present invention, the final concentration of the dNTPs in the first rolling circle amplification reaction solution is 0.1-0.5 mM, such as 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, and preferably 0.39 mM.

[0078] According to an embodiment of the present invention, the volume fraction of PF68 in the first rolling circle amplification reaction solution is 0.01-0.03%, such as 0.01%, 0.015%, 0.02%, 0.025%, 0.03%, and preferably 0.0195%.

[0079] According to an embodiment of the present invention, the second rolling circle amplification reaction solution includes an SSB protein and a phi29 buffer solution.

[0080] According to an embodiment of the present invention, the final concentration of the SSB protein in the second rolling circle amplification reaction solution is 2-3 μg / μL, such as 2 μg / μL, 2.1 μg / μL, 2.2 μg / μL, 2.3 μg / μL, 2.4 μg / μL, 2.5 μg / μL, 2.6 μg / μL, 2.7 μg / μL, 2.8 μg / μL, 2.9 μg / μL, 3 μg / μL, and preferably 2.5 μg / μL.

[0081] According to an embodiment of the present invention, the final concentration of the phi29 buffer in the second rolling circle amplification reaction solution is 5×.

[0082] According to an embodiment of the present invention, the volume fraction of the first rolling circle amplification reaction solution in the mixed solution is 40-50%, such as 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, and preferably 47.6%.

[0083] According to an embodiment of the present invention, the volume fraction of the second rolling circle amplification reaction solution in the mixed solution is 4.5-5.5%, such as 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, and preferably 5%.

[0084] According to an embodiment of the present invention, the final concentration of the phi29 buffer in the mixed solution is 4.5×.

[0085] According to an embodiment of the present invention, the final concentration of the cyclized product in the mixed solution is 0.004 ng / μL - 0.2 ng / μL, such as 0.0047 ng / μL, 0.019 ng / μL, 0.047 ng / μL, 0.19 ng / μL, and preferably the final concentration is 0.019 ng / μL. The assembly test results of different cyclized product concentrations are shown in Table 19. Within this concentration range, more single molecules can be detected and the assembly integrity is higher.

[0086] According to an embodiment of the present invention, the rolling circle amplification treatment is to react at 30°C for 0.5-1.5 h first, and then react at 65°C for 10-20 min.

[0087] According to an embodiment of the present invention, the double-strand generation treatment is carried out in a mixed solution of a double-strand generation reaction solution and nuclease-free water.

[0088] According to an embodiment of the present invention, the double-strand generation reaction solution includes an isothermal amplification buffer, dNTPs, a 2nd primer, and Bst 3.0 DNA polymerase.

[0089] According to an embodiment of the present invention, the 2nd primer has a nucleotide sequence as shown in SEQ ID NO:20.

[0090] According to an embodiment of the present invention, the final concentration of the isothermal amplification buffer in the double-strand generation reaction solution is 3 to 4×, such as 3×, 3.1×, 3.2×, 3.3×, 3.4×, 3.5×, 3.6×, 3.7×, 3.8×, 3.9×, 4×, and preferably 3.97×.

[0091] According to an embodiment of the present invention, the final concentration of the dNTPs in the double-strand generation reaction solution is 3 to 4 mM, such as 3 mM, 3.1 mM, 3.2 mM, 3.3 mM, 3.4 mM, 3.5 mM, 3.6 mM, 3.7 mM, 3.8 mM, 3.9 mM, 4 mM, and preferably 3.17 mM.

[0092] According to an embodiment of the present invention, the final concentration of the 2nd primer in the double-strand generation reaction solution is 0.3 to 0.5 μM, such as 0.3 μM, 0.35 μM, 0.39 μM, 0.4 μM, 0.45 μM, 0.49 μM, 0.8 μM, and preferably 0.397 μM.

[0093] According to an embodiment of the present invention, the final concentration of the Bst 3.0 DNA polymerase in the double-strand generation reaction solution is 0.5 to 0.8 U / μL, such as 0.5 U / μL, 0.6 U / μL, 0.63 U / μL, 0.68 U / μL, 0.7 U / μL, 0.8 U / μL, and preferably 0.635 U / μL.

[0094] According to an embodiment of the present invention, the volume ratio of the double-strand generation reaction solution to nuclease-free water is 1:(2 to 5).

[0095] According to an embodiment of the present invention, the final concentration of the rolling circle amplification product in the mixed solution is 0.5 to 1.5 ng / μL, such as 0.5 ng / μL, 0.6 ng / μL, 0.7 ng / μL, 0.8 ng / μL, 0.9 ng / μL, 1 ng / μL, 1.1 ng / μL, 1.2 ng / μL, 1.3 ng / μL, 1.4 ng / μL, 1.5 ng / μL, and preferably 1 ng / μL.

[0096] According to an embodiment of the present invention, for the double-strand generation treatment, first react at 60 °C for 0.5 to 1.5 h, and then react at 80 °C for 10 to -20 min.

[0097] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present invention. Brief Description of the Drawings

[0098] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of embodiments in conjunction with the accompanying drawings, where:

[0099] Figure 1 is a schematic diagram of an stLFR-based HLA amplicon typing scheme according to an embodiment of the present invention;

[0100] Figure 2 is the gel electrophoresis detection of HLA gene amplification products according to an embodiment of the present invention; the electrophoresis molecular weight marker used is 1Kb plus, the specific band sizes are shown on the left of the gel image, and the predicted product sizes are shown as the numbers under the gene names above the lanes;

[0101] Figure 3 is a flow chart of HLA region typing analysis based on the stLFR method according to an embodiment of the present invention. Detailed Embodiments

[0102] Embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention and should not be construed as a limitation of the present invention.

[0103] It should be noted that the terms "first" and "second" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features, nor is there any order of precedence. Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of such features. Further, in the description of the present invention, unless otherwise specified, the meaning of "a plurality" is two or more.

[0104] As used herein, phrases such as "between X and Y" and "between about X and Y" shall be construed to include X and Y. As used herein, the phrase "between about X and Y" means "between about X and about Y", and the phrase "from about X to Y" means "from about X to about Y".

[0105] Unless otherwise specified herein, the numerical ranges recited herein are only intended as a convenient method for separately referring to each individual numerical value falling within the range, and each individual numerical value is incorporated into this specification as if it were recited herein separately. For example, if the range 10 to 15 is disclosed, then 11, 12, 13, and 14 are also disclosed.

[0106] As used herein, the terms "comprising", "including", and "including or comprising" specify the presence of the stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0107] In the present invention, the terms "optionally", "optional" or "option" generally mean that the subsequent described event or condition may but does not necessarily occur, and the description includes the cases where the event or condition occurs and the cases where the event or condition does not occur.

[0108] The term "allele", as used herein, refers to one of the alternative forms of a genetic locus.

[0109] As used herein, the term "locus" refers to the position on a chromosome of a specific gene or allele.

[0110] The term "genotype", as used herein, refers to a description of the alleles of a gene or genes contained in an individual or in a sample from said individual.

[0111] The expression "determining the HLA genotype", as used herein, refers to the determination of the HLA polymorphisms present in the individual alleles of a subject.

[0112] The term "DNA sample" refers to a sample containing human genomic DNA obtained from a subject.

[0113] As used herein, the term "subject" refers to a human being, including adults, children and humans in the fetal stage.

[0114] The term "polymerase chain reaction" or "PCR", as used herein, refers to a method for amplifying a DNA sequence in a cyclic reaction using a thermostable DNA polymerase and a set of amplification primers, in which the annealing of the primers, the synthesis of the progeny DNA strands and the denaturation of the duplexes each occur at different temperatures. Since the newly synthesized DNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation and dissociation result in the rapid amplification of the target sequence.

[0115] The term "amplification primer", as used herein, refers to an oligonucleotide that can selectively hybridize to a target nucleic acid or "template", more particularly can anneal to a DNA region adjacent to the target sequence to be amplified and provides a starting point for template-directed synthesis (polymerase chain reaction amplification) of a polynucleotide complementary to the template by a polymerase such as DNA polymerase. The primer is preferably a single-stranded oligodeoxyribonucleotide. Amplification primers typically range in length from 15 to 40 nucleotides, preferably from 15 to 30 nucleotides. The amplification primer may contain regions complementary to the target HLA sequence and regions not complementary to the target HLA sequence. In this case, the region complementary to the target HLA sequence is at least 15 nucleotides in length. Primers are often obtained as synthetic molecules and can be designed with a wide range of molecular modifications, particularly at their 5'- or 3'-ends.

[0116] As used herein, the term "DNA polymerase" refers to an enzyme necessary for the elongation of an amplification primer in a nucleic acid template. One of ordinary skill in the art can select a suitable polymerase based on the characteristics of the polymerase such as efficiency, processivity, or fidelity. Preferably, the polymerase is a high-fidelity and thermostable polymerase.

[0117] The term "amplicon" or "amplification product", as used herein, refers to a DNA fragment spanned within a pair of amplification primers that is exponentially amplified by a DNA polymerase. The amplicon can be single-stranded or double-stranded.

[0118] The term "determined sequence", as used herein, refers to determining the identity of nucleotide bases at each position along the length of a polynucleotide. Any sequencing method can be used in the present invention.

[0119] HLA gene

[0120] HLA-A, HLA-B, and HLA-C are the three main types of human MHC class I cell surface antigen-presenting proteins. They play a central role in the immune system by presenting peptides derived from the lumen of the endoplasmic reticulum and are expressed in almost all cells. These receptors are heterodimers and consist of a heavy α chain and a light chain (the invariant β2-microglobulin molecule encoded by a separate region of the human genome). The HLA-A gene (Gene ID: 3105) contains 8 coding exons, and the HLA-B gene (Gene ID: 3106) and HLA-C gene (Gene ID: 3107) contain 7 coding exons.

[0121] HLA class II molecules are heterodimers consisting of an α chain and a β chain that are both anchored in the membrane. They play a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen-presenting cells (such as B lymphocytes, dendritic cells, macrophages).

[0122] HLA-DRB1 (Gene ID: 3123), HLA-DRB3 (Gene ID: 3125), HLA-DRB4 (Gene ID: 3126), and HLA-DRB5 (Gene ID: 3127) belong to the HLA class II β-chain paralogous genes. The heterodimer consists of an α chain (DRA) and a β chain (DRB). The β chain is approximately 26-28 kDa and is encoded by 6 exons.

[0123] HLA-DQA1 (Gene ID: 3117) belongs to the HLA class II α-chain paralogous genes. The heterodimer consists of an α chain (DQA) and a β chain (DQB). The α chain is approximately 33-35 kDa and is encoded by 4 coding exons.

[0124] HLA-DQB1 (Gene ID: 3119) belongs to the HLA class II beta-chain paralogous genes. The beta-chain is approximately 26-28 kDa and is encoded by 5 coding exons.

[0125] HLA-DPB1 (Gene ID: 3115) belongs to the HLA class II beta-chain paralogous genes. The heterodimer is composed of an alpha-chain (DPA) and a beta-chain (DPB). The beta-chain is approximately 26-28 kDa and is encoded by 5 coding exons.

[0126] The term "single tube Long Fragment Read (stLFR)" is a long fragment read technology independently developed by MGI Tech based on the DNBSEQ platform, which can achieve a read sequence length of up to 10k - 300k. The specific steps of this method can be found in the reference Wang O, Chin R, Cheng X, et al. Efficient and unique cobarcoding of second-generation sequencing reads from long DNA molecules enabling cost-effective and accurate sequencing, haplotyping, and de novo assembly [J]. Genome research, 2019, 29(5): 798 - 808.

[0127] The embodiments of the present invention will be described in detail below. The embodiments described below are exemplary and are only used to explain the present invention and should not be construed as a limitation of the present invention. For those not specified in the embodiments regarding specific techniques or conditions, the techniques or conditions described in the literature in this field or according to the product specifications shall be followed. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0128] The present invention proposes a method for HLA amplicon typing based on single tube Long Fragment Read (stLFR). First, the full-length bands of the major HLA genes (HLA-A, B, C, DRB1, DQA1, DQB1, DPA1, DPB1) are amplified by long fragment PCR. Then, the adapter sequences required for molecular internal circularization are ligated to the amplification products, and then circularization is carried out. The obtained circular DNA products are subjected to rolling circle amplification to obtain single-stranded multi-copy long molecules. After hybridizing with double-stranded primers, a double-stranded DNA synthesis polymerization reaction is carried out, and finally, double-stranded long molecules composed of multiple single copies in series are obtained, which are used as the starting DNA for single tube Long Fragment Read (stLFR) library construction. The schematic diagram is as Figure 1 shown. The specific method is as follows:

[0129] Example 1

[0130] 1. Synthesize the primer sequences listed in Table 1 of Sangon Biotech, and dissolve the primers to a concentration of 100 μM in TE buffer (Thermofisher 12090015) according to the method provided by the supplier for later use.

[0131] Table 1 Primer sequences for HLA gene amplification

[0132] Primer Sequence SEQ ID NO: HLA-A_F7 ATCCTGGATACTCACGACGCGGAC 1 HLA-A_R7 CATCAACCTCTCATGGCAAGAATTT 2 HLA-B_F3 AGGTGAATGGCTCTGAAAATTTGTCTC 3 HLA-B_R3 AGAGTTTAATTGTAATGCTGTTTTGACACA 4 HLA-C_F4 GGCCGCCTGTACTTTTCTCAGCAG 5 HLA-C_R4 CCATGGTGAGTTTCCCTGTACAAGAG 6 HLA-DPA1_F1 CTCTCTTGACCACGCTGGTACCTA 7 HLA-DPA1_R1 TTGGCCTCTTGGCTATACCTCTTTT 8 HLA-DPB1_F1_X TGGTCCAACAGGATCACATTTATAAGTGT 9 HLA-DPB1_R1_X CCCAGTTTGGATGGTCTCTCAGCTCTT 10 HLA-DQA1_F2 GCCAGGGAGGGAAATCAACT 11 HLA-DQA1_R2 ATCCAGTGGAGGACACAGCAC 12 HLA-DQB1_F6 TCATGTGCTTCTCTTGAGCAGTCTGA 13 HLA-DQB1_R6 TGTGACAGCAATTTTCTCTCCCCT 14 HLA-DRB1_F1 TGATTGACTTGCTGGCTGGTTTCTCATC 15 HLA-DRB1_R1 GCATCCACAGAATCACATTTTCTAGTGTT 16

[0133] 2. Configure the PCR system according to the information in Table 2. The sample source is NA12878 genomic DNA (Coriell Institute NA12878). The primers refer to a set of primers in Table 1, and the 8 sets of primers are configured in different PCR reaction tubes respectively.

[0134] Table 2 Formulation of PCR system

[0135]

[0136] 3. Vortex and mix the above PCR system and then centrifuge it. Amplify using the PCR reaction conditions in Table 3 to obtain the PCR product.

[0137] Table 3 PCR reaction conditions

[0138]

[0139] 4. Use 10 μL of Ampure XP magnetic beads (Bechman Coulter A63882) to purify the PCR product according to the instruction manual. Finally, dissolve the magnetic beads in TE buffer (Thermofisher 12090015) to a volume of 25 μL, and take 22 μL of the supernatant. After purification, use Qubit TM HS dsDNA Quantification Kit (Thermofisher Q32851) to measure the concentration and label it.

[0140] 5. Take 2 μL of the purified product, perform electrophoresis detection on the purified product using 0.8% (m / v) agarose, and use GeneRuler 1kb plus (Thermo Scientific TM SM1331) electrophoresis molecular weight indicator to assist in judging the size of the amplification product. The electrophoresis condition is to run at a voltage of 140 V for 2 hours. The electrophoresis result is as Figure 2 shown.

[0141] Example 2

[0142] 1. Configure the end repair reaction system in Table 4, and perform end repair on the product after PCR purification in Example 1. The end repair reaction temperature is 20 °C, and the reaction time is 30 minutes.

[0143] Formulation of the end repair reaction system in Table 4

[0144]

[0145]

[0146] 2. After the end repair reaction, use 50 μL of Ampure XP magnetic beads (Bechman Coulter A63882) to purify the end repair product according to the instructions. The final volume of the magnetic beads redissolved in TE buffer is 20 μL, and 18 μL of the supernatant is taken.

[0147] 3. Configure the A-addition reaction system in Table 5, add it to the product purified in Step 2, mix well by shaking, and then centrifuge for the A-addition reaction. The reaction temperature is 37 °C, and the reaction time is 30 minutes.

[0148] Formulation of the A-addition reaction system in Table 5

[0149]

[0150] 4. After the A-addition reaction, use 30 μL of Ampure XP magnetic beads (Bechman Coulter A63882) to purify the A-addition product according to the instructions. The final volume of the magnetic beads redissolved in TE buffer is 15 μL, and 13 μL of the supernatant is taken.

[0151] 5. Order the sequences in Table 6 from Sangon Biotech, and use TE buffer (Thermofisher 12090015) to dissolve the primers ds_ad_3T_1, ds_ds_5T_1, and ds PCR primer-2 to a 100 μM concentration stock solution for standby according to the method provided by the supplier. And use TE buffer (Thermofisher 12090015) to dilute the 2nd primer to a 1 μM concentration.

[0152] Sequences of the circularization adapter primers and subsequent extension primers in Table 6

[0153] Primer Sequence SEQ ID NO: ds_ad_3T_1 5'Phos-AGTCGGACGCTGATAAGGTCGCCATGCCT 17 ds_ds_5T_1 AGGTCGCCAUGCCUCTCAGTACTCCGACTT 18 ds PCR primer-2 AGGCAUGGCGACCTTAUCAGCG 19 2nd primer CGCTGATAAGGTCGCCATGCCTCTCAGTAC 20

[0154] 6. Take 25 μL each of the 100 μM ds_ad_3T_1 primer and ds_ad_5T_1 primer after dissolution. Mix them well and add 50 μL of TE buffer (Thermofisher 12090015). Vortex and mix again, then centrifuge. Incubate the above primer mixture at 70 °C for 10 minutes, and then let it stand at room temperature for more than half an hour. Label it as 25 μM dsAD (circular adapter primer) for later use.

[0155] 7. Prepare 3×HB buffer according to Table 7. After preparation, sterilize it by autoclaving and store it in a -20 °C refrigerator for later use.

[0156] Table 7 3×HB buffer formulation

[0157] Component Dosage Unit 50% PEG-8000 (sigma aldrich P1458) 6 mL 2M Tris-HCl (pH 7.8) (Enzynomics EBT026-250) 0.75 mL <![CDATA[1M MgCl2(Invitrogen AM9530G)]]> 0.3 mL 0.1M ATP (Thermo Scientific R0441) 0.3 mL 1M DTT (Invitrogen P2325) 15 μL 20mg / mL BSA (Thermo Scientific FERB14) 75 μL <![CDATA[dH2O]]> 2.56 mL

[0158] 8. Prepare the adapter ligation system as shown in Table 8 and add it to the purified sample in Step 4. Vortex and mix well, then centrifuge for the ligation reaction. The reaction temperature is 20 °C and the reaction time is 30 minutes.

[0159] Table 8 Ligation system formulation

[0160]

[0161] 9. After the ligation reaction, add 30 μL of Ampure XP magnetic beads (Bechman Coulter A63882) to the reaction system, and supplement 33 μL of TE buffer (Thermofisher 12090015). Purify the ligation product according to the instructions. Finally, the volume of the magnetic beads redissolved in TE buffer (Thermofisher 12090015) is 26 μL, and take 24 μL of the supernatant.

[0162] 10. Prepare the PfuCx reaction mixture (2×) according to Table 9. After preparation, filter it using a 0.22 μM filter membrane.

[0163] Table 9 PfuCx reaction mixture (2×) formulation

[0164] Component Dosage Unit 10× PfuTurbo buffer (Agilent 600252) 2 mL DMSO (Sigma Aldrich D8418) 0.5 mL 5M Betaine (Sigma Aldrich B0300) 2 mL <![CDATA[1M MgSO4(Sigma Aldrich M3409)]]> 60 μL <![CDATA[25 mM dNTPs (Thermo Scientific TM R1121)]]> 240 μL <![CDATA[NF H2O(Invitrogen 10977015)]]> 5.2 mL

[0165] 11. Prepare the polymerase extension reaction solution according to Table 10. After preparation, store it on ice for later use.

[0166] Table 10 Polymerase extension reaction solution formulation

[0167]

[0168] 12. Add the polymerase extension reaction solution to the purified ligation product. After shaking and mixing evenly, centrifuge for the polymerase extension reaction. The reaction conditions are 95°C for 3 minutes, 55°C for 1 minute, 72°C for 20 minutes, and then hold at 4°C.

[0169] 13. Add 75 μL of Ampure XP magnetic beads (Bechman Coulter A63882) to the reaction system, and purify the ligation product according to the instruction manual. Finally, dissolve the magnetic beads with TE buffer (Thermofisher 12090015) to a volume of 31 μL, and take 29 μL of the supernatant.

[0170] 14. Prepare the USER enzyme reaction system according to Table 11.

[0171] Table 11 Formulation of USER enzyme reaction solution

[0172]

[0173]

[0174] 15. Add the USER enzyme reaction solution to the above polymerase extension reaction product. After shaking and mixing evenly, centrifuge for the USER enzyme excision reaction. The reaction conditions are 37°C for 1 hour, and then hold at 4°C.

[0175] 16. Prepare the cyclization reaction solution according to Table 12.

[0176] Table 12 Formulation of cyclization reaction solution

[0177] Component Dosage Unit <![CDATA[H2O(Invitrogen 10977015)]]> 85.5 μL 10×TA Buffer (Epicentre TA6160) 10 μL 0.1M ATP (Thermo Scientific R0441) 1.5 μL Total 97 μL

[0178] 17. Add the cyclization reaction solution to the above USER enzyme excision reaction product. After shaking and mixing evenly, centrifuge for pre-incubation of the cyclization reaction. The reaction conditions are 70°C for 15 minutes and 25°C for 5 minutes. Then add 3 μL of T4 DNA ligase (Qiagen L6030-LC-L) to the reaction tube. After shaking and mixing evenly, centrifuge and incubate at 25°C for 60 minutes, and then hold at 4°C.

[0179] 18. Add 0.4 μL of Plasmid Safe DNA exonuclease (Biosearch Technologies E3101K) to the above cyclization reaction system. After shaking and mixing evenly, centrifuge to degrade the uncyclized linear DNA. The reaction conditions are 37°C for 1 hour, 65°C for 15 minutes, and then hold at 4°C.

[0180] 19. Add 150 μL of Ampure XP magnetic beads (Bechman Coulter A63882) to the above reaction system, and purify the digestion product according to the instruction manual. Finally, dissolve the magnetic beads in 15 μL of TE buffer (Thermofisher 12090015). Take 13 μL of the supernatant, and take 1 μL of the digested product for Qubit HS dsDNA (Thermofisher Q32851) concentration measurement.

[0181] 20. Prepare Rolling Circle Amplification Reaction Solution 1 according to Table 13.

[0182] Table 13 Recipe of Rolling Circle Amplification Reaction Solution 1

[0183]

[0184] 21. Prepare Rolling Circle Amplification Reaction Solution 2 according to Table 14.

[0185] Table 14 Recipe of Rolling Circle Amplification Reaction Solution 2

[0186] Component Dosage Unit SSB Protein (Thermo Scientific 70032Z500UG) 2 μL 10×phi29 Buffer (Qiagen P7020-HC-L) 2 μL total 4 μL

[0187] 22. Take 0.4 ng of the above purified digestion product (final concentration: 0.019 ng / μL), add 5 μL of 10×phi29 buffer (Qiagen P7020-HC-L), 10 μL of Rolling Circle Amplification Reaction Solution 1 and 1 μL of Rolling Circle Amplification Reaction Solution 2, and make up the volume to 21 μL with nuclease-free water (Invitrogen 10977015). After mixing well by oscillation and centrifugation, perform the rolling circle amplification reaction. The reaction conditions are 30 °C for 1 hour, 65 °C for 15 minutes, and hold at 4 °C. Take 1 μL of the rolling circle amplification product for Qubit HS ssDNA (Invitrogen Q10212) concentration measurement.

[0188] 23. Prepare the reaction system for generating double-stranded rolling circle amplification products according to Table 15.

[0189] Table 15 Reaction Solution for Generating Double-stranded Rolling Circle Amplification Products

[0190] Component Dosage Unit 10×Isothermal Amplification Buffer (NEB B0537S) 5 μL <![CDATA[25mM dNTPs(Thermo Scientific TM R1121)]]> 1.6 μL 2nd Primer (1uM) 5 μL Bst 3.0 DNA Polymerase (NEB M0374S) 1 μL total 12.6 μL

[0191] 24. Take 50 ng of the above rolling circle amplification product, add 12.6 μL of the reaction solution for generating double-stranded rolling circle amplification products, and then make up the volume to 50 μL with nuclease-free water (Invitrogen 10977015). Gently mix 10 times with a flared pipette tip, and place it in a PCR instrument for double-stranded generation reaction. The reaction conditions are 60 °C for 1 hour, 80 °C for 15 minutes, and hold at 4 °C.

[0192] 25. Take 1 μL of the second-strand generation reaction product for Qubit HS dsDNA (Thermofisher Q32851) concentration measurement. Take 1 ng of the rolling circle amplification second-strand generation product and use the MGIEasy stLFR library preparation kit (MGI Tech 940-000193-00) to construct the MGIEasy stLFR library.

[0193] 26. Use the MGISEQ-2000 platform to perform PE100+26+10 sequencing on the above stLFR library (reference: Wang O, Chin R, Cheng X, et al. Efficient and unique cobarcoding of second-generation sequencing reads from long DNA molecules enabling cost-effective and accurate sequencing, haplotyping, and de novo assembly[J]. Genome research, 2019, 29(5):798-808.).

[0194] Example 3

[0195] 1. Use SOAPnuke (https: / / github.com / BGI-flexlab / SOAPnuke) to perform quality control filtering on the data.

[0196] 2. Use the stLFR barcode splitting process (https: / / github.com / stLFR / stLFR_read_demux) to split the data (reference: Wang O, Chin R, Cheng X, et al. Efficient and unique cobarcoding of second-generation sequencing reads from long DNA molecules enabling cost-effective and accurate sequencing, haplotyping, and de novo assembly[J]. Genome research, 2019, 29(5):798-808.).

[0197] 3. Filter the data after splitting by the amount of data, select barcodes with more than 100 sequencing sequences, and use SOAPdenovo (https: / / www.animalgenome.org / bioinfo / resources / manuals / SOAP.html) to independently assemble the sequencing sequences under each barcode.

[0198] 4. Align the contig sequences obtained by assembly to the human reference genome (version number GRCh37), and retain the contig sequences aligned to the human leukocyte antigen region (HLA region, chr6: 28,477,797 - 33,448,354).

[0199] 5. Further align the contig sequences that can be aligned to the human leukocyte antigen region to the IPD-IMGT database (https: / / www.ebi.ac.uk / ipd / imgt / hla / )

[0200] 6. Filter out low-quality alignment sequences, and determine the final leukocyte antigen type according to the database type. The whole process is as Figure 3 shown.

[0201] 7. Finally, the diploid typing results of the HLA region of the NA12878 sample obtained by this method are compared with the true HLA type of the NA12878 sample as shown in Table 1 ormally, the two sets of haplotype typing results obtained by assembly are completely consistent with the prior results.

[0202] Table 16

[0203]

[0204] Comparative Example 1

[0205] 1. After directly aligning the original sequencing sequences after library construction and sequencing using stLFR to the reference genome, the haplotype typing results are obtained based on the co-marking strategy, and then the HLA typing results are as shown in Table 17. The consistency rate of the results of 8 genes (16 allele loci) with the prior results is only 62.5%.

[0206] Table 17

[0207]

[0208]

[0209] 2. After library construction and sequencing using stLFR, diploid genotyping and assembly were performed based on the co - tagging strategy. After aligning the obtained assembled contigs to the reference genome, HLA typing was carried out, and the results are shown in Table 18. For 8 genes (16 allele loci), the consistency rate of the results with the prior results was only 68.75%.

[0210] Table 18

[0211]

[0212] 3. Using circularized products with different concentrations for rolling circle replication will have a significant impact on the final assembly effect. As shown in Table 19, when the input amount of circularized product is 0.4 ng, more single - molecules can be detected compared to other concentrations, and the assembly integrity is higher.

[0213] Table 19

[0214]

[0215]

[0216] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above - mentioned terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0217] Although the embodiments of the present invention have been shown and described above, it can be understood that the above - mentioned embodiments are exemplary and should not be construed as limitations of the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above - mentioned embodiments within the scope of the present invention.

Claims

1. A method for determining HLA genotype, characterized in that, Comprising: Constructing a sequencing library containing HLA gene nucleic acid sequences by using a single-tube long-fragment reading library construction method; Performing sequencing processing on the sequencing library; And Comparing the sequencing processing result with a predetermined reference sequence to determine the genotype of the HLA.

2. The method according to claim 1, characterized in that, The starting DNA for constructing the sequencing library is obtained by the following method: Using the genome as a template, performing amplification processing in the presence of HLA gene primers to obtain an amplification product; Adding a polyA tail to the 3' end of the amplification product to obtain an amplification product with a polyA tail; Connecting the amplification product with a polyA tail to a circular adapter to obtain a ligation product; Circularizing the ligation product to obtain a circularized product; Using the circularized product as a template, performing rolling circle amplification processing in the presence of dNTPs to obtain a rolling circle amplification product; Performing double-strand generation processing on the rolling circle amplification product to obtain a double-strand generation product; Using the double-strand generation product as the starting DNA.

3. The method according to claim 1, characterized in that, Before comparing the sequencing processing result with a predetermined reference sequence, further comprising independently assembling the sequencing sequences with the same molecular tag in the sequencing processing result to obtain a contig sequence; Optionally, the comparison processing includes performing a first comparison of the contig sequence with a human reference genome to obtain a contig sequence that overlaps with the human leukocyte antigen region; performing a second comparison of the contig sequence with the IPD-IMGT database to determine the genotype of the HLA.

4. The method according to claim 1 or 2, characterized in that The HLA genotype is selected from at least one of HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1; Optionally, the primers are selected from at least one set of nucleotide sequences shown in SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16.

5. The method according to claim 2, characterized in that, The rolling circle amplification processing is performed in a mixed solution of a first rolling circle amplification reaction solution, a second rolling circle amplification reaction solution, phi29 buffer, and nuclease-free water; Optionally, the first rolling circle amplification reaction solution includes phi29 buffer, dNTPs, PF68, and H2O; Optionally, the second rolling circle amplification reaction solution includes SSB protein and phi29 buffer; Optionally, the rolling circle amplification processing is first carried out at 30°C for 0.5 - 1.5 h, and then at 65°C for 10 - 20 min.

6. The method according to claim 2, wherein The amplification processing is performed in a PCR system; Optionally, the PCR system includes a DNA sample carrying the genome, PrimeStar GXL polymerase, PrimeStar buffer, dNTPs, dH2O, and the primers.

7. The method according to claim 2, characterized in that, Adding a polyA tail to the 3'-end of the amplification product is carried out in a polyA addition reaction system; Optionally, the polyA addition reaction system includes dH2O, PNK buffer, dATP, and klenow exo- fragment; Optionally, adding a polyA tail to the 3'-end of the amplification product is carried out at 35 - 40 °C for 20 - 40 min.

8. The method according to claim 2, characterized in that, The ligation treatment is carried out in a ligation system; Optionally, the ligation system includes dH2O, HB buffer, circularization adapter primer, and T4 DNA ligase; Optionally, the HB buffer includes dH2O, PEG - 8000, Tris - HCl, MgCl2, ATP, DTT, and BSA; Optionally, the circularization adapter primer includes a first primer and a second primer. The first primer has the nucleotide sequence shown in SEQ ID NO:17, and the second primer has the nucleotide sequence shown in SEQ ID NO:18; Optionally, the ligation treatment is carried out at 17 - 23 °C for 20 - 40 min.

9. The method according to claim 2, wherein Before subjecting the ligation product to circularization treatment, it further includes subjecting the ligation product to extension treatment and enzyme excision treatment; Optionally, the extension treatment is carried out in an extension reaction solution; Optionally, the extension reaction solution includes H2O, PfuCx reaction mixture, ds PCR primer - 2, and PfuTurbo polymerase; Optionally, the ds PCR primer - 2 has the nucleotide sequence shown in SEQ ID NO:19; Optionally, the PfuCx reaction mixture includes PfuTurbo buffer, DMSO, betaine, MgSO4, dNTPs, and NFH2O; Optionally, the reaction conditions for the extension treatment are successively 95 °C for 3 minutes, 55 °C for 1 minute, and 72 °C for 20 minutes; Optionally, the enzyme excision treatment is carried out in an enzyme reaction solution; Optionally, the enzyme reaction solution includes TA buffer, H2O, and USER; Optionally, the enzyme excision treatment is carried out at 35 - 40 °C for 0.5 h - 1.5 h.

10. The method according to claim 2, characterized in that, The circularization treatment includes subjecting the ligation product to a first incubation treatment with a circularization reaction solution, and subjecting the product of the first incubation treatment to a second incubation treatment with T4 DNA ligase to obtain the circularization product; Optionally, the circularization reaction solution includes H2O, TA buffer, and ATP; Optionally, the final concentration of T4 DNA ligase in the product of the first incubation treatment is 580 - 620 U / μL; [[ID= ​ 11. The method according to claim 2, wherein ​ ​ Optionally, the 2nd primer has a nucleotide sequence shown in SEQ ID NO: 20; Optionally, the volume ratio of the double-strand generation reaction solution to the ribonuclease-free water is 1:(2-5); Optionally, for the double-strand generation treatment, the reaction is first carried out at 60°C for 0.5-1.5 h, and then at 80°C for 10-20 min.

Images