InDel markers tightly linked to the sweet and sticky traits of corn ears and their applications

Abstract

The present application discloses an InDel marker tightly linked to the sweet and sticky homologous trait of corn cobs, with the corn B73-V4 genome as the reference genome. The marker is a 73 bp insertion sequence located at the 12126328 bp position of chromosome 9, and the nucleotide sequence of the insertion sequence is shown in SEQ ID NO.1. The InDel marker provided by the present invention can be used to quickly screen out corn materials containing the sweet and sticky homologous gene in the early stages of corn growth, and can also be used for molecular marker-assisted breeding of fresh corn. The screening accuracy rate using the InDel marker and screening method provided by the present invention is high, and the use of the marker and screening method not only saves production costs but also improves breeding efficiency.

Description

Technical Field

[0001] The present application relates to the field of molecular genetics technology, and in particular to an InDel marker tightly linked to the sweet and sticky corn cob trait and its application. Background Art

[0002] Fresh corn refers to corn varieties that are harvested during the milky stage for processing or fresh consumption, also known as fruit and vegetable corn. Based on starch composition and flavor characteristics, it is mainly divided into three categories: sweet corn, glutinous corn, and sweet and glutinous corn. Sweet corn is known for its high sugar content, with a soluble sugar content ranging from 12-22% and amylopectin accounting for less than 5%, giving it a sweet, refreshing, and crisp taste. Glutinous corn has a typical high-amylopectin structure, with a content of more than 97%, and a sugar content generally less than 10%, with a unique soft and glutinous texture. Sweet and glutinous corn is achieved by hybridizing the genetic characteristics of sweet corn and glutinous corn on the same cob to achieve a precise combination of sweet and glutinous kernels. The two kernels are usually presented in a stable ratio of 1:3 or 7:9, combining the taste advantages of both parental lines.

[0003] The three existing mainstream types of fresh corn have the following shortcomings: First, sweet corn and sticky corn cannot simultaneously meet consumer demand for both flavors, and there is an urgent need for high-quality corn germplasm resources that are both highly sweet and sticky. Second, existing sweet and sticky corn contains both sweet and sticky kernels on the same ear, and the sweet and sticky kernels are separated by a certain ratio, resulting in the disadvantages of sweet kernels not being sticky and sticky kernels not being sweet. Third, the harvest period of the three existing types of fresh corn varieties is generally short (only 3-5 days). When extreme weather prevents harvesting, it will cause significant economic losses to farmers and fresh corn planting companies, and also put a great deal of pressure on processing companies to concentrate labor in a short period of time.

[0004] To address these challenges in the development of the fresh corn industry, the Fresh Corn Genetics and Breeding Research Group at the Institute of Specialty Products, Chinese Academy of Agricultural Sciences, through extensive collection, identification, and evaluation of fresh corn germplasm resources, discovered a breakthrough sweet-glutinous, homogenous corn germplasm (i.e., the sweet-glutinous, homogenous corn parent B2595T used in this application) that is distinct from the three existing types of fresh corn: sweet corn, glutinous corn, and sweet and glutinous corn. All kernels of this new germplasm exhibit high sweetness (above 15 degrees) and high glutinousness (amylopectin content up to 89%), achieving a breakthrough in sweet-glutinous, homogenous corn production. Notably, this new germplasm boasts a fresh-ear harvest period of over 15 days, making it a revolutionary new fresh corn germplasm.

[0005] Breakthrough sweet-and-sticky kernel germplasm resources possess significant innovation and extremely high commercial development value. However, their core regulatory genes have not yet been cloned, and molecular marker development lags behind, severely hindering the precise genetic improvement and industrial application of this trait. Therefore, to further accelerate the breeding of new sweet-and-sticky kernel fresh-eating corn varieties, it is necessary to conduct QTL mapping of sweet-and-sticky kernel genes in corn and develop molecular markers highly linked to these genes. This will enable better utilization of these breakthrough sweet-and-sticky kernel germplasm resources and promote the breeding and development of new sweet-and-sticky kernel fresh-eating corn varieties. Summary of the Invention

[0006] The present invention provides an InDel marker tightly linked to the sweet and sticky trait of corn ears. The corn B73-V4 genome is used as a reference genome. The marker is a 73 bp - / insertion sequence located at the 12126328 bp position of chromosome 9. The nucleotide sequence of the insertion sequence is shown in SEQ ID NO.1.

[0007] The present invention also provides a primer pair for amplifying the aforementioned InDel marker, wherein the primer pair comprises primers shown in SEQ ID NO. 2-3.

[0008] The present invention also provides a use of the aforementioned InDel marker or primer pair, wherein the use comprises at least one of the following 1) to 3):

[0009] 1) Rapid screening of sweet and sticky corn germplasm resources;

[0010] 2) Maize molecular marker-assisted breeding;

[0011] 3) Prepare detection products for rapid screening of sweet and sticky corn germplasm resources.

[0012] The present invention also provides a method for rapidly screening sweet and glutinous corn germplasm resources, comprising the following steps:

[0013] (1) Extracting genomic DNA from the maize germplasm to be tested;

[0014] (2) PCR amplification of the genomic DNA of the maize germplasm to be tested using the aforementioned primers;

[0015] (3) If the amplified product contains only one sequence fragment, and the fragment is 421 bp in length or includes the insertion sequence shown in SEQ ID NO.1, then the maize germplasm resource to be tested is a sweet and glutinous corn material.

[0016] Specifically, in step (1), the seedling leaves of the maize germplasm resources to be tested are collected to extract the genomic DNA of the maize germplasm resources to be tested.

[0017] The conditions for PCR amplification in step (2) are: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, and extension at 72°C for 15 sec, 35 cycles; and extension at 72°C for 5 min.

[0018] In step (3), the PCR amplification product is subjected to gel electrophoresis analysis to determine the fragment size of the amplification product; if only one band is amplified and its length is 421 bp, the corn germplasm resource to be tested is a sweet and glutinous corn material.

[0019] More specifically, the nucleotide sequence of the amplified product in step (3) is shown as SEQ ID NO.5.

[0020] The present invention also provides a detection kit for rapidly identifying sweet and sticky corn germplasm resources, characterized in that the kit comprises the aforementioned primer pair.

[0021] The present invention provides the following beneficial effects: It provides an InDel marker, chr9_12126328, that is tightly linked to the sweet and sticky corn cob trait. The InDel marker provided by the present invention can be used to rapidly screen for corn materials containing the sweet and sticky corn gene during early growth stages and can also be used for molecular marker-assisted breeding of fresh corn. The InDel marker and screening method provided by the present invention have high screening accuracy, reducing production costs and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Fit the positioning results for SNP-Index;

[0023] Figure 2 This is an agarose gel electrophoresis diagram of the PCR amplification products of the F2 generation sweet and glutinous corn material in Example 1, wherein the markers from bottom to top are: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp and 700 bp;

[0024] Figure 3 This is an agarose gel electrophoresis diagram of the PCR amplification products of the F2 waxy corn material in Example 1, wherein the markers from bottom to top are: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp and 700 bp;

[0025] Figure 4This is the agarose gel electrophoresis diagram of the PCR amplification product of the corn material in Example 3, wherein the markers from bottom to top are: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp and 700 bp. DETAILED DESCRIPTION

[0026] The present invention will be further illustrated and described below in conjunction with the embodiments, but the embodiments described are only some embodiments of the present invention, rather than all embodiments. Based on the present invention and embodiments, all other inventions and embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0029] Example 1. Screening of InDel markers

[0030] This example determines candidate QTLs and linked InDel markers based on BSA-seq, specifically including the following process:

[0031] (1) Phenotypic definition: The criteria for determining sweet and sticky corn are that the percentage of amylopectin content in the total mass is ≥85%, the percentage of soluble sugar content in the total mass is ≥14%, the endosperm of the mature kernels after drying has obvious horse-tooth depressions and an opaque waxy luster, and the fresh ears are suitable for harvesting for more than 15 days; the criteria for determining sticky corn are that the percentage of amylopectin content in the total mass is ≥97%, the percentage of soluble sugar content in the total mass is ≤10%, the endosperm of the mature kernels after drying has a dense and plump texture and an opaque waxy luster, and the fresh ears are suitable for harvesting for less than 10 days.

[0032] (2) Leaves of 30 waxy corn parent B2595W (deposited at the Institute of Special Products, Chinese Academy of Agricultural Sciences) and sweet waxy corn parent B2595T (deposited at the Institute of Special Products, Chinese Academy of Agricultural Sciences) as well as 30 F2 waxy corn materials and sweet waxy corn materials of the same grain were collected in the field (each material was planted in the field after phenotypic identification, and leaves at the seedling stage were collected). DNA was extracted using the magnetic bead method. After qubit quantification, 30 waxy corn materials of the F2 generation were mixed in equal amounts to form F2-B2595W, and 30 sweet waxy corn materials of the F2 generation were mixed in equal amounts to form F2-B2595T.

[0033] (3) A total of four DNA samples, including the parents B2595W and B2595T and the progeny mixed pool F2-B2595W and F2-B2595T, were used to construct a whole-genome resequencing library. Fragments in the range of 320-460 bp were selected, enriched and amplified, and qbit quantitative stability was achieved. After confirming that the library was qualified, sequencing was performed using BGI DNBSEQ-T7.

[0034] (4) The clean data obtained by sequencing in step (3) were aligned to the maize B73-V4 genome (https: / / maizegdb.org / ) as the reference genome using bwa, and GATK variant detection was performed to obtain high-quality SNP sites. The parameters were "-filter QD < 2.0 --filter-name QD2 -filter QUAL < 30.0 --filter-name QUAL30 -filter SOR > 3.0 --filter-name SOR3 -filter FS > 60.0 --filter-name FS60 -filter MQ < 40.0 --filter-name MQ40 -filter MQRankSum < -12.5 --filter-name MQRankSum-12.5 -filter ReadPosRankSum < -8.0 --filter-nameReadPosRankSum-8" (Li et al., 2020).

[0035] (5) The SNPs selected in step (4) were used to screen the homozygous and differential SNP markers of the parents F2-B2595W and F2-B2595T. The SNP markers were used to locate the QTLs of the progeny pool F2-B2595W and F2-B2595T using the SNP-index algorithm of the R package PNGseqR (Fu et al., 2022). The results are shown in Figure 2. Figure 1 As shown in the SNP-Index fitting positioning results, it can be seen from the figure that the candidate interval of Qsw-chr9-1 (the first QTL for sweet and sticky grains on chromosome 9) is chr9: 218037-23337779.

[0036] (6) Primers were designed for all the InDel markers within the QTL interval determined in step (5). Seven primers were designed according to the principle of uniform distribution (the sites were chr9: 218990, chr9: 338353, chr9: 3915869, chr9: 7253676, chr9: 12126328, chr9: 16426918, and chr9: 18793689). The primers were then subjected to electrophoresis analysis on 121 F2 waxy corn materials and 75 sweet and waxy corn materials of the same grain (planted in the field after phenotypic identification, and DNA was extracted from leaves at the seedling stage). PCR amplification reaction system: 20-100 ng of DNA template, 10 μl of 2× M5 HiPer plus Taq HiFi PCR mix (with blue dye, purchased from Beijing Polymer Biotechnology Co., Ltd., catalog number Mf002-plus-100), 0.5 μl each of forward primer F (10 μM) and reverse primer R (10 μM), and ddH2O to 20 μl. Amplification conditions: initial denaturation at 95°C for 3 min; 35 cycles of denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, and extension at 72°C for 15 sec; and extension at 72°C for 5 min.

[0037] (7) The InDel markers amplified by PCR in step (6) were associated with the phenotypes. Finally, it was determined that the InDel molecular marker located at chr9_12126328 of the maize genome had the highest degree of linkage with the phenotype. The allele was a 73 bp insertion / deletion, and the 73 bp sequence was shown in SEQ ID NO. 1. The primer information was the forward primer F sequence: CAACACCCTGAACCGCT (SEQ ID NO. 2), and the reverse primer R sequence: CCGTGAATCTCGCTGCT (SEQ ID NO. 3).

[0038] The above primers were used to amplify the DNA of 121 waxy corn materials and 75 sweet and waxy corn materials of the F2 generation, and the amplified products were analyzed by electrophoresis (3% agarose gel electrophoresis). The results are as follows: Figure 2-3 As shown: the amplification product of the homozygous genotype RR of the sweet and glutinous corn with the same kernel is only a fragment with a length of 421 bp (its nucleotide sequence is shown in SEQ ID NO.5), and the amplification product of the homozygous genotype GG of the glutinous corn with the same kernel is only a fragment with a length of 348 bp (its nucleotide sequence is shown in SEQ ID NO.6). The sweet and glutinous corn with the same kernel can be quickly screened out by agarose gel electrophoresis.

[0039] Table 1. Genotypic and phenotypic statistical results of F2 generation sweet and glutinous corn materials

[0040] serial number Phenotype genotype serial number Phenotype genotype N1 glutinous rice GG T1 Sweet and sticky RR N2 glutinous rice GG T2 Sweet and sticky RR N3 glutinous rice GG T3 Sweet and sticky RR N4 glutinous rice GG T4 Sweet and sticky RR N5 glutinous rice GR T5 Sweet and sticky RR N6 glutinous rice NN T6 Sweet and sticky RR N7 glutinous rice GG T7 Sweet and sticky RR N8 glutinous rice GG T8 Sweet and sticky RR N9 glutinous rice GG T9 Sweet and sticky RR N10 glutinous rice GG T10 Sweet and sticky RR N11 glutinous rice GG T11 Sweet and sticky RR N12 glutinous rice GG T12 Sweet and sticky RR N13 glutinous rice GG T13 Sweet and sticky RR N14 glutinous rice GG T14 Sweet and sticky RR N15 glutinous rice GG T15 Sweet and sticky RR N16 glutinous rice GG T16 Sweet and sticky RR N17 glutinous rice GG T17 Sweet and sticky RR N18 glutinous rice GG T18 Sweet and sticky RR N19 glutinous rice NN T19 Sweet and sticky RR N20 glutinous rice GG T20 Sweet and sticky RR N21 glutinous rice GG T21 Sweet and sticky RR N22 glutinous rice GG T22 Sweet and sticky RR N23 glutinous rice GG T23 Sweet and sticky RR N24 glutinous rice GG T24 Sweet and sticky RR N25 glutinous rice GG T25 Sweet and sticky RR N26 glutinous rice GG T26 Sweet and sticky RR N27 glutinous rice GG T27 Sweet and sticky RR N28 glutinous rice GG T28 Sweet and sticky RR N29 glutinous rice GG T29 Sweet and sticky RR N30 glutinous rice GG T30 Sweet and sticky RR N31 glutinous rice GG T31 Sweet and sticky RR N32 glutinous rice GG T32 Sweet and sticky RR N33 glutinous rice GG T33 Sweet and sticky RR N34 glutinous rice GG T34 Sweet and sticky RR N35 glutinous rice GG T35 Sweet and sticky NN N36 glutinous rice GG T36 Sweet and sticky RR N37 glutinous rice GG T37 Sweet and sticky RR N38 glutinous rice GR T38 Sweet and sticky RR N39 glutinous rice GG T39 Sweet and sticky RR N40 glutinous rice GG T40 Sweet and sticky RR N41 glutinous rice GG T41 Sweet and sticky RR N42 glutinous rice GG T42 Sweet and sticky RR N43 glutinous rice GG T43 Sweet and sticky RR N44 glutinous rice GG T44 Sweet and sticky RR N45 glutinous rice GG T45 Sweet and sticky RR N46 glutinous rice GG T46 Sweet and sticky RR N47 glutinous rice GG T47 Sweet and sticky NN N48 glutinous rice GG T48 Sweet and sticky RR N49 glutinous rice GG T49 Sweet and sticky RR N50 glutinous rice GG T50 Sweet and sticky RR N51 glutinous rice GG T51 Sweet and sticky RR N52 glutinous rice GG T52 Sweet and sticky NN N53 glutinous rice NN T53 Sweet and sticky RR N54 glutinous rice GG T54 Sweet and sticky RR N55 glutinous rice GG T55 Sweet and sticky RR N56 glutinous rice GG T56 Sweet and sticky RR N57 glutinous rice GG T57 Sweet and sticky RR N58 glutinous rice GG T58 Sweet and sticky RR N59 glutinous rice GG T59 Sweet and sticky RR N60 glutinous rice GG T60 Sweet and sticky RR N61 glutinous rice GG T61 Sweet and sticky RR N62 glutinous rice GG T62 Sweet and sticky RR N63 glutinous rice GG T63 Sweet and sticky RR N64 glutinous rice GG T64 Sweet and sticky RR N65 glutinous rice GG T65 Sweet and sticky RR N66 glutinous rice GG T66 Sweet and sticky RR N67 glutinous rice GG T67 Sweet and sticky RR N68 glutinous rice GG T68 Sweet and sticky RR N69 glutinous rice GG T69 Sweet and sticky RR N70 glutinous rice GG T70 Sweet and sticky RR N71 glutinous rice GG T71 Sweet and sticky RR N72 glutinous rice GG T72 Sweet and sticky RR N73 glutinous rice GG T73 Sweet and sticky RR N74 glutinous rice GG T74 Sweet and sticky RR N75 glutinous rice GG T75 Sweet and sticky RR N76 glutinous rice GG N77 glutinous rice GG N78 glutinous rice GG N79 glutinous rice GG N80 glutinous rice GR N81 glutinous rice GG N82 glutinous rice GG N83 glutinous rice GG N84 glutinous rice GG N85 glutinous rice GG N86 glutinous rice GG N87 glutinous rice GG N88 glutinous rice GG N89 glutinous rice GG N90 glutinous rice GG N91 glutinous rice GG N92 glutinous rice GG N93 glutinous rice GG N94 glutinous rice NN N95 glutinous rice GG N96 glutinous rice GG N97 glutinous rice GG N98 glutinous rice GG N99 glutinous rice GG N100 glutinous rice GG N101 glutinous rice GG N102 glutinous rice GG N103 glutinous rice GR N104 glutinous rice GG N105 glutinous rice GG N106 glutinous rice GG N107 glutinous rice GR N108 glutinous rice GG N109 glutinous rice GG N110 glutinous rice GG N111 glutinous rice GG N112 glutinous rice GG N113 glutinous rice GR N114 glutinous rice GR N115 glutinous rice GG N116 glutinous rice GG N117 glutinous rice GG N118 glutinous rice NN N119 glutinous rice GG N120 glutinous rice GG N121 glutinous rice NN

[0041] Note: "NN" in the table represents missing genotype data; "R" is the abbreviation of "GATTTCCTCTTCTCTCTCACGGTTTCTGTTCATCGCAGAATGTAGGGGCTTTGACGGGGTTTTATAGCCTTGTT (SEQ ID NO.4)".

[0042] As shown in Table 1, there were 72 materials with the homozygous genotype RR in the F2 generation of sweet and glutinous corn (accounting for 100% of the sweet and glutinous corn materials); there were 108 materials with the homozygous genotype GG in the F2 generation of glutinous corn (accounting for 93.9% of the glutinous corn materials), and 7 materials with the heterozygous genotype GR.

[0043] The above results indicate that the chr9_12126328 marker is tightly linked to the sweet-glutinous identical-kernel phenotype and is suitable for rapid screening of sweet-glutinous identical-kernel corn materials.

[0044] Example 2: Method for Rapid Screening of Sweet and Waxy Corn Materials Using InDel Markers

[0045] The specific method for rapidly screening sweet and glutinous corn materials of the same grain using the InDel markers obtained in Example 1 comprises the following steps:

[0046] (1) Collect seedling leaves of the maize germplasm resources to be tested and extract genomic DNA;

[0047] (2) Using the primer pair obtained in Example 1 (forward primer F and reverse primer R, primers shown in SEQ ID NO. 2-3) to perform PCR amplification on the genomic DNA of the maize germplasm resources to be tested;

[0048] PCR amplification reaction system: 20-100 ng DNA template, 10 μl of 2×M5 HiPer plus Taq HiFiPCR mix (with blue dye, purchased from Beijing Polymer Biotechnology Co., Ltd., catalog number Mf002-plus-100), 0.5 μl each of forward primer F (10 μM) and reverse primer R (10 μM), and ddH2O was added to make up to 20 μl.

[0049] Amplification conditions: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, and extension at 72°C for 15 sec; and extension at 72°C for 5 min.

[0050] (3) The PCR amplification product was subjected to gel electrophoresis analysis. If the amplified product was only one band with a length of approximately 421 bp, the tested corn germplasm resource was a sweet and glutinous corn material.

[0051] Example 3: Application verification of the method for rapid screening of sweet and glutinous corn materials using InDel markers

[0052] Phenotypic identification was performed on 69 corn materials (including sweet corn, waxy corn and sweet and waxy corn) using the method of step (1) of Example 1 (Table 2). Then, rapid molecular identification was performed using the screening method provided in Example 2. The identification results are shown in Figure 4 and Table 2. Figure 4 It can be seen that 10 sweet and glutinous corn materials with the same kernel were quickly screened out by InDel markers. The results were completely consistent with the results of corn ear phenotypic identification, indicating that this molecular marker can be effectively used for the early rapid screening of corn materials containing the sweet and glutinous kernel gene.

[0053] Table 2 Genotype and phenotype statistical results of corn materials in this example

[0054]

Claims

1. Use of an InDel marker closely linked to the sweet and sticky corn cob trait or a primer pair for amplifying the InDel marker, characterized in that: The application includes at least one of the following 1) or 2): 1) Rapid screening of sweet and sticky corn germplasm resources; 2) Prepare a test product for rapid screening of sweet and sticky corn germplasm resources; Taking the maize B73-V4 genome as the reference genome, the InDel marker is a 73 bp deletion / insertion sequence located at position 12126328 bp of chromosome 9, and the nucleotide sequence of the deletion / insertion sequence is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The primer pair includes primers shown in SEQ ID NO. 2-3.

3. A method for rapidly screening sweet and glutinous corn germplasm resources, characterized in that: The steps include: (1) Extracting genomic DNA from the maize germplasm to be tested; (2) PCR amplification of the genomic DNA of the maize germplasm to be tested was performed using the primers shown in SEQ ID NO. 2-3; (3) If the amplified product contains only one sequence fragment, and the fragment is 421 bp in length or includes the insertion sequence shown in SEQ ID NO.1, then the maize germplasm resource to be tested is a sweet and glutinous corn material.

4. The method according to claim 3, characterized in that In the step (1), the seedling leaves of the maize germplasm resources to be tested are collected to extract the genomic DNA of the maize germplasm resources to be tested.

5. The method according to claim 3, characterized in that The conditions for PCR amplification in step (2) are: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, and extension at 72°C for 15 sec, 35 cycles; and extension at 72°C for 5 min.

6. The method according to claim 3, characterized in that In step (3), the PCR amplification product is subjected to gel electrophoresis analysis to determine the fragment size of the amplification product; if only one band is amplified and its length is 421 bp, the corn germplasm resource to be tested is a sweet and glutinous corn material.

7. The method according to claim 3, characterized in that The nucleotide sequence of the amplified product in step (3) is shown in SEQ ID NO.5.

Images