Yeast strain with high yield of esterifying enzyme and application thereof

Abstract

The invention relates to a saccharomycetes strain with high yield of esterifying enzyme and application thereof, the classification name of the saccharomycetes strain is Wickerhamomyces anomalus, the saccharomycetes strain is preserved in China General Microbiological Culture Collection Center on March 21, 2025, the preservation number is CGMCC 33925, and the address of the preservation unit is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The strain screened by the invention has the ability of high yield of esterifying enzyme, and can synchronously catalyze synthesis of a plurality of key esters such as ethyl acetate, ethyl hexanoate, ethyl lactate and the like. Through the synergistic effect of polyesters, the flavor level of the liquor body is richer, and the liquor body is close to the composite aroma characteristic of the traditional solid fen-flavor liquor. The strain is naturally adapted to brewing of fen-flavor liquor and intensified application of medium and low temperature yeast, exogenous enzyme dependence is reduced, and the esterification capacity of yeast is improved.

Description

Technical Field

[0001] The invention relates to a yeast strain with high esterase production and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance some understanding of the overall background of the invention and should not be necessarily regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Baijiu (Chinese liquor) is a traditional fermented beverage in China with a history of over 2,000 years. Alcohol and water make up approximately 98% of baijiu's composition, while trace elements, comprising only 2%, are the primary flavoring and aroma components, determining its aroma, taste, and flavor. Baijiu's flavoring compounds primarily fall into four categories: acids, alcohols, esters, and aldehydes. Esters, comprising 40% to 70% of these compounds, are a key determinant of its quality and flavor. Esters in baijiu are formed through two pathways: microbial conversion of fatty acids into acetic acid and other organic acids, which then undergo esterification with ethanol to form the corresponding esters; and free organic acids undergo esterification with ethanol to form the corresponding esters. Esterases are key enzymes that catalyze esterification reactions and are often derived from esterase-producing microorganisms in koji.

[0004] Based on the type of saccharifying and fermenting agent used, light-aroma baijiu (Fenjiu) can be divided into three types: Daqu (Daqu), Xiaoqu (Xiaoqu), and Fuqu (Fuqu). Fenjiu is a typical example of the Daqu (Daqu) light-aroma type, using three types of medium-low-temperature Daqu (Qingchaqu, Hongxinqu, and Houhuoqu) as saccharifying and fermenting agents. Esters are characteristic indicators of different baijiu flavors. They are produced by the esterification reaction between corresponding organic acids and alcohols. For example, ethyl acetate, ethyl hexanoate, and ethyl lactate can all be produced through esterification reactions catalyzed by esterases. The esterification capacity of Daqu is an important technical indicator of Daqu quality, and this capacity is related to the esterases secreted by microorganisms. Esterases are important biocatalysts that promote esterification reactions during the baijiu brewing process. Therefore, the esterification capacity of Daqu is one of the key factors influencing the formation of esters in light-aroma baijiu. However, since the production of traditional Daqu mainly adopts natural fermentation technology, the microbial flora spontaneously enriches and grows, resulting in unstable quality of the finished Daqu. The esterification power of Daqu in different batches varies, which directly affects the flavor quality of the corresponding brewing batch of light-fragrance liquor.

[0005] Daqu is a saccharification and fermentation agent used in the brewing of liquor. The rich microbial community in it can secrete and produce extracellular enzymes such as saccharifying enzymes and esterifying enzymes, which play an important role in the subsequent starch saccharification and alcohol fermentation process. Among them, esterifying enzymes are a class of enzymes that catalyze the formation or hydrolysis of ester bonds. They catalyze the esterification reaction between alcohol and acid to produce ester compounds, which are important characteristic flavor and aroma components of liquor. Based on the differences in catalytic mechanisms, they are mainly divided into the following three categories: (1) Lipases: They can catalyze both ester bond hydrolysis and ester synthesis reactions in non-aqueous phases; (2) Esterases: They are more inclined to hydrolyze short-chain esters; (3) Acyltransferases: They specifically catalyze acyl transfer reactions and are widely used in the synthesis of pharmaceutical intermediates.

[0006] Ester-producing microorganisms in baijiu (white liquor) koji include bacteria and fungi. Bacteria include Pseudomonas, Bacillus, lactic acid bacteria, acetic acid bacteria, caproic acid bacteria, butyric acid bacteria, and fungi include yeast, Rhizopus, Aspergillus, Penicillium, and Mucor. Yeast is one of the most important ester-producing microorganisms. Identifying high-yielding esterase strains and applying them to baijiu production can enhance ester content and aroma, enriching the flavor. Esters are key components of baijiu's characteristic flavor, and their content and proportion directly influence the aroma, taste, and quality. Esterases, as biocatalysts, accelerate the esterification reaction between acids and alcohols, producing flavor compounds such as ethyl acetate, ethyl hexanoate, and ethyl lactate. Traditional daqu production relies on naturally enriched microorganisms, but due to the instability of the microbial community, the esterification capacity (the ability to catalyze ester synthesis per unit time) fluctuates significantly, affecting the flavor consistency between baijiu batches. Traditional daqu production requires long cultivation periods, and the microbial community forms spontaneously, which is easily affected by environmental factors, resulting in significant variability in esterification capacity between batches. Light-fragrance liquors are often produced using solid-state fermentation. This results in uneven distribution of acids, alcohols, and esters in the mash, leading to low esterification efficiency and reliance on highly active esterases to boost the reaction rate. High-end light-fragrance liquors require stringent ester content and ratios, making traditional processes difficult to meet these quality stability requirements. Therefore, it is crucial to screen high-yield esterase strains adapted to solid-state fermentation conditions from specific brewing environments (such as the mash of Daqu light-fragrance liquor) to enhance Daqu esterification and stabilize the liquor's flavor.

[0007] The existing implementation scheme that is most similar to the present invention is the screening and application of high-yield esterase strains:

[0008] (1) Monascus strain: From the published paper "Study on the application of crude Monascus esterification enzyme preparation in the production of Luzhou-flavor Qingjiu Daqu", Wang Xiaodan et al. screened out the purple Monascus (Monascus purpureus) FBKL3.0018 with high esterase production from Luzhou-flavor Daqu. Its crude lipase enzyme solution can increase the content of ethyl hexanoate in the finished wine, thereby improving the wine quality and yield.

[0009] (2) Rhizopus strain: From the published paper "Study on the esterification conditions of ethyl hexanoate by Rhizopus esterifying bacteria CS825", Lai Dengyan et al. studied the esterification conditions of ethyl hexanoate catalyzed by Rhizopus CS825. The esterification rate in the solvent-free system reached more than 70%, which is suitable for liquor production.

[0010] (3) Antarctic Candida: From the paper “Effect of Antarctic Candida Lipase B Treatment on the Esterification of Organic Acids in Liquor Waste Grains”, Sun Hailong et al. optimized the application conditions of Antarctic Candida Lipase B and increased the concentrations of ethyl acetate and ethyl lactate in the waste grains to above 110 mg / 100 mL.

[0011] The above strains are mostly targeted at the production of strong-flavor liquor, liquid fermentation or Xiaoqu, and have not been screened for adaptability to the solid-state fermentation environment of Daqu and light-flavor liquor.

[0012] Genetic engineering to improve ester synthesis capacity:

[0013] (1) Overexpression of alcohol acetyltransferase: Overexpression of the ATF1 gene can significantly increase the ethyl acetate production of Saccharomyces cerevisiae.

[0014] (2) Metabolic pathway optimization: Knocking out competitive metabolic pathway genes (such as BAT2) or overexpressing fatty acid synthesis-related genes (such as ACCI and FAS) can improve the synthesis efficiency of flavor substances such as ethyl hexanoate.

[0015] Genetically modified strains must pass biosafety assessments, and the cost of industrial application is high.

[0016] Comparative analysis of existing patents:

[0017] Patent 1: "New strain of abnormal Wickham yeast and its isolation and screening method and application" (application number: 202410562014.6). The abnormal Wickham yeast strain in this patent is screened from Xiaoqu and is suitable for liquid fermentation of Xiaoqu light-fragrance liquor; it has the ability to produce high ethyl acetate and enhance the flavor of Xiaoqu liquor through liquid fermentation, but is not suitable for Daqu production and light-fragrance liquor solid fermentation environment.

[0018] Patent 2: "An esterase-producing strain and a method for preparing esterase using an esterase-producing strain" (CN202310852331.7). The strain in this patent is isolated from high-temperature Daqu and is a bacterium that synthesizes ethyl hexanoate. This patent focuses on increasing the yield of ethyl hexanoate, but does not specify the catalytic ability of multiple esters. It is suitable for liquid fermentation or Daqu production and optimizes the flavor of liquor. The strain is tropical Bacillus, which is mainly used for the synthesis of ethyl hexanoate. Its application scenarios are more limited. The content of ethyl hexanoate in light-fragrance liquor is very low, while ethyl acetate is the typical flavor substance of light-fragrance liquor. Therefore, this patent is not suitable for light-fragrance liquor.

[0019] Disadvantages of existing solutions:

[0020] (1) Insufficient strain adaptability

[0021] The existing patented strains have not been targeted for the solid-state fermentation environment and medium-low temperature Daqu of light-fragrance liquor. The existing patented strains are more suitable for the high-temperature Daqu fermentation environment of liquid or small-qu light-fragrance or mixed-fragrance liquor.

[0022] (2) Different products

[0023] Existing patented strains focus on the synthesis of single esters (ethyl acetate, ethyl hexanoate), ignoring the interactions between other key esters in baijiu flavor (such as ethyl acetate and ethyl octanoate). This can result in a single flavor profile, making it difficult to meet the complex aroma requirements of light-flavor baijiu. Summary of the Invention

[0024] In view of the deficiencies in the prior art, the technical problem to be solved by the present invention is that the esterification power of Daqu is not high and the content of ester substances in the liquor is unstable. The present invention screens strains with high esterification enzyme production from the mash of Daqu light-fragrance liquor, and adopts ultraviolet mutagenesis to screen high-esterification enzyme strains in a targeted manner, ensuring that they are naturally adapted to the solid-state fermentation environment, improving enzyme production stability and catalytic efficiency, and solving the problem of low esterification power of existing strains under solid-state conditions. By screening strains with multi-ester catalytic ability, ethyl acetate, ethyl octanoate and other esters in light-fragrance liquor are simultaneously improved to form a complex aroma, meeting the demand of light-fragrance liquor for flavor levels. By improving the esterification enzyme production capacity of Daqu itself and reducing dependence on exogenous enzymes, the liquor brewing process is made more controllable, the flavor stability between batches is higher, and the quality upgrade of light-fragrance liquor is promoted.

[0025] The technical solution adopted in the present invention is as follows:

[0026] In a first aspect of the present invention, a strain of abnormal Wickerham yeast YC-JP302 is provided. The strain is classified as abnormal Wickerham yeast (Wickerhamomyces anomalus), deposited in the China General Microbiological Culture Collection on March 21, 2025, with the deposit number: CGMCC 33925, and the depository address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0027] In a second aspect of the present invention, a microbial mixture is provided, characterized by comprising at least the strain of the present invention. The microbial mixture may comprise other esterase-producing strains and microorganisms that coexist with the strain of the present invention.

[0028] In a third aspect of the present invention, a product comprising the strain of the present invention or the microbial mixture of the present invention is provided. The product may be a bacterial agent, a bacterial fertilizer or a composition.

[0029] Preferably, the product includes a carrier; the carrier may be a solid carrier or a liquid carrier. The solid carrier or liquid carrier is a conventional carrier material, wherein the solid carrier may be selected from clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica, corn flour, soybean flour, polyvinyl alcohol and / or polyglycol; the liquid carrier may be vegetable oil, mineral oil or water.

[0030] Preferably, the product is in powder form, solution form, suspension form, tablet form, granule form or other forms.

[0031] Further preferably, the powder form may be a freeze-dried powder form; and the tablet form may be a tablet form containing the freeze-dried powder and optional nutrients (such as vitamins, mineral salts, etc.).

[0032] The active ingredient of the product is abnormal Wickham yeast, which can be present in the form of cultured living cells, fermentation broth of living cells, filtrate of cell culture or a mixture of cells and filtrate.

[0033] In a fourth aspect of the present invention, a fermentation broth comprising anomalous Wickham yeast is provided.

[0034] In a fifth aspect of the present invention, a fermentation method of the abnormal Wickham yeast is provided, which comprises inoculating the abnormal Wickham yeast into a fermentation medium and performing fermentation culture.

[0035] In a sixth aspect of the present invention, there is provided a strain of the present invention, a microbial mixture of the present invention, a product comprising the strain or the microbial mixture, or a fermentation broth of the present invention for high production of esterase in Daqu solid-state fermentation.

[0036] In a seventh aspect of the present invention, a method for improving the esterification activity of Daqu is provided, which comprises the step of fermenting solid Daqu using the strain of the present invention, the microbial mixture of the present invention, or the product of the present invention comprising the above strain or the above microbial mixture.

[0037] The specific method includes: inoculating the strain of the present invention, the microbial mixture of the present invention, or the present invention containing the above strains or the above microbial mixture into the Daqu raw material, mixing and pressing into shape, spreading rice bran on the ground before the koji is brought into the room, and then carrying out the steps of mold application and drying, damp fire and high fire, post-fire and koji cultivation.

[0038] The process of the present invention selects yeast with higher-than-average esterase activity. The high-esterase-yielding yeast selected by mutagenesis can more effectively improve the esterification capacity of Daqu. The inoculation amount conforms to the yeast inoculation range (5%-20% w / w) and is the optimal inoculation amount. The temperature, ventilation conditions and culture time are taken into consideration according to the characteristics of the yeast to maximize its esterase synthesis capacity.

[0039] A yeast strain with high esterase production was screened from the mash of Daqu-flavor liquor and selectively bred using ultraviolet mutagenesis to improve the strain's esterase production ability. After ultraviolet mutagenesis, the strain's esterase activity increased from 48 U / mL to 108 U / mL, an increase of 125%. The present invention further catalyzes the synthesis of ethyl acetate, ethyl octanoate, and other esters, enhancing the layered flavor and complex aroma of the wine through the synergistic effect of multiple esters.

[0040] Compared with the related art known to the inventors, one of the technical solutions of the present invention has the following beneficial effects:

[0041] (1) In the existing technology, most strains are derived from liquid fermentation environments or high-temperature Daqu, which are not suitable for the solid-state fermentation process of light-fragrance liquor and the production of medium- and low-temperature Daqu.

[0042] The invention directionally screens yeast strains from the mash of Daqu light-fragrance liquor, which are native microorganisms and naturally suitable for the solid-state fermentation conditions of light-fragrance liquor and the production of medium-low temperature Daqu.

[0043] (2) Existing technologies focus on the synthesis of single esters (such as ethyl acetate and ethyl hexanoate), ignoring the synergistic effects of other key esters in the flavor of liquor (such as ethyl acetate and ethyl octanoate).

[0044] The strains screened by the present invention have the ability to produce high levels of esterification enzymes and can simultaneously catalyze the synthesis of ethyl acetate and other esters besides the main esters. Through the synergistic effect of multiple esters, the wine has richer flavor layers, closer to the complex aroma characteristics of traditional solid-state light-fragrance liquors. Other exogenous strains have the ability to produce high levels of single ester substances, which will change the proportion of ester substances in light-fragrance liquors. However, the strains of the present invention are naturally adapted to the brewing of light-fragrance liquors and the enhanced application of medium- and low-temperature Daqu. They do not change the flavor of light-fragrance liquors, reduce dependence on exogenous enzymes, and enhance the esterification power of Daqu. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The accompanying drawings, which constitute a part of the specification of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0046] Figure 1 :Yeast esterase activity.

[0047] Figure 2 : Abnormal colony morphology of Wickham yeast YC-JP320.

[0048] Figure 3 : Microscopic cell morphology of abnormal Wickham yeast YC-JP320 (400×).

[0049] Figure 4 : Phylogenetic tree of Wickhamella anomala YC-JP320.

[0050] Figure 5 : Growth curve of aberrant Wickham yeast YC-JP320.

[0051] Figure 6 : Acid resistance of abnormal Wickham yeast YC-JP320.

[0052] Figure 7 : Ethanol tolerance of abnormal Wickham yeast YC-JP320.

[0053] Figure 8 : Esterase activity of original strain and induced strain.

[0054] Figure 9 : HS-SPME-GC-MS chromatogram of volatile components of Wickhamella anomala YC-JP320. DETAILED DESCRIPTION

[0055] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0056] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations and / or combinations thereof.

[0057] In order to solve the key technical problem of improving the esterification capacity of Daqu in the brewing process of light-fragrance liquor, the present invention successfully screened a yeast with a high esterase production ability from the mash in the brewing process of Daqu light-fragrance liquor, and carried out screening, identification, mutagenesis and preservation. Compared with the reported literature, the esterase activity of the yeast of the present invention is higher than the esterase activity in many literatures, such as the esterase activity of 11.38U / mL reported in "Isolation, Identification and Production Characteristics Analysis of Yeast in the Brewing System of Light-fragrance Liquor" (Du Aiming et al.), the enzyme activity of 13.73U / mL in "Screening, Identification and Composite Mutagenesis Breeding of High-yielding Esterase Bacteria" (Tang Xiujuan et al.), and the esterase activity of 5.62U / mL reported by Cao Xinzhi et al. in "Isolation, Screening and Optimization of Fermentation Conditions of Esterase-producing Molds in Daqu".

[0058] The yeast YC-JP320 of the present invention is screened from the mash of light-fragrance liquor. It is different from the exogenous microorganisms in existing patents. Since microorganisms are very sensitive to growth environment conditions, exogenous microorganisms are not suitable for the production environment of light-fragrance liquor. The yeast YC-JP320 of the present invention is an "original" microorganism from the brewing of light-fragrance liquor. It is an "indigenous" functional microorganism that cannot be replaced by the exogenous microorganisms in other patents. Therefore, the yeast of the present invention has a natural adaptability to environmental factors such as geography, temperature and pH in the brewing of light-fragrance liquor, and will not produce other unknown metabolites, which will affect the taste of light-fragrance liquor. At the same time, the yeast of the present invention has the ability to secrete esterase with high enzyme activity. Esterase is a key enzyme that catalyzes the esterification reaction between ethanol and organic acid, and can promote the production of various ester substances in light-fragrance liquor.

[0059] The application of esterase-producing yeast is intended to improve the efficiency of the esterification reaction that promotes the production of ester substances during the fermentation process, enhance the esterification power of Daqu, and increase the content of ester substances in the liquor products, thereby improving the flavor and quality of the light-fragrance liquor.

[0060] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0061] The culture medium used in the following examples is as follows:

[0062] YPD solid medium: yeast extract powder (10 g / L), peptone (20 g / L), glucose (20 g / L), agar powder (20 g / L).

[0063] YPD liquid medium: yeast extract powder (10 g / L), peptone (20 g / L), glucose (20 g / L).

[0064] Fermentation medium: peptone (10 g / L), glucose (10 g / L), K2HPO4 (1 g / L), MgSO4 (0.5 g / L), FeSO4 (0.01 g / L), KCl (0.5 g / L), MnSO4 (0.3 g / L)

[0065] Example 1: Screening of high-yielding esterase yeast strains

[0066] 1. Isolation, Screening, and Mutagenesis of Abnormal Wickham Yeast YC-JP320

[0067] (1) Initial screening of yeast

[0068] A natural yeast strain was isolated and screened from the fermented grains of Daqu-flavor liquor. The esterase activity of the screened yeast was determined.

[0069] S1. Take 10 g of the fermented grains of the light-flavor liquor and add them to a 250 mL conical flask with 90 mL of sterile water. Shake on a shaker at 30 °C and 180 r / min for 20 min. Take 1 mL of the bacterial suspension and 9 mL of sterile water for gradient dilution. -3 ~10 -6 Pathway dilution was performed and the cells were separated and cultured in a 30°C incubator for 2 to 3 days.

[0070] S2. Isolate and purify the colonies on the plate by the plate streak method to obtain single bacteria, inoculate them into liquid culture medium and preserve them with glycerol.

[0071] (2) Yeast esterase activity determination

[0072] S1. Activate the obtained yeast on a plate and inoculate it into YPD liquid medium, incubate at 30°C, 180 rpm, and culture for 12 hours to obtain seed solution. Inoculate the seed solution into fermentation medium at a 10% inoculum rate, incubate at 30°C, 180 rpm, and culture for 2 days.

[0073] S2. Centrifuge the resulting fermentation broth at 6000 rpm for 20 min at 4°C to remove the precipitate. Take the supernatant as the crude enzyme solution and store it in a refrigerator at 4°C.

[0074] S3. Place 12.4 mL of acetic acid, 6.2 mL of ethanol, 20 mL of cyclohexane, and 0.4 mL of enzyme solution in a stoppered conical flask. Esterify in a 30°C incubator for 1 day. Pipette 0.5 mL of the supernatant of the esterified liquid, add 10 mL of water as the test solution, add 2-3 drops of phenolphthalein, and titrate with sodium hydroxide. Calculate the amount of enzyme required to consume 1 micromole of acetic acid per minute as 1 enzyme activity unit. Finally, measure the esterification enzyme activity. The highest esterification enzyme activity of abnormal Wickham yeast is 48 U / mL ( Figure 1 ).

[0075] S4. Inoculate the abnormal Wickham yeast into yeast culture medium (containing 2% glucose, 1% yeast extract, 0.2% KH2PO4, 0.1% MgSO4, pH 5.5).

[0076] In the logarithmic growth phase (OD 600 ≈0.8) to collect the bacteria and prepare a single-cell suspension. 15 mL of the bacterial suspension was placed in a sterilized, empty plate and placed in a clean bench.

[0077] Under dark conditions, at a distance of 50 cm from the UV lamp, use UV lamp (254 nm) to irradiate for 30 to 180 seconds for mutagenesis, and repair in the dark for 2 hours.

[0078] After the mutagenesis, the bacterial suspension was serially diluted 10 -4 ~10 -6 The strains were then plated on a screening medium (YPD solid medium) to screen for mutants with obvious color circles. The esterase activity of the mutants was then measured to screen for strains with significantly improved enzyme activity.

[0079] After UV mutagenesis, a mutant strain (Wickerhamomyces anomalus YC-JP320) was screened out with an enzyme activity increased by 125%, which was significantly higher than the original strain ( Figure 8 ).

[0080] 2. Identification of Abnormal Wickham Yeast YC-JP320

[0081] (1) Morphological identification

[0082] The colony morphology was observed to be milky white, indicating moistness, uniform texture, protrusions, and easy to pick up ( Figure 2 After staining with crystal violet, the microscopic results showed that the bacteria were ellipsoidal and three-dimensional ( Figure 3 ).

[0083] (2) Molecular biological identification

[0084] S1. Take fresh yeast culture medium in the exponential growth phase obtained by mutagenesis screening, collect the cells by centrifugation, and extract genomic DNA;

[0085] S2. The obtained genomic DNA was amplified by PCR, and the PCR products were separated and tested by 1% agarose gel electrophoresis for 35 minutes. The gel was observed and then sent for testing;

[0086] S3. The primers are universal primers ITS1 and ITS4.

[0087] ITS1 5′-TCCGTAGGTGAACCTGCGC-3′, as shown in SEQ ID NO: 2;

[0088] ITS4 5'-TCCTCCGCTTATTGATATGC-3', as shown in SEQ ID NO: 3; Error! No bookmarkname given.Error! No bookmark name given.

[0089] S4, amplification procedure:

[0090]

[0091] The amplified product was sent to Sangon Sequencing Co., Ltd. for gene sequencing. The sequencing result is shown in SEQ ID NO: 1. Then the product was submitted to the National Center for Biotechnology Information (NCBI) database for sequence alignment using the Basic local alignment search tool (BLAST) to draw a phylogenetic tree ( Figure 4 ).

[0092] Strain YC-JP320 was identified as abnormal Wickham yeast through morphology and molecular biology, and was classified and named Wickerhamomyces anomalus. It was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on March 21, 2025, with the deposit number CGMCC No.33925.

[0093] The ITS sequence of Wickerhamomyces anomalus YC-JP320 is shown in SEQ ID NO: 1:

[0094] SEQ ID NO: 1: ITS rDNA sequence of the abnormal Wickham yeast YC-JP320

[0095] GTGGCTTTAGATTCTATTGCCAGCGCTTATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGCATCAGCCTAGCTGCGTGCCCAAAGGTCTAAACACATTTTTTTAATGTTAAAACCTTTAACCA ATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACAT TGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAA TGTATTAGGTTCTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCCGGGAGGAAAAGGA

[0096] Example 2: Tolerance analysis of strain YC-JP320

[0097] 1. Growth curve

[0098] Inoculate the activated strain YC-JP320 into YPD liquid medium at a 2% inoculum size and incubate at 30°C and 180 rpm. Take 1 mL of the culture every 2 hours and dilute it appropriately. Measure the OD value at 600 nm using a visible light spectrophotometer. Plot a growth curve with time as the horizontal axis and the OD value at 600 nm as the vertical axis.

[0099] The results are as follows Figure 5 It can be seen that the strain is in the logarithmic growth phase from 0 to 10 hours, in the stable growth phase from 10 to 30 hours, and tends to grow steadily thereafter.

[0100] 2. Acidity tolerance

[0101] The activated strain YC-JP320 bacterial liquid was inoculated into sterilized 50mL YPD liquid culture medium at an inoculum size of 1%. The pH of the culture medium (adjusted with glacial acetic acid solution) was 1, 2, 3, 4, 5, and 6, respectively. After shaking culture at 30°C and 180 r / min for 24 hours, the OD value of the bacterial liquid at a wavelength of 600 nm was measured to determine the acid resistance of the strain.

[0102] The results are as follows Figure 6 As shown in the figure, the OD600 nm of the strain gradually increased at pH 3.0, and tended to be flat after pH>5.0, while the strain still had a certain growth amount at pH 1.0, indicating that the strain had strong acidity tolerance.

[0103] 3. Ethanol tolerance

[0104] The activated strain YC-JP320 bacterial liquid was inoculated into sterilized 50mL YPD liquid culture medium at an inoculum size of 1%, and the alcohol content (V / V) of the culture medium was adjusted to 2%, 4%, 6%, 8%, 10%, and 12%, respectively. After shaking culture at 30°C and 180 r / min for 24 hours, the OD value of the bacterial liquid at a wavelength of 600 nm was measured to determine the ethanol tolerance of the strain.

[0105] The results are as follows Figure 7 As shown in the figure, when the ethanol content is between 2% and 6%, the OD600 nm of the strain does not change much, and the strain grows well at this time. When the ethanol content reaches 8% to 10%, the OD600 nm drops sharply. The strain still grows to a certain extent at an alcohol concentration of 12%, but the OD600 nm does not change much at alcohol concentrations of 10% and 12%.

[0106] Example 3: Determination of volatile compounds in high-yield esterase yeast

[0107] The activated strain YC-JP320 was inoculated into the fermentation medium and fermented at 30°C and 180 rpm for 48 h. The fermentation broth was centrifuged (6000 rpm, 20 min), and 4 mL of the fermentation broth was taken into a 20 mL headspace bottle. 1 g of NaCl and 1 μL of 2-octanol were added. After sample pretreatment, the volatile compounds in the abnormal Wickham yeast were determined by HS-SPME-GC-MS (Table 1 and Figure 9 ).

[0108] Table 1 Determination results of yeast volatile flavor substances

[0109]

[0110]

[0111] Table 1 shows that the fermentation process produces a variety of flavor compounds, including ethyl acetate, ethyl octanoate, phenylethanol, 3-methylbutyric acid, hexanal, and phenylacetaldehyde. These volatile compounds impart distinct flavors to the baijiu. Among the esters, ethyl octanoate, while not as abundant as ethyl acetate, contributes to the unique fruity and brandy-like aromas that characterize the baijiu. 2,2,4-Trimethyl-1,3-pentanediol diisobutyrate, at 0.001 μg / mL, is a trace flavor component naturally produced by microbial metabolism and is present at extremely low levels in the baijiu aroma. 3,5-Dimethylbenzaldehyde is used in perfumes and fragrances. 6-Methyl-5-hepten-2-one, with its fruity and fresh aroma, is used in various essential oils and spices. The production of these flavor compounds contributes to the strain's unique aroma, which holds great promise for its future applications in baijiu.

[0112] Example 4: Daqu strengthening experiment

[0113] The strain YC-JP320 was inoculated into yeast culture medium (containing 2% glucose, 1% yeast extract, 0.2% KH2PO4, 0.1% MgSO4, pH 5.5) and cultured until the logarithmic growth phase (OD 600 ≈0.8) to collect the bacterial liquid, add the bacterial liquid to the Daqu raw material (wheat: pea = 7:3, mass ratio) at an inoculum rate of 15% (150 mL of bacterial liquid per 1 kg of Daqu raw material), mix and press into shape, and spread rice bran on the ground before the koji is put into the room.

[0114] (1) Mildew and air-drying:

[0115] Small white spots will appear on the surface of the koji block within 2 to 4 days. The room temperature should be maintained at 20 to 40 degrees Celsius, and the product temperature should be 36 to 38 degrees Celsius.

[0116] During the drying and mold stage, the distance between the koji blocks needs to be increased to prevent them from becoming sticky. Generally, the koji should be turned over every other day.

[0117] (2) Tidal fire and big fire:

[0118] The damp and hot period is the peak period for microbial reproduction, and the product temperature can reach 45-48℃. It is necessary to open windows flexibly to release moisture and turn the product over many times.

[0119] During the fire period, the internal moisture of the koji blocks decreased, and the product temperature was controlled at 43-44°C, and gradually dropped to 29-32°C in the later period.

[0120] (3) Post-fire and nourishing koji:

[0121] During the post-fire stage, the product temperature drops to 37-38°C. During the koji cultivation stage, the temperature is maintained at a constant level. The koji blocks are then stored for three to six months to become aged. The cultivation conditions are controlled at a temperature of 20-40°C and a humidity of 80%. The production cycle for Daqu is approximately 28 days.

[0122] The esterification capacity was determined using the QBT4257-2011 general analytical method for brewing Daqu.

[0123] The esterification capacity of Daqu with added yeast was measured, and the esterification enzyme activity of Daqu reached 84U / g, which was 40% higher than that of traditional Daqu, as shown in Table 2.

[0124] Table 2 Comparison of esterification capacity of medium and low temperature Daqu before and after adding yeast

[0125]

[0126] The control yeast was Hansenula anomala CGMCC2.3034, which has the ability to produce esters.

[0127] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. An abnormal Wickham yeast strain YC-JP302, characterized in that: The strain was classified and named as Wickerhamomyces anomalus and was deposited in the China General Microorganism Culture Collection on March 21, 2025 with the deposit number: CGMCC 33925. The deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. A microbial mixture, characterized in that: The microbial mixture comprises at least the strain according to claim 1.

3. A product comprising the anomalous Wickham yeast YC-JP302 according to claim 1 or the microbial mixture according to claim 2.

4. The product according to claim 3, characterized in that The product is in the form of powder, solution, suspension, tablet, granule or other forms. A fermentation broth comprising the strain according to claim 1 .

6. A fermentation method of the abnormal Wickham yeast YC-JP302 according to claim 1, characterized in that: The abnormal Wickham yeast is inoculated into a fermentation medium for fermentation culture to obtain the product.

7. Use of the abnormal Wickham yeast YC-JP302 according to claim 1, the microbial mixture according to claim 2, the product according to claim 3, or the fermentation liquid according to claim 5 for high production of esterase in Daqu solid-state fermentation.

8. A method for improving the activity of Daqu esterification enzyme, characterized in that: The method comprises the steps of fermenting solid-state Daqu using the abnormal Wickham yeast YC-JP302 according to claim 1, the microbial mixture according to claim 2 or the product according to claim 3.

9. The method for improving the activity of Daqu esterifying enzyme as claimed in claim 8, characterized in that: The specific method includes: inoculating the strain described in claim 1, the microbial mixture described in claim 2 or the product described in claim 3 into the Daqu raw material, mixing and pressing into shape, spreading rice bran on the ground before the koji is brought into the room, and then carrying out the steps of mold application and drying, damp fire and high fire, post-fire and koji cultivation.

Images