Gene ZmPAP26 for regulating and controlling drought resistance of corn and application of gene ZmPAP26

Abstract

The invention discloses a gene ZmPAP26 for regulating and controlling drought resistance of corn and application of the gene ZmPAP26, the nucleotide sequence of cDNA of the gene ZmPAP26 is shown as SEQ ID NO: 1, and the nucleotide sequence of CDS of the gene ZmPAP26 is shown as SEQ ID NO: 2. The corn drought-resistant gene ZmPAP26 structure is destroyed by utilizing a mutagenesis technology, the survival rate of a mutant plant under drought is remarkably improved, and the ZmPAP26 mutant shows a phenotype of plant height reduction in a field environment. The results show that the ZmPAP26 can be used for improving the drought resistance of crops.

Description

Technical Field

[0001] The present invention relates to the technical field of corn genetic engineering, and in particular to a gene ZmPAP26 for regulating corn drought resistance and an application thereof. Background Art

[0002] Maize (Zea may L.) is a cross-pollinated, annual grass plant. It is an important food crop, feed, and industrial raw material. In my country, maize cultivation has surpassed rice in area, becoming the country's leading food crop. In-depth research on the genetics and molecular mechanisms of drought resistance in maize, identifying and cloning key drought-resistant genes, and combining plant genetic engineering with traditional breeding can accelerate the development of drought-resistant varieties. This is of great significance for ensuring national food security.

[0003] Purple acid phosphatases (PAPs) are a class of metallophosphatases widely found in higher plants. Under weakly acidic conditions, they hydrolyze a variety of organic phosphorus substrates into inorganic phosphorus that can be absorbed and utilized by the plant. Plant PAPs can be divided into intracellular and secreted acid phosphatases based on their area of action. The former hydrolyzes phosphorus from the plant's internal phosphorus pool, while the latter is secreted into the soil and participates in the degradation of organic phosphorus and active substances in the soil. Recent studies have shown that in addition to participating in plant phosphorus metabolism, PAPs are also widely involved in processes such as reactive oxygen species regulation, carbon metabolism control, cell wall synthesis, leaf senescence, disease resistance, and stress tolerance. However, whether and how PAPs participate in plant drought response remains largely unknown. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a gene ZmPAP26 for regulating drought resistance in maize and its application. The gene belongs to the PAP protein family and can regulate plant drought resistance.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides a gene ZmPAP26 for regulating drought resistance of maize. The nucleotide sequence of the cDNA of the gene ZmPAP26 is shown in SEQ ID NO: 1.

[0007] The nucleotide sequence of the CDS of the above gene ZmPAP26 is shown in SEQ ID NO:2.

[0008] The present invention also provides a purple acid phosphatase ZmPAP encoded by the gene ZmPAP26. The amino acid sequence of the purple acid phosphatase ZmPAP is shown in SEQ ID NO: 3.

[0009] It should be understood that those skilled in the art can, based on the amino acid sequence disclosed herein, substitute, delete, and / or add one or more amino acids to the amino acid sequence without affecting the activity of the protein, thereby obtaining mutant sequences of the protein with at least 90% homology upon protein sequence alignment. Therefore, the present invention also includes derivative proteins with high homology and activity obtained by substituting, deleting, and / or adding one or more amino acids to the amino acid sequence of SEQ ID No. 3.

[0010] The present invention includes nucleotide sequences encoding the above-mentioned proteins.

[0011] In addition, it should be understood that, in view of the codon degeneracy and species-specific codon preferences, those skilled in the art can use codons suitable for expression in a specific species as needed.

[0012] The present invention also provides a method for constructing a maize zmpap26 mutant, comprising the following steps:

[0013] 1) The EMS3-08dffa material (this variety contains the pap26 mutation site. The mutation site is located at position 2358 of SEQ1 and position 415 of SEQ2. When the sequence of this site is T, the material is a mutant, and when the sequence of this site is C, the material is wild-type) from the maize EMS mutant library (http: / / maizeems.qlnu.edu.cn / ) was backcrossed for three generations with the maize variety B73 to obtain BC3 plants;

[0014] 2) BC3 plants were self-pollinated to obtain four maize mutant families, namely zmpap26-1, zmpap26-2, zmpap26-3 and zmpap26-4.

[0015] The present invention also provides a primer pair zmpap26-F / R for identifying a maize zmpap26 mutant. The primer pair zmpap26-F / R:

[0016] ZmPAP26-F:GTATGCACATGTTGAATTGACCACGGAA,

[0017] ZmPAP26-R:GCTAGGCTAGGGGTTGAAGAGGTCCAAC.

[0018] The present invention also provides a kit for identifying a maize zmpap26 mutant, which comprises the above primer pair.

[0019] The present invention also provides an application of the above-mentioned primer pair zmpap26-F / R or the above-mentioned kit in identifying whether a corresponding mutation occurs at the pap26 site of the gene ZmPAP26 in a corn variety. The application method comprises extracting the genome of the corn sample to be tested; performing PCR amplification and electrophoresis; and performing Sanger sequencing to detect whether a corresponding mutation occurs at the pap26 site.

[0020] The present invention also provides a method for identifying a maize zmpap26 mutant, comprising the following steps:

[0021] 1) Extracting the genome of the corn sample to be tested;

[0022] 2) Perform PCR amplification and electrophoresis using the above primer pairs or the above kit; and perform Sanger sequencing to detect whether the corresponding mutation occurs at the pap26 site, thereby determining:

[0023] When the pap26 site has a corresponding mutation, the corn sample to be tested is a corn zmpap26 mutant;

[0024] When no corresponding mutation occurs at the pap26 site, the corn sample to be tested is wild type.

[0025] The present invention also provides an application of the gene ZmPAP26 in improving the drought resistance of crops.

[0026] Furthermore, the crop is corn.

[0027] The present invention also provides an application of the base mutation of the gene ZmPAP26 in constructing a maize zmpap26 mutant.

[0028] Beneficial effects of the present invention:

[0029] The present invention uses mutagenesis to disrupt the structure of the maize drought-resistant gene ZmPAP26. The mutant plants have significantly improved survival rates under drought conditions. In field conditions, ZmPAP26 mutants exhibit a reduced plant height phenotype. These results suggest that ZmPAP26 can be used to improve crop drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the acquisition and identification of ZmPAP26 mutants;

[0031] Figure 2 Schematic diagram of the drought resistance phenotype analysis of the ZmPAP26 mutant;

[0032] Figure 3 Schematic diagram of the changes in flowering period and plant height of the ZmPAP26 mutant in the field;

[0033] In the figure, ZmPAP26 mut -1#、ZmPAP26 mut -2#、ZmPAP26 mut -3# and ZmPAP26 mut -4# are ZmPAP26 mutants zmpap26-1, zmpap26-2, zmpap26-3 and zmpap26-4, and WT is the wild-type plant. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.

[0035] Example 1 Obtaining the gene ZmPAP26 that regulates corn salt tolerance

[0036] Extract the genome of corn variety B73 and design primer pairs:

[0037] ZmPAP26-KZ-F:CCAAACTGACTGATTGTCTG,

[0038] ZmPAP26-KZ-R:CACCAGCAAACCAACGAGAT;

[0039] PCR amplification was performed, and gene fragments were obtained by sequencing. After comparison, the gene regulating maize salt tolerance was named gene ZmPAP26. The nucleotide sequence of the cDNA of the gene ZmPAP26 is shown in SEQ ID NO: 1; the nucleotide sequence of its CDS is shown in SEQ ID NO: 2, and the amino acid sequence of the purple acid phosphatase ZmPAP encoded by the gene ZmPAP26 is shown in SEQ ID NO: 3.

[0040] Example 2 Obtaining and Identifying Maize ZmPAP26 Mutants

[0041] 1) The EMS3-08dffa material (this variety contains the pap26 mutation site. The mutation site is located at position 2358 of SEQ1 and position 415 of SEQ2. When the sequence of this site is T, the material is a mutant, and when the sequence of this site is C, the material is wild-type) from the maize EMS mutant library (http: / / maizeems.qlnu.edu.cn / ) was backcrossed for three generations with the maize variety B73 to obtain BC3 plants;

[0042] 2) BC3 plants were self-pollinated to obtain four maize mutant families, namely zmpap26-1, zmpap26-2, zmpap26-3 and zmpap26-4 ( Figure 1 ).

[0043] A primer pair zmpap26-F / R was designed to simultaneously amplify pap26 variant sites, specifically:

[0044] ZmPAP26-F: GTATGCACATGTTGAATTGACCACGGAA, as shown in SEQ ID NO: 4;

[0045] ZmPAP26-R: GCTAGGCTAGGGGTTGAAGAGGTCCAAC; as shown in SEQ ID NO: 5.

[0046] The above primers were used to identify the zmpap26-F / R material in each generation (the screening requirements were: heterozygous plants were selected in the BC1-BC3 generations, and homozygous mutant plants were selected in the BC3F2 generation). The specific method is as follows:

[0047] First, PCR amplification is followed by Sanger sequencing to detect whether the target mutation occurs at the corresponding site.

[0048] Example 3 Analysis of drought resistance phenotype of ZmPAP26 mutant

[0049] This example tests the drought resistance of zmpap26-1, zmpap26-2 and negative isolates at the seedling stage. 0.1L pots were filled with equal amounts of substrate (peat: vermiculite = 7:3), and four mutant or wild-type B73 plants were planted in each pot. The plants were grown in a growth room at a temperature of 22-26°C, with a circadian rhythm of 16h sunlight / 8h darkness. When the plants grew to three leaves and one heart, watering was stopped and drought treatment began. After 15 days of drought, the plants showed obvious leaf curling, and rewatering was carried out at this time. The survival rate of the plants was measured 6 days after rewatering. The ZmPAP26 mutant had a higher survival rate than the wild-type plants, indicating that the ZmPAP26 mutation had stronger drought resistance ( Figure 2 ).

[0050] Example 4 Identification of ZmPAP26 mutant phenotypes in the field

[0051] Mutants zmpap26-1 to zmpap26-4 and isolated wild-type plants were planted in the field at a planting density of 4,500 plants per mu. After normal growth to flowering, the flowering period and plant height of plants with different backgrounds were investigated. It was found that the zmpap26 mutant flowered earlier and had a lower plant height. This suggests that the zmpap26 mutation can change the plant height and growth period of corn, and has potential application value in high-yield corn breeding. Figure 3 ).

[0052] Example 5 Kit for Identifying Maize ZmPAP26 Mutants

[0053] A kit for identifying maize ZmPAP26 mutants was constructed based on the primer pair of Example 2. The kit includes the primer pair:

[0054] ZmPAP26-F:GTATGCACATGTTGAATTGACCACGGAA,

[0055] ZmPAP26-R:GCTAGGCTAGGGGTTGAAGAGGTCCAAC.

[0056] The method for identifying a maize zmpap26 mutant using the above kit comprises the following steps:

[0057] 1) Extracting the genome of the corn sample to be tested;

[0058] 2) using the primer pair of claim 5 or the kit of claim 6 to perform PCR amplification and electrophoresis; and performing Sanger sequencing to detect whether a corresponding mutation occurs when the pap26 site sequence mutates from C to T, thereby determining:

[0059] When the pap26 site has a corresponding mutation and the sequence is T, the corn sample to be tested is a corn zmpap26 mutant;

[0060] When there is no corresponding mutation at the pap26 site and the sequence is c, the corn sample to be tested is wild type.

[0061] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A gene ZmPAP26 for regulating drought resistance in maize, characterized by: The nucleotide sequence of the cDNA of the gene ZmPAP26 is shown in SEQ ID NO: 1, and the nucleotide sequence of its CDS is shown in SEQ ID NO:

2.

2. A purple acid phosphatase ZmPAP encoded by the gene ZmPAP26 according to claim 1, characterized in that: The amino acid sequence of the purple acid phosphatase ZmPAP is shown in SEQ ID NO:

3.

3. A method for constructing a maize zmpap26 mutant, characterized by: The following steps are involved: 1) The EMS3-08dffa material from the maize EMS mutant library was backcrossed with the maize variety B73 for three generations to obtain BC3 plants; 2) BC3 plants were self-pollinated to obtain four maize mutant families, namely zmpap26-1, zmpap26-2, zmpap26-3 and zmpap26-4.

4. A primer pair zmpap26-F / R for identifying a maize zmpap26 mutant, characterized in that: The primer pair zmpap26-F / R: ZmPAP26-F:GTATGCACATGTTGAATTGACCACGGAA, ZmPAP26-R:GCTAGGCTAGGGGTTGAAGAGGTCCAAC.

5. A kit for identifying a maize zmpap26 mutant, characterized in that: The kit comprises the primer pair according to claim 4.

6. Use of the primer pair zmpap26-F / R according to claim 4 or the kit according to claim 5 for identifying whether a corresponding mutation occurs at the pap26 site of the gene ZmPAP26 in a corn variety, the method comprising extracting the genome of a corn sample to be tested; performing PCR amplification and electrophoresis; and performing Sanger sequencing to detect whether a corresponding mutation occurs at the pap26 site.

7. A method for identifying a maize zmpap26 mutant, characterized in that: The following steps are involved: 1) Extracting the genome of the corn sample to be tested; 2) performing PCR amplification and electrophoresis using the primer pair of claim 5 or the kit of claim 6; Sanger sequencing was performed to detect whether the corresponding mutation occurred at the pap26 site, thereby determining: When the pap26 site has a corresponding mutation, the corn sample to be tested is a corn zmpap26 mutant; When no corresponding mutation occurs at the pap26 site, the corn sample to be tested is wild type.

8. Use of the gene ZmPAP26 according to claim 1 in improving the drought resistance of crops.

9. The use according to claim 8, characterized in that: The crop is corn.

10. Use of the base mutation of the gene ZmPAP26 according to claim 1 in constructing a maize zmpap26 mutant.

Images