Application of SmRab82 gene in improving salt tolerance of plants
By overexpressing the willow SmRab82 gene in plants, overexpression vectors are constructed and transformed into plants, the salt stress tolerance of plants is improved, the growth restriction caused by salinization is solved, and ecological and economic benefits are improved.
Patent Information
- Application Number
- CN202510581371.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-08-05
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Soil problems caused by salinization seriously affect the growth and survival of crops and trees, and the prior art is difficult to effectively improve the salt stress tolerance of plants.
The overexpression vector was constructed by genetic engineering using the willow SmRab82 gene to transform target plants such as willow or Arabidopsis to improve their salt stress tolerance.
It significantly improves the growth and yield of plants under salt-stressed environment, solves the problem of restricted plant growth in saline-alkali land production, and achieves the improvement of ecological and economic benefits.
Smart Images
Figure CN120424979A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of plant genetic engineering and salt tolerance improvement, and particularly relates to the application of Salix matsudana SmRab82 gene in improving plant salt tolerance. Background Art
[0002] Soil salinization is a major challenge facing global agriculture and forestry production. With climate change and intensified human activities, salinization is becoming increasingly severe, threatening the growth and survival of crops and trees. Plants respond to salt stress through a range of molecular and physiological mechanisms, including regulation of ion homeostasis, activation of antioxidant systems, osmotic regulation, and changes in gene expression.
[0003] In plant cells, the small GTPase family (Rab GTPases) acts as a key regulator of vesicle transport, participating in the response to salt stress by regulating the formation, transport, anchoring, and fusion of cell membrane vesicles. Willow, a perennial woody plant with strong salt tolerance, has extensive ecological and economic value. This invention utilizes the key role of the willow SmRab82 gene in improving salt stress tolerance and applies it to improve plant salt tolerance through genetic engineering methods. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide an application of the SmRab82 gene in improving plant salt stress tolerance, so as to solve the growth restriction problem faced by plant production in saline-alkali land and achieve improved ecological and economic benefits.
[0005] To solve the above technical problems, the present invention provides the use of the SmRab82 gene in improving plant salt stress tolerance. The nucleotide sequence of the SmRab82 gene is shown in SEQ ID NO.1.
[0006] The present invention also obtains transgenic plants with high salt stress tolerance by constructing a SmRab82 gene overexpression vector. The salt stress tolerance of the SmRab82 gene plants is specifically manifested as follows: under salt stress, the root length of the SmRab82 gene overexpressing plants is longer than that of the wild type, and the degree of leaf wilting is less than that of the wild type.
[0007] According to its function, plants tolerant to salt stress can be obtained by transgenic means. Specifically, the SmRab82 gene can be introduced into target plants to obtain transgenic plants with higher salt stress tolerance than the target plants, which are willow or Arabidopsis.
[0008] In order to improve the excellent traits of plants, the present invention also discloses a plant breeding method, which obtains plants with salt stress tolerance stronger or / and lower than that of wild plants by regulating the expression of the SmRab82 gene in the target plant. The nucleotide sequence of the SmRab82 gene is shown in SEQ ID NO.1.
[0009] The expression mode of the SmRab82 gene in the target plant is overexpression, and the target plant is willow or Arabidopsis thaliana.
[0010] The beneficial effects of the above technical solution of the present invention are as follows:
[0011] The present invention discovered the SmRab82 gene and transformed it into Arabidopsis thaliana. The results showed that compared with the wild type, the SmRab82-transfected Arabidopsis had a well-developed root system under salt stress, and the plants did not show growth retardation, leaf shrinkage, or wilting. This indicates that the SmRab82 gene can significantly improve the plant's ability to resist salt stress and promote plant root growth. Transforming it into yeast, the study showed that compared with the control group, the SmRab82-transfected yeast grew well under higher salt concentrations, which can clearly demonstrate the SmRab82 yeast's ability to survive under salt stress. These results suggest that the use of the SmRab82 gene may significantly improve plant growth and yield under salt stress environments. In the future, it may be widely used to improve the salt tolerance of crops (such as rice and wheat) and economic trees, solving the growth restriction problem faced by plant production in saline-alkali land and achieving improved ecological and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 is the expression change of SmRab82 gene under salt stress conditions;
[0013] Figure 2 The growth performance of yeast strains containing the SmRab82 gene under different salt concentrations;
[0014] Figure 3 The growth performance of Arabidopsis thaliana containing the SmRab82 gene under a salt concentration of 200 mM NaCl. DETAILED DESCRIPTION
[0015] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.
[0016] Embodiments of the present invention provide the use of the SmRab82 gene in improving plant salt stress tolerance. The nucleotide sequence of the SmRab82 gene is shown in SEQ ID NO.1. The use is to construct a SmRab82 gene overexpression vector and a biological material to obtain a plant with high salt tolerance. The biological material is a recombinant cell containing the SmRab82 gene overexpression vector. The plant has the following characteristics: improved salt stress resistance, and improved salt stress resistance relative to a reference level (the reference level is the level of the wild type). The salt stress tolerance of the SmRab82 gene plant is specifically manifested as: under salt stress, the root length of the SmRab82 gene overexpressing plant is greater than that of the wild type, and the degree of leaf wilting is less than that of the wild type.
[0017] In this embodiment, to improve plant traits, the present invention further discloses a plant breeding method, wherein the method regulates the expression of the SmRab82 gene in a target plant to obtain plants with salt stress tolerance greater than or less than that of wild plants. The nucleotide sequence of the SmRab82 gene is shown in SEQ ID NO. 1. The expression of the SmRab82 gene in the target plant is regulated by overexpression, and the target plant is willow or Arabidopsis thaliana.
[0018] The present invention will be further described below by way of examples, but the present invention is not limited to these examples.
[0019] Example 1 SmRab82 gene cloning and expression verification
[0020] (1) Preparation of materials and equipment
[0021] Plant materials: Healthy Salix matsudana plants were selected and fresh leaves were taken for RNA extraction.
[0022] Reagents: RNA extraction kit (such as TRIzol reagent, Invitrogen), DNase I (for DNA removal), cDNA synthesis kit (such as PrimeScript TM RT reagent Kit, Takara); PCR primers (specific primers for SmRab82 gene); PCR reagents (TaqDNA polymerase, dNTPs, MgCl2, etc.); agarose gel and DNA dye (such as EB dye).
[0023] (2) RNA extraction
[0024] Sample collection: Weigh approximately 1 g of healthy, disease-free leaves from Salix matsudana plants. Quickly freeze the leaves using liquid nitrogen and grind them into a fine powder to maintain RNA stability.
[0025] RNA extraction: Transfer the ground leaf powder to a centrifuge tube containing TRIzol reagent and follow the kit instructions. TRIzol reagent is effective for total RNA extraction. Mix thoroughly and centrifuge at room temperature. Transfer the supernatant to a fresh centrifuge tube and centrifuge again to remove impurities. Use chloroform for phase separation. Remove the aqueous phase and add isopropanol to precipitate the RNA. Wash the RNA pellet with 70% ethanol to remove impurities. Finally, dissolve the RNA pellet in RNase-free water. Determine RNA concentration and purity (using a NanoDrop or other spectrophotometer; the A260 / A280 ratio should be 1.8-2.0).
[0026] RNA quality check: Use agarose gel electrophoresis to check RNA integrity and ensure no degradation. Measure RNA concentration using a spectrophotometer to ensure sufficient RNA for subsequent experiments.
[0027] (3) Removal of genomic DNA (DNAse treatment)
[0028] Removal of genomic DNA: Use DNase I to remove DNA from the RNA. React the extracted RNA with DNase I and follow the kit instructions to ensure the removal of residual genomic DNA. After completion, use an RNA cleanup kit to remove the enzyme and impurities to obtain a purified RNA sample.
[0029] (4) cDNA synthesis
[0030] Reverse transcription synthesis of cDNA: Use a reverse transcription kit (such as PrimeScript TM The extracted total RNA was reverse transcribed into cDNA using RT reagent Kit.
[0031] Reaction system: Combine 1 μg RNA, random primers (or oligo(dT) primers), reverse transcriptase, and other reaction components as specified in the kit. Perform reverse transcription at an appropriate temperature (usually 37°C for 60 minutes, followed by heating to 65°C for 5 minutes to terminate the reaction).
[0032] cDNA quality testing: Use PCR primers to amplify a portion of the gene (e.g., the exon region of SmRab82) to verify successful cDNA synthesis. Use agarose gel electrophoresis to check that the amplified product is the expected size.
[0033] (5) PCR amplification of the full-length sequence of the SmRab82 gene
[0034] Design specific primers for the SmRab82 gene:
[0035] F: ATGAATCCAGAGTATGATTATTTGTTCA;
[0036] R:TCAAGACGAGCAGCAGCC;
[0037] Primer design should take into account the start and end regions of the gene and ensure good specificity and amplification efficiency.
[0038] PCR reaction system:
[0039] The PCR reaction system includes: 10-50 ng cDNA, 1× PCR buffer, 0.2 mM dNTPs, 0.5 μM primers (forward and reverse), 1 U Taq DNA polymerase, 1.5 mM MgCl2, and deionized water to a final volume of 50 μL.
[0040] PCR amplification conditions:
[0041] Initial denaturation: 95°C, 7 min
[0042] Loop conditions:
[0043] Denaturation: 95°C, 40 seconds
[0044] Annealing: According to the Tm value of the primer, set the annealing temperature (usually 58°C) for 30 seconds
[0045] Extension: 72°C, 1 minute
[0046] Total number of cycles: 35 cycles
[0047] Final extension: 72°C, 7 minutes
[0048] Analysis of PCR products:
[0049] After PCR is completed, the amplified product is detected by agarose gel electrophoresis. The success of amplification is determined based on the size of the product. The amplified product of the SmRab82 gene should be consistent with the expected size.
[0050] (6) Product recovery and sequencing
[0051] PCR product recovery: If PCR amplification is successful, the amplified product can be recovered using a PCR product purification kit.
[0052] Sequencing: The purified PCR product was sent for Sanger sequencing to confirm the full-length sequence of the SmRab82 gene. Gene sequence alignment confirmed that the amplified sequence was consistent with the known SmRab82 gene sequence.
[0053] (7) Result analysis
[0054] By BLAST comparison or other online tools, it was confirmed that the amplified gene sequence was consistent with the sequence of the S. matsudana SmRab82 gene, proving that the full-length sequence of the SmRab82 gene had been successfully extracted and amplified from the leaves of Salix matsudana.
[0055] Example 2 Construction of SmRab82 gene overexpression vector
[0056] 1. Experimental Materials and Equipment
[0057] Plant material: Salix matsudana was selected as the research object, and healthy, disease-free plants were selected.
[0058] Salt stress treatment: 200 mM NaCl solution was used for salt stress treatment, and the treatment time was 12 h, 24 h and 48 h.
[0059] Reagents: RNA extraction kit (such as TRIzol), DNase I (for removal of genomic DNA), reverse transcription kit (such as PrimeScript TM RT reagent Kit), qRT-PCR kit (such as SYBR Green PCR Master Mix)
[0060] Primer design: Design specific primers for SmRab82 gene:
[0061] F:ACCAGCAGTTACTACCGTGG;
[0062] R:CCTTTGCCGTCTCGTATGAC;
[0063] Actin internal reference gene specific primers:
[0064] F:GTCAAGTTCTTTGCTTTCCTCC;
[0065] R: CATCACAATCACTCTCCGACTA.
[0066] 2. Salt stress treatment
[0067] Plant treatments: Salix matsudana plants were divided into a salt-stressed group and a control group. The control group received water, while the salt-stressed group received a 200 mM NaCl solution. Leaf samples were collected 12, 24, and 48 hours after treatment.
[0068] Sample collection: 1-2 fresh leaves (about 0.1-0.5 g) were collected from each plant at each treatment time point, immediately frozen in liquid nitrogen, and stored at -80°C for RNA extraction.
[0069] 3. RNA Extraction and Purification
[0070] RNA extraction: Total RNA was extracted from frozen leaf samples using TRIzol reagent. Follow the kit instructions to ensure high-purity RNA extraction and the absence of DNA contamination.
[0071] RNA purity test: Use a spectrophotometer to determine RNA concentration and check the A260 / A280 ratio (ideal value is 1.8-2.0). Use agarose gel electrophoresis to check RNA integrity and ensure that it is not degraded.
[0072] DNA Removal: Treat RNA samples with DNase I to remove any possible genomic DNA contamination. Treat RNA according to the DNase I instructions and purify using an RNA cleanup kit after treatment.
[0073] 4. cDNA Synthesis
[0074] Reverse transcription synthesis of cDNA: Use a reverse transcription kit (such as PrimeScript TM RT reagent Kit) and reverse transcribe the extracted RNA into cDNA. Adjust the reaction system according to the amount of RNA.
[0075] The reaction system includes: 1 μg RNA, an appropriate amount of random primers or oligo (dT) primers, reverse transcriptase, reverse transcription buffer, etc.
[0076] Reverse transcription reaction conditions: 37°C for 1 hour, followed by heating to 70°C for 5 minutes to terminate the reaction.
[0077] 5.qRT-PCR Analysis
[0078] Reaction system: 10 μL SYBR Green PCR Master Mix, 1 μL cDNA template, 0.5 μM of each primer, and water to 20 μL. Three technical replicates (triplicates) were performed for each sample to ensure data accuracy and reproducibility.
[0079] qRT-PCR conditions:
[0080] Initial denaturation: 95°C for 3 minutes
[0081] Loop conditions:
[0082] Denaturation: 95°C for 30 seconds
[0083] Annealing: 60°C 30 seconds
[0084] Extension: 72°C for 30 seconds
[0085] Number of cycles: 40 cycles
[0086] Data Analysis:
[0087] The relative expression level was calculated using the 2^-ΔΔCT method (ΔΔCT = (CT(SmRab82)-CT(Actin)) stress group - (CT(SmRab82)-CT(Actin)) control group). The relative expression level of the SmRab82 gene was calculated at different treatment time points (12 h, 24 h, and 48 h).
[0088] 6. Result Analysis and Expression Changes
[0089] Data analysis: Based on the qRT-PCR results, the relative expression change curve of the SmRab82 gene under treatment at different time points (12 hours, 24 hours and 48 hours) was drawn.
[0090] The results show that Figure 1 As shown in the data, under salt stress conditions, the SmRab82 gene was significantly upregulated within 12 hours, 24 hours, and 48 hours after treatment, indicating that the gene was responsive to salt stress and its expression level increased with the extension of salt treatment time.
[0091] Statistical analysis: The t-test was used to analyze whether the differences between the salt stress treatment group and the control group were significant.
[0092] Example 3 Obtaining SmRab82 gene plants
[0093] 1. Experimental Materials and Equipment
[0094] Plant material: Arabidopsis thaliana.
[0095] Vector and Agrobacterium:
[0096] Vector: pWM101 expression vector was used, which has a 35S promoter to drive the expression of the SmRab82 gene.
[0097] Agrobacterium strain: Agrobacterium tumefaciens GV3101 was selected for plant transformation.
[0098] Reagents and tools:
[0099] PCR reagent: used to amplify the SmRab82 gene.
[0100] Restriction enzymes: XbaI and KpnI, used to digest the pWM101 vector and the SmRab82 gene fragment.
[0101] Culture medium: MS medium, SC (Ura) medium, antibiotic selection medium.
[0102] Antibiotics: Hygromycin was used to select transformed plants.
[0103] 2. Construction of pWM101-SmRab82 recombinant plasmid
[0104] Cloning of the SmRab82 gene: The SmRab82 gene was amplified by PCR from the cDNA of Salix matsudana using specific primers containing XbaI and KpnI restriction enzyme sites.
[0105] PCR amplification:
[0106] Reaction system: 1 μg of cDNA template, 0.5 μM of each primer, 200 μM dNTPs, 1 U Taq DNA polymerase, 1× PCR buffer, total volume 50 μL.
[0107] PCR conditions: pre-denaturation at 95°C for 7 minutes, cycling conditions: 95°C for 40 seconds (denaturation), 55-60°C for 30 seconds (annealing), 72°C for 1 minute (extension); 30-35 cycles, and final extension at 72°C for 7 minutes.
[0108] Vector digestion and SmRab82 gene insertion:
[0109] pWM101 vector digestion: Use XbaI and KpnI to digest the pWM101 vector, linearize the vector fragment, and recover the target fragment.
[0110] SmRab82 gene insertion: The PCR-amplified SmRab82 gene fragment was mixed with the linearized pWM101 vector and ligated using homologous recombinase.
[0111] Transformation to E. coli for verification: The ligation reaction product was transformed into E. coli (such as DH5α), screened on LB plates, and colonies containing antibiotics were selected to verify whether the SmRab82 gene was successfully inserted into the pWM101 vector.
[0112] Plasmid verification: Sequencing was used to verify whether the SmRab82 gene was correctly inserted into the pWM101 vector and to confirm that the insertion direction was correct.
[0113] 3. Agrobacterium transformation
[0114] Agrobacterium culture and transformation: The constructed pWM101-SmRab82 recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 using the freeze-thaw method.
[0115] 4. Select Arabidopsis thaliana for transformation.
[0116] Choose the right plants: Select Arabidopsis plants with white flower buds for transformation. For the first infection, remove any excess seeds and completely immerse the inflorescence in the bacterial solution. Cover the container with the solution for 1-2 minutes.
[0117] Prepare infection medium: Suspend Agrobacterium GV3101 in transformation buffer containing the target gene, usually using MS medium as the suspension medium.
[0118] To infect the inflorescence: Place the plants soaked in the inoculum on a tray and cover with a black plastic bag. Mist the bag with water to maintain humidity. After 24 hours in the dark, stand the plants upright and water them normally. Repeat the transformation procedure seven days later.
[0119] 5. Screening and Verification of Transgenic Arabidopsis
[0120] PCR detection: Genomic DNA was extracted from transgenic Arabidopsis plants and PCR amplification was performed using specific primers to detect whether the SmRab82 gene was successfully integrated into the plant genome.
[0121] Example 4 Functional verification of the SmRab82 gene in yeast
[0122] 1. Experimental Materials and Equipment
[0123] Yeast strain: AXT3K yeast strain was selected as the experimental material.
[0124] Recombinant plasmid: The SmRab82 gene was cloned using the p416-GPD vector to construct the recombinant plasmid p416-SmRab82.
[0125] Reagents: Yeast culture medium: SC-Ura (lacking uracil) medium, used for screening transformed yeast.
[0126] Salt solution: prepare 50mmol / L and 100mmol / L NaCl solutions for salt stress treatment.
[0127] Incubator: used to culture yeast, set the appropriate temperature (such as 30℃).
[0128] 2. Construction of p416-SmRab82 recombinant plasmid
[0129] Cloning of the SmRab82 gene: The full-length SmRab82 gene sequence was amplified by PCR. Specific primers (containing appropriate restriction enzyme sites, BamHI and EcoRI) were used to amplify the SmRab82 gene. The amplified product was analyzed by agarose gel electrophoresis to confirm successful amplification.
[0130] Vector selection and enzyme digestion: The p416-GPD expression vector was selected and linearized using BamHI and EcoRI restriction enzymes to prepare a vector fragment suitable for inserting the SmRab82 gene.
[0131] Insert the gene: Insert the SmRab82 gene into the linearized p416-GPD vector and perform a ligation reaction using a homologous recombinase. After ligation, transform the recombinant plasmid into competent E. coli and screen for transformants.
[0132] Verify the recombinant plasmid: Confirm whether the SmRab82 gene is correctly inserted into the vector by restriction enzyme digestion and sequencing, and verify the direction and position of insertion.
[0133] 3. Yeast Transformation
[0134] Yeast strain preparation: Select the AXT3K yeast strain and culture it to the logarithmic growth phase (OD600≈1.0). Use an appropriate medium (such as YPD medium) to culture the yeast.
[0135] Chemical transformation: The p416-SmRab82 recombinant plasmid is transformed into AXT3K yeast using chemical transformation. Specifically, a yeast cell suspension is mixed with the recombinant plasmid, a transformation reagent (such as LiAc) is added, and heat shock transformation is performed. The transformed yeast is then inoculated onto SC-Ura solid medium and screened for successfully transformed yeast colonies. The transformed yeast is then cultured on SC-Ura medium, and viable yeast colonies are screened for those harboring the p416-SmRab82 recombinant plasmid.
[0136] 4. Salt Stress Treatment and Growth Analysis
[0137] Salt stress treatment: The transformed yeast strains were divided into an experimental group (p416-SmRab82) and a control group (p416-GPD, empty vector control). Each yeast group was inoculated into SC-Ura liquid medium containing 50 mmol / L and 100 mmol / L NaCl, respectively, for salt stress treatment. Different treatment times, such as 36 hours, were set to analyze growth performance under salt stress.
[0138] Yeast serial dilution: After 36 hours of salt stress treatment, serially dilute the yeast solution from each group at the following dilution ratios: 100, 10⁻¹, 10⁻², and 10⁻³. Spread the diluted yeast solution onto SC-Ura solid medium and incubate for 48 hours, observing yeast growth.
[0139] 5. Assessment of Growth and Salt Tolerance
[0140] Colony growth analysis: Colony size and morphology were observed and recorded at different NaCl concentrations to evaluate the tolerance of the SmRab82 gene to salt stress. Under 50 mmol / L and 100 mmol / L NaCl conditions, the p416-SmRab82-transformed yeast showed significantly stronger growth than the control group, demonstrating strong salt tolerance.
[0141] Comparison of survival ability: the results are as follows Figure 2 As shown in the figure, the difference in viability between yeast containing the SmRab82 gene and the control group was evaluated by comparing the number of colonies under different concentrations of NaCl. SmRab82-transformed yeast can still grow well at higher salt concentrations (such as 100mmol / LNaCl), while the growth of the control yeast is significantly inhibited.
[0142] Example 5 Evaluation of Salt Tolerance of Plants with SmRab82 Gene
[0143] (1) Root length measurement
[0144] Wild-type (WT) and transgenic Arabidopsis thaliana (OE1, OE2, and OE3) seeds were cultured vertically in 1 / 2 MS medium for 14 days and then transplanted to a peat soil:vermiculite (3:1) matrix for an additional 14 days. The plants were then subjected to salt treatment, with daily application of different concentrations of NaCl solution (0, 50, and 100 mmol). Phenotypes were observed and taproot length was measured after 7 days of treatment. The results showed that under normal growth conditions, there was no significant difference in root length between the WT and transgenic lines (p>0.05). However, under salt stress conditions, the root length of the transgenic lines was significantly longer than that of the WT (p<0.001), indicating that overexpression of SmRab82 significantly improves salt tolerance in Arabidopsis, particularly in promoting root growth.
[0145] (2) Phenotypic observation
[0146] like Figure 3As shown in the results, after salt stress treatment, WT plants showed growth retardation, smaller leaves and wilting, while transgenic lines (OE1, OE2, OE3) maintained healthy leaves and more developed root systems. This further confirms the positive role of SmRab82 in improving plant salt tolerance. Therefore, overexpression of the SmRab82 gene in Arabidopsis significantly enhanced its tolerance to salt stress, especially at a salt concentration of 200mM NaCl. Transgenic Arabidopsis (OE line) showed stronger salt tolerance in root growth than the wild type (WT). Under normal growth conditions, there was no significant difference in root length between the OE line and the WT. However, under salt stress conditions, the root length of the OE line was significantly longer than that of the WT plants, indicating enhanced salt tolerance. In contrast, WT plants showed growth stunting, smaller leaves and significantly shorter roots under salt stress, indicating that salt stress had an adverse effect on their growth and development. These results suggest that SmRab82 plays an important role in maintaining root growth and overall plant health, especially under salt stress, and may promote plant adaptation to salt stress by enhancing mechanisms such as ion homeostasis, osmotic regulation, and vesicle trafficking.
[0147] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Application of the SmRab82 gene in improving plant salt stress tolerance, characterized in that: The nucleotide sequence of the SmRab82 gene is shown in SEQ ID NO.
1.
2. The use of the SmRab82 gene according to claim 1 in improving plant salt stress tolerance, characterized in that By constructing a SmRab82 gene overexpression vector, transgenic plants with high salt stress tolerance were obtained.
3. Use of the SmRab82 gene according to claim 1 or 2 in improving salt stress tolerance in plants, wherein the plant is willow or Arabidopsis thaliana.
4. Use of the SmRab82 gene according to claim 1 or 2 in improving plant salt stress tolerance, wherein the salt stress tolerance is manifested as: under salt stress, the root length of the SmRab82 gene overexpressing plant is longer than that of the wild type, and the degree of leaf wilting is less than that of the wild type.
5. A plant breeding method, characterized in that: Plants with salt stress tolerance higher or / lower than that of wild plants are obtained by regulating the expression of the SmRab82 gene in target plants. The nucleotide sequence of the SmRab82 gene is shown in SEQ ID NO.
1.
6. The plant breeding method according to claim 5, characterized in that The expression mode of the SmRab82 gene in the plant of the regulation purpose is overexpression.
7. The plant breeding method according to claim 5, characterized in that The target plant is willow or Arabidopsis thaliana.