Application of OsECT3 gene in changing cold tolerance of rice
By constructing OsECT3 knockout and complementary materials, the expression of OsECT3 gene in rice was regulated, and the problem of rice sensitivity to low temperature was solved, and the cold tolerance of rice was significantly improved or reduced, providing a molecular basis for high-quality rice breeding.
Patent Information
- Application Number
- CN202510589627.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-08-05
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In the prior art, rice is sensitive to low temperature, resulting in slow growth, yellowing, dysplasia, withering and even death of rice seedlings, affecting yield and quality, and the study of OsECT3 in regulating low temperature stress in rice has not yet been thorough.
By constructing knockout materials and complementary materials of OsECT3, the expression of OsECT3 genes is regulated, rice varieties with higher or lower cold tolerance are cultivated, and the active state of OsECT3 is changed by hybridization, genetic engineering and physical or chemical mutagenesis methods are used.
It significantly improves or reduces the cold tolerance of rice, provides a new breeding method, provides a molecular basis for cultivating high-quality rice resources, and verifies that the cold tolerance of OsECT3 mutant plants is reduced and the cold tolerance of complementary materials is improved.
Smart Images

Figure CN120424980A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of rice molecular breeding, and particularly relates to the application of the OsECT3 gene in changing the cold tolerance of rice, and a rice breeding method for changing the cold tolerance of rice. Background Art
[0002] Rice (Oryza sativa), the staple food of more than half the world's population, faces significant production challenges, particularly in recent years, as increasingly frequent cold weather events have led to significant declines in the yield and quality of rice native to tropical and subtropical regions. Rice is a low-temperature-sensitive crop. Exposure to low temperatures during the seedling stage can cause growth retardation, yellowing, stunted growth, wilt, and even death. Exposure to low temperatures during the reproductive growth period directly impacts rice yield and quality. Therefore, developing cold-tolerant rice varieties is an urgent issue.
[0003] OsECT3 (Evolutionarily Conserved C-Terminal region 3) encodes an mRNA adenine methylation modification (m6A) binding protein containing a conserved YTH (YT521-Bhomology) domain.
[0004] Currently, there are no reports on whether OsECT3 regulates low temperature stress in rice. Summary of the Invention
[0005] The present invention provides application of the OsECT3 gene in changing the cold tolerance of rice.
[0006] The present invention also provides a rice breeding method for changing the cold tolerance of rice. On the one hand, the method can make the starting rice plants that do not express the active OsECT3 gene express the active OsECT3 gene, thereby cultivating rice varieties with higher cold tolerance.
[0007] Alternatively, we can engineer rice varieties with lower cold tolerance by inactivating the OsECT3 gene in the starting rice plants. While lower cold tolerance may appear to be a detrimental trait in the final rice variety, it can be useful for specific purposes, such as using rice varieties with lower cold tolerance as intermediates for hybridization or genetic manipulation, leading to better performance in subsequent breeding efforts.
[0008] In a specific embodiment, the active OsECT3 gene is introduced into the starting rice plant that does not express the active OsECT3 gene by hybridization, so that the starting rice plant expresses the active OsECT3 gene; or
[0009] The OsECT3 gene expression cassette is introduced into the starting rice plant that does not express the active OsECT3 gene by genetic engineering methods, so that the plant expresses the active OsECT3 gene.
[0010] In a specific embodiment, the starting rice plant expressing the active OsECT3 gene is made to not express the active OsECT3 gene by hybridization; or
[0011] knocking out the OsECT3 gene in the starting rice plant expressing the active OsECT3 gene by genetic engineering, or mutating the OsECT3 gene into an inactive form; or
[0012] The OsECT3 gene in the starting rice plant expressing the active OsECT3 gene is mutated into an inactive one by physical or chemical mutagenesis.
[0013] The present invention also provides a method for screening cold tolerance of rice, comprising the step of detecting whether an active OsECT3 gene is expressed in target rice plants.
[0014] In a specific embodiment, the amino acid sequence encoded by the OsECT3 gene is shown in SEQ ID NO: 2.
[0015] In a specific embodiment, the nucleic acid sequence of the OsECT3 gene is shown in SEQ ID NO: 2.
[0016] This study explores the role of OsECT3 in regulating rice's response to cold stress. By constructing OsECT3 knockout and complementary materials, the authors demonstrated that rice plants with OsECT3 mutations exhibit significantly reduced cold tolerance, while complementary materials exhibit significantly improved cold tolerance. This provides a new perspective for creating high-quality rice resources and lays a molecular foundation for the future breeding of rice with cold tolerance or other high-quality traits. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The upper half of the figure shows the schematic diagram of the OsECT3 gene structure and how its sequence can be edited using CRISPR knockout technology.
[0018] Figure 2 Identification of OsECT3 complementary material positive families. AB is the identification of OsECT3 complementary material (COM-E3) positive families; CD is the identification of OsECT3 complementary material (COM-E3) that has lost the ability to bind to m6A. 3WA ) Identification of positive families.
[0019] Figure 3 OsECT3 positively regulates rice response to low temperature stress. Representative images and survival statistics of WT (ZH11) and osect3 mutants before and after treatment.
[0020] Figure 4 WT, osect3 mutant materials, complementation materials (COM-E3) and complementation materials without m6A domain (COM-E3 3WA ) Phenotypic observation and survival rate statistics after low temperature treatment.
[0021] Figure 5 WT, osect3 mutant materials, complementation materials (COM-E3) and complementation materials without m6A domain (COM-E3 3WA )Conductivity statistics before and after low temperature treatment. DETAILED DESCRIPTION
[0022] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.
[0023] 1. Knockout of the OsECT3 gene
[0024] The sequence of the OsECT3 gene in rice was obtained as shown in SEQ ID NO: 1; the encoded amino acid sequence was shown in SEQ ID NO: 2.
[0025] Based on the sequence of the OsECT3 gene, two knockout targets were selected:
[0026] OsECT3-target 1: 5'-GCGTGGCGATTCCTCCTGAG-3' (SEQ ID NO: 3);
[0027] OsECT3-target 2: 5'-GAAGGAACTCCACCTAGCAA-3' (SEQ ID NO: 4).
[0028] The target site was fused to the TKC promoter sequence through homologous recombination and amplified to obtain a promoter sequence containing the target site. The amplified fragments were then cut with the corresponding restriction endonucleases into the knockout vector TKC. The fragments were then enzymatically linked using homologous recombinases and heat-shock transformed into competent Trnasi5α. This resulted in the transformation vector TKC-OsECT3. These vectors were then introduced into the rice recipient Zhonghua11 (ZH11) using Agrobacterium-mediated transgenesis to obtain the corresponding transformed plants.
[0029] The results are as follows Figure 1As shown, two homozygous families were obtained for the mutant. In the first family, the mutations included a single insertion and a five-base deletion in the OsECT3 exon, resulting in premature termination of the coding sequence. In the second family, the mutations included a single insertion and a four-base deletion in the OsECT3 exon, resulting in premature termination of the coding sequence.
[0030] 2. Complementation of Knockout Mutants
[0031] Based on the sequence of the OsECT3 gene, primers for the OsECT3 complementary vector were designed. The primer sequences are as follows:
[0032] PFA2300-promoter-F:CCGCATGCGTCGACTCTAGACTTCCATATCACAATAAACC(SEQ IDNO:5);
[0033] Promoter-R-2:GGCCATGGCTTTGGCTCACGAGATAG (SEQ ID NO: 6);
[0034] CDS-F:TATCTCGTGAGCCAAAGCCATGGCCGCCGTCGCGCCG (SEQ ID NO:7);
[0035] PFA2300-E3-CDS-R:CCCCGGGCTGCAGTCTAGAACTAGCTTTGACGGTGCCGT (SEQ ID NO: 8).
[0036] The target sequence was amplified using the aforementioned primers. The amplified fragments were then cleaved with the corresponding restriction endonucleases to remove the knockout vectors. The fragments were then heat-shock transformed into competent Trnas5α using homologous recombinase enzyme ligation. This yielded the transformation vector Pfa2300-OsECT3. The vectors were then introduced into the rice receptor strain osect3 using Agrobacterium-mediated transgenesis to obtain corresponding positively transformed plants.
[0037] The results are as follows Figure 2 As shown, after detecting the gene expression level and protein level, positive complementation strains were obtained.
[0038] 3. Effect of OsECT3 on plant survival rate
[0039] ZH11 wild type (WT), OsECT3 mutant, and complemented seedlings with consistent growth were grown under normal hydroponic conditions for 2 weeks, and then placed in a 4°C incubator for 3 days of low-temperature treatment; after 14 days, the survival rate of each material was counted.
[0040] The results are as follows Figure 3 and 4 As shown in Figure 2, after low temperature stress treatment, the osect3 mutant showed a significantly lower survival rate compared to the wild type. Figure 4 As shown in the figure, after low temperature stress treatment, COM-E3 complementation material can improve the survival rate of mutants. 3WA There was no significant difference in the survival rate between the OsECT3-complemented plants that lost the m6A binding ability and the osect3 mutant.
[0041] 4. Effects of OsECT3 on plant tissue electrical conductivity
[0042] Take the WT, OsECT3 mutant, COM-E3, COM-E3 with the same growth 3WA The complementary seedlings were grown under normal hydroponic conditions for 2 weeks and then treated with low temperature for 3 days for the detection of electrical conductivity.
[0043] The results are as follows Figure 5 As shown, OsECT3 mutants and COM-E3 3WA The plants showed higher electrical conductivity, while the COM-E3 complementary material showed no significant change.
[0044] Although the examples of the present invention only list specific methods for enhancing wild-type rice and OsECT3 mutants, the experiments of the present invention have in fact demonstrated that the OsECT3 mutation makes rice sensitive to cold stress, and that OsECT3 complementation materials can partially complement the mutant's phenotype. After reading the present invention, those skilled in the art will readily understand that improving the cold tolerance of rice can be achieved by simply complementing the OsECT3 mutant using appropriate methods. Therefore, the means for achieving the aforementioned objectives should not be used to limit the scope of protection of the present invention; any means that can achieve the aforementioned objectives are encompassed within the scope of protection of the present invention.
[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. Application of OsECT3 gene in changing cold tolerance of rice.
2. A rice breeding method for improving the cold tolerance of rice, characterized in that: The method comprises the steps of causing a starting rice plant that does not express an active OsECT3 gene to express an active OsECT3 gene; or, A step of preventing the expression of active OsECT3 gene in the starting rice plant expressing active OsECT3 gene.
3. The method according to claim 2, characterized in that introducing the active OsECT3 gene into the starting rice plant that does not express the active OsECT3 gene by hybridization, so that the plant expresses the active OsECT3 gene; or The OsECT3 gene expression cassette is introduced into the starting rice plant that does not express the active OsECT3 gene by genetic engineering methods, so that the plant expresses the active OsECT3 gene.
4. The method according to claim 2, characterized in that By hybridization, the starting rice plant expressing the active OsECT3 gene does not express the active OsECT3 gene; or knocking out the OsECT3 gene in the starting rice plant expressing the active OsECT3 gene by genetic engineering, or mutating the OsECT3 gene into an inactive form; or The OsECT3 gene in the starting rice plant expressing the active OsECT3 gene is mutated into an inactive one by physical or chemical mutagenesis.
5. A method for screening cold tolerance of rice, characterized in that: The method includes the step of detecting whether the target rice plant expresses an active OsECT3 gene.
6. The use according to claim 1 or the method according to any one of claims 2 to 5, characterized in that: The amino acid sequence encoded by the active OsECT3 gene is shown in SEQ ID NO:
2.
7. The use or method according to claim 6, characterized in that The nucleic acid sequence of the active OsECT3 gene is shown in SEQ ID NO: 2.