SNP molecular marker for identifying salt tolerance of grass carp and application thereof

Abstract

The application provides a SNP molecular marker for identifying salt tolerance of grass carp and application thereof. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, wherein the base at the 503th position of the sequence is T or C. The SNP molecular marker provided by the application can be applied to rapid identification of salt tolerance of grass carp and assisted breeding of salt-tolerant grass carp. By detecting the SNP molecular marker, salt-tolerant grass carp parents with excellent salt tolerance can be effectively selected under the same breeding conditions, the SNP molecular marker can be effectively used for molecular marker assisted breeding of grass carp, and then the genotypes of the grass carp parents can be identified according to actual breeding requirements, suitable genotype grass carp parents are selected for breeding, and grass carp offspring (fish fry) with high salt tolerance can be obtained, breeding time is saved, cost is low, accuracy is high, the breeding process of the grass carp is accelerated, and the economic benefits of the grass carp in a saline-alkali environment are increased.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and particularly relates to a SNP molecular marker for identifying salt tolerance of grass carp and application thereof. BACKGROUND

[0002] The area of saline-alkali land in China is about 9.93x10 11 m 2 The area of saline-alkali water in China is about 4.60x10 11 m 2 , and is distributed in 19 provinces, cities and autonomous regions in China. Due to the characteristics of high salinity, high alkalinity, imbalance of main ion ratio, and multiple water quality types, most of the saline-alkali water is in idle state for a long time. At present, there are fewer aquatic species that can be cultured in saline-alkali water. Therefore, fish culture using saline-alkali water is one of the methods for developing and utilizing saline-alkali water areas, and the key of this method is to improve the salt tolerance of aquatic culture species and to breed new salt-tolerant fish species.

[0003] Grass carp (Ctenopharyngodon idella) is one of the four major freshwater fish in China, and is also an important freshwater economic fish in China. Its culture scale and market demand are expanding year by year. According to the data of “2024 China Fishery Statistical Yearbook”, the annual output of grass carp in China reached 590.48 million tons in 2023.

[0004] With the shortage of freshwater resources and the increasing demand for the development of saline-alkali water areas, improving the salt tolerance of grass carp has become a key research direction to expand its culture range and improve the economic benefits of saline-alkali water areas. Traditional salt-tolerant variety breeding mainly relies on phenotypic selection, that is, screening salt-tolerant individuals by long-term exposure to high salt environment. However, this method has significant defects, for example, high salt stress can easily cause damage to the physiological functions of grass carp, and even cause irreversible growth and development disorders, which seriously affect the reproductive performance of the parents. Phenotypic selection has a long cycle, high cost, and is greatly affected by environmental factors, so the accuracy of selection cannot be guaranteed.

[0005] Genome wide association study (GWAS) can detect hundreds or millions of genetic variations in the genomes of various organisms, and perform association analysis with sample phenotypes to find variation sites that are significantly associated with specific phenotypes or diseases. Single nucleotide polymorphism (SNP) widely exists in the genomes of animals and plants, and is a DNA sequence polymorphism caused by variation of a single nucleotide, including single base substitution, transversion, insertion and deletion. SNP markers have the advantages of high distribution density, large detection throughput, high degree of automation, low cost, etc., and have become the preferred tool for analyzing the genetic mechanism of complex traits.

[0006] Therefore, the SNP site significantly related to salt tolerance is screened by using whole genome resequencing and GWAS, and the salt-tolerant dominant allele is located, which is of great significance for rapidly identifying the salt tolerance of grass carp and assisting in breeding salt-tolerant grass carp. SUMMARY

[0007] The application provides a SNP molecular marker for identifying the salt tolerance of grass carp and application thereof, which can be applied to rapidly identifying the salt tolerance of grass carp and assisting in breeding salt-tolerant grass carp.

[0008] According to a first aspect of the application, a SNP molecular marker for identifying the salt tolerance of grass carp is provided, and the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, wherein the base at position 503 of the sequence is T or C.

[0009] The inventors of the present application found that there is a significant difference in survival time between individual grass carp after culturing the grass carp under a certain salinity condition. The tail fin tissues of the salt-sensitive group of grass carp and the salt-tolerant group of grass carp are subjected to whole genome sequencing, and a candidate SNP molecular marker related to the salt tolerance of grass carp is identified by using whole genome association analysis (GWAS), that is, the SNP molecular marker for identifying the salt tolerance of grass carp provided by the present application. The SNP molecular marker is located at the base at position 503 of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is T / C. The SNP molecular marker provided by the present application can be applied to rapidly identifying the salt tolerance of grass carp and assisting in breeding salt-tolerant grass carp. By detecting the SNP molecular marker, the salt-tolerant grass carp parents with excellent salt tolerance can be effectively selected under the same breeding conditions, and the SNP molecular marker can be effectively used for molecular marker assisted breeding of grass carp. Furthermore, the genotype of the grass carp parents can be identified according to the actual breeding requirements, the grass carp parents with suitable genotypes are selected for breeding, and grass carp offspring (fish fry) with high salt tolerance can be obtained, which saves breeding time, is low in cost, high in accuracy, accelerates the breeding process of grass carp, and increases the economic benefits of grass carp breeding in saline-alkali environment.

[0010] Using high-salt conditions to select grass carp with excellent salt tolerance may cause irreversible damage to the grass carp for life, and reduce its reproductive performance. The SNP molecular marker for identifying the salt tolerance of grass carp provided by the present application can be used to directly select grass carp parents with excellent salt tolerance, avoid irreversible damage to the grass carp, and greatly reduce the breeding cost of new salt-tolerant grass carp varieties.

[0011] Preferably, the SNP molecular marker is located at the base at position 15890052 of chromosome 1 of grass carp.

[0012] Preferably, the grass carp with the genotype of CC at the 503th base pair of the nucleotide sequence of the SNP molecular marker has the salt tolerance ability.

[0013] The genotype of CC at the 503th base pair of the nucleotide sequence of the grass carp as shown in SEQ ID NO: 1 is the dominant genotype of the grass carp salt tolerance, which provides a theoretical support for the salt tolerance ability of the grass carp and the assisted breeding of the grass carp.

[0014] According to a second aspect of the present application, the application of the SNP molecular marker for identifying the salt tolerance ability of the grass carp in the preparation of a product for identifying the salt tolerance ability of the grass carp is provided.

[0015] Preferably, the product comprises at least one of a primer pair, a probe, a kit, and a chip.

[0016] According to a third aspect of the present application, the application of the SNP molecular marker for identifying the salt tolerance ability of the grass carp in the assisted breeding of the grass carp is provided.

[0017] According to a fourth aspect of the present application, a primer pair for detecting the SNP molecular marker for identifying the salt tolerance ability of the grass carp is provided, the primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer being shown in SEQ ID NO: 3.

[0018] According to a fifth aspect of the present application, a kit for identifying the salt tolerance ability of the grass carp is provided, the kit comprising the primer pair of the SNP molecular marker for identifying the salt tolerance ability of the grass carp.

[0019] According to a sixth aspect of the present application, a method for identifying the salt tolerance ability of the grass carp is provided, comprising the following steps:

[0020] S1. extracting the genomic DNA of the grass carp to be tested;

[0021] S2. performing PCR amplification on the extracted genomic DNA by using the primer pair for detecting the SNP molecular marker for identifying the salt tolerance ability of the grass carp to obtain a PCR amplification product;

[0022] S3. performing sequencing on the PCR amplification product, and judging the salt tolerance ability of the grass carp to be tested according to the sequencing result.

[0023] Based on the SNP molecular marker for identifying the salt tolerance of grass carp identified by the application, a primer pair for the SNP molecular marker is designed, the primer pair contains an upstream primer and a downstream primer, after the genomic DNA extracted from the grass carp to be tested is subjected to PCR amplification by using the primer pair, the PCR amplification product is sequenced, and the genotype of the 503th base of SEQ ID NO: 1 in the genomic DNA sample of the grass carp to be tested is determined according to the sequencing result, if the 503th base is CC genotype, it is a grass carp with strong salt tolerance, and if the 503th base is TC genotype, it is a grass carp with weak salt tolerance.

[0024] Preferably, in S2, the reaction procedure of PCR amplification is as follows: 90-94 DEG C pre-denaturation for 3-6 min; 90-94 DEG C denaturation for 20-35 s, 56-60 DEG C annealing for 30-35 s, 70-72 DEG C extension for 20-30 s, 35-37 cycles; 70-72 DEG C extension for 3-12 min.

[0025] Preferably, in S2, the reaction system of PCR amplification is as follows: 0.1 ug of genomic DNA, 10 uL of Mix, 1 uL of upstream primer, 1 uL of downstream primer, and a total reaction system of 20 uL, wherein the concentration of the upstream primer and the downstream primer is 0.1 nmol / mL. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 A comparison chart of survival time of the salt-sensitive group and the salt-tolerant group of grass carp provided in Example 1.

[0027] Figure 2 A high-quality SNP obtained after sequencing and its distribution density map in 24 chromosomes of grass carp provided in Example 1.

[0028] Figure 3 A Manhattan plot in GWAS of the salt stress trait provided in Example 1.

[0029] Figure 4 A sequencing peak chart of 8 grass carps randomly selected from the grass carp population to be tested provided in the test example.

[0030] Figure 5 A sequencing peak chart of 100 grass carps in the salt-sensitive group in the grass carp population to be tested provided in the test example.

[0031] Figure 6 A sequencing peak chart of 100 grass carps in the salt-tolerant group in the grass carp population to be tested provided in the test example. DETAILED DESCRIPTION

[0032] The technical features of the technical solution provided by the present invention will be further clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] Example 1: Screening of candidate SNP molecular markers for salt-tolerant grass carp

[0034] This embodiment uses grass carp as the experimental subject. The grass carp are cultured under certain salinity conditions, and the tail fin tissue of the grass carp is taken for whole-genome sequencing. Genome-wide association analysis (GWAS) is then used to screen for candidate SNP molecular markers related to the salt tolerance of grass carp. The specific operation steps are as follows:

[0035] 1. The grass carp used in the experiment were purchased from Mingtao Fish Fry Farm in Dinghu District, Zhaoqing City, Guangdong Province. 1000 grass carp of similar size (average weight 16 grams) were selected. Before the experiment, the grass carp were transferred to a cement pond (5000L, 2.5m×2.5m×0.8m) to allow them to adapt for 72 hours. No feed was given during this period. After the adaptation period, 948 grass carp participated in the formal experiment.

[0036] 2. At the start of the formal experiment, the salinity in the cement pool was increased by 3 ppt every two hours. Once the salinity reached 12 ppt, observations were conducted every four hours. Dead grass carp were promptly removed, and their survival time was recorded. The tail fins of the grass carp were collected and soaked in anhydrous ethanol, then stored at 4°C for later use. The first 50 fish to die and the last 50 to survive were designated as the salt-sensitive group (SS group) and the salt-tolerant group (ST group), respectively. The average survival time of the grass carp in the salt-sensitive group (SS group) and the salt-tolerant group (ST group) was calculated. The results are as follows: Figure 1 As shown.

[0037] Depend on Figure 1 It can be seen that under 12 ppt salinity stress, the average survival time of grass carp was 63.70 h. The average survival times of grass carp in the salinity sensitive group (SS group) and the salinity tolerant group (ST group) were 14.30 ± 2.30 h and 131.94 ± 1.58 h, respectively. Moreover, one-way ANOVA showed that there was a significant difference in the survival time of grass carp in the sensitive group (SS group) and the salinity tolerant group (ST group) (P < 0.0001).

[0038] 3. Whole genome resequencing was performed on the caudal fin tissues of 100 grass carps in the above-mentioned salinity-sensitive group (SS group) and salinity-tolerant group (ST group). After the genomic DNA of the caudal fin tissue samples was qualified, the DNA sequence fragments were fragmented by ultrasonic waves to form random fragments. The fragmented DNA was subjected to end repair, 3' end A addition, and ligation of sequencing adapters in turn, and then the fragments with a length of about 350 bp were enriched by magnetic beads and subjected to PCR amplification to form a sequencing library. The constructed library was subjected to library quality inspection, and the qualified library was sequenced by using a DNBSeq T7TM platform. The sequencing strategy was DNBSeq T7 PE150, the total sequencing read length was 300 bp, the sequencing depth was 10x, and the sequencing results were aligned to the grass carp reference genome (GCF_019924925.1) after quality control. The sequencing results showed that 1,220.65G reads data were obtained, the sequencing quality score Q30 was 97.98%, and the GC content was 37.77%. GATK software was used to detect SNPs, and after SNP quality control, plink was used for association analysis. A large number of SNP molecular markers associated with the traits were screened, and after bioinformatics analysis and site filtering, 9,473,455 SNPs were used for subsequent further analysis. The high-quality SNPs obtained after sequencing and their distribution density in the 24 chromosomes of grass carp are shown in Figure 2 To reveal the relationship between the candidate SNPs and the salt stress traits, FarmCPU model was used for analysis, and the Bonferroni correction method was applied. 1.00x10E-06 was regarded as the critical value of the whole genome significant p value, and the identification results of the SNP molecular markers related to the salt stress traits in the GWAS are shown in Figure 3 .

[0039] As shown in the Manhattan plot analysis results of the GWAS related to the salt stress traits Figure 3 , one of the SNP molecular markers had a significance of 5.68E-07 and was significantly associated with the salt tolerance trait. The SNP molecular marker was located at the 15890052th base on the chromosome 1 of grass carp, and was located at the 503th base from the 5' end of the sequence shown in SEQ ID NO: 1. The polymorphism was T / C, which was the SNP molecular marker provided by the application for identifying the salt tolerance ability of grass carp. Through gene annotation of the SNP molecular marker for identifying the salt tolerance ability of grass carp obtained by the above screening, protocadherin 7a (pcdh7a) was identified in the vicinity, that is, the SNP molecular marker was related to the pcdh7a gene, and its function was related to calcium ion binding.

[0040] SEQ ID NO: 1

[0041] 5'-TGTCCGTTTCATTTTTTTTTTTAAATGTTCATCAACACAGCAAAAGCAGT ACTTATTGACAATGAAATGTATTTTTCTACAAAAACCAATTAAAATAAATAGTTTACATTTAAATAATTAATATGAAGAAAATACAGTAAAAAAAGAATAAGTAAAAGAGAAAAGTAAAAGAAGGTTGTAATAAATTCAAAAAAATCTATAGCATTAAAAATCTAGTATTTAAAGAGGTGTCTGTGTGTACATACAAACAAAAAGAAATAAAGCAACCATAACAACCATTTAAAGCTGTTTTGTATACAAGTATGCTAGTGCTGTTCCAGAGAGACATGCTGTTGTGTTTAACAATCTTATAGCCTGTGGTTAGAAGCTGTTTTATAGGAAACAGACAGAAAGTCAGGGGATCATTGAGGGCTTTTTACAATGGACCTGGCATTTCTAATCTATAGGCATATTGGCCTTCACAAGAACATATGAAGAAATGCTTTGGATATTTGATAGTTTA[N]GGTCAGTGTGTTCAGGTTTGATCCTTCTTTCATTACTGCTATGATCAAGTTGAACACAATGATGATATAAAGGTTAGTGGTGAAGGTATTTGGCCACCAAATAATTCTTTAAATAGGAGATTCAAATGTAAAATAAAAACTTAAAAGTGCAATATTGTACACTATATTGTAAGTGTAGTGTGCAAGATAGATAGATAGATAGATAGATCTAGACGTTTTTCTTTTTGCCATAATGGACCATTTAGGTTAAATAGCTTAAGTTATTATTAGTCTATCAATATTATTGTTATTATCTTATTGGTTTTGTTGTTATGTCTCTGAATCACGAAGAAGAAGTGTTCTCATTGTCTGAATGCGGCAATGCTTTTCGCTCATCCTGTTAACAATGAGCATGTATCGCACACACTCTCTCCGGTCCCAGCACGGGCTGCCCCGTAGCCACGCGGATGCGCGAGCGCAATGCAGCACTGACTGAACGTAATACAGTCACACAACAAAAGGA-3'

[0042] In SEQ ID NO: 1, the base N in [] represents T / C, which is a mutation type, and is the position of the candidate SNP molecular marker related to the salt tolerance of grass carp identified in this embodiment.

[0043] Example 2: Primer pair for salt-tolerant grass carp candidate SNP molecular marker

[0044] Table 1: Primer pair for detecting SNP molecular marker for identifying salt tolerance of grass carp

[0045] Primer name Sequence number Specific nucleotide sequence Upstream primer (Primer 1-F) SEQ ID NO: 2 5'-GCAACCATAACAACCATT-3' Downstream primer (Primer 1-R) SEQ ID NO: 3 5'-GGCCAAATACCTTCACCA-3'

[0046] This embodiment aims to design the amplification primer (i.e. the primer pair for detecting SNP molecular marker for identifying salt tolerance of grass carp provided by the present application) shown in Table 1 for the SNP molecular marker (SEQ ID NO: 1) significantly associated with the salt tolerance trait of grass carp identified in Example 1 using Primer 5, and the nucleotide sequence amplified by the primer pair is shown in SEQ ID NO: 4, which is > 50 bp away from the 5' end and 3' end of the SNP molecular marker site.

[0047] SEQ ID NO: 4

[0048] GCAACCATAACAACCATTTAAAGCTGTTTTGTATACAAGTATGCTAGTGCTG

[0049] TTCCAGAGAGACATGCTGTTGTGTTTAACAATCTTATAGCCTGTGGTTAGAA

[0050] GCTGTTTTATAGGAAACAGACAGAAAGTCAGGGGATCATTGAGGGCTTTTT

[0051] ACAATGGACCTGGCATTTCTAATCTATAGGCATATTGGCCTTCACAAGAACATATGAAGAAATGCTTTGGATATTTGATAGTTTA[N]GGTCAGTGTGTTCAGGT TTGATCCTTCTTTCATTACTGCTATGATCAAGTTGAACACAATGATGATATAA AGGTTAGTGGTGAAGGTATTTGGCC

[0052] In SEQ ID NO: 4, the base N in [] is T / C, which is a mutation type, and is the position of the candidate SNP molecular marker related to the salt tolerance of grass carp identified in Example 1.

[0053] Method for identifying salt tolerance of grass carp

[0054] A method for identifying salt tolerance of grass carp, comprising the following steps:

[0055] S1. Extracting genomic DNA of the grass carp to be tested;

[0056] S2. Using the primer pair for detecting the SNP molecular marker for identifying the salt tolerance of grass carp provided in Example 2 to perform PCR amplification on the extracted genomic DNA to obtain a PCR amplification product;

[0057] The reaction program of PCR amplification is as follows: pre-denaturation at 90-94℃ for 3-6 min; denaturation at 90-94℃ for 20-35 s, annealing at 56-60℃ for 30-35 s, extension at 70-72℃ for 20-30 s, 35-37 cycles; extension at 70-72℃ for 3-12 min.

[0058] The reaction system of PCR amplification is as follows: 0.1 μg of genomic DNA, 10 μL of Taq Master Mix, 1 μL of upstream primer, 1 μL of downstream primer, a total reaction system of 20 μL (supplemented with H2O to 20 μL), and the concentration of the upstream primer and the downstream primer is 0.1 nmol / mL.

[0059] Taq Master Mix is a PCR premix containing Taq DNA polymerase, dNTPs, standard Taq enzyme reaction buffer, enzyme stabilizer and bromophenol blue dye;

[0060] S3. Sequencing the PCR amplification product, and judging the salt tolerance of the grass carp to be tested according to the sequencing result.

[0061] Test Example

[0062] The test example aims to verify the polymorphism of the SNP molecular marker related to the salt tolerance of grass carp identified in Example 1 by using the primer pair provided in Example 2 and the method provided in Example 3. The specific operation steps are as follows:

[0063] 1. Randomly select 8 grass carps from the to-be-tested population (purchased from Mingtao Fish Fry Farming Field in Dinghu District, Zhaoping City, Guangdong Province), extract the genomic DNA of the fin bar of the grass carps by using marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology), detect the quality of the genomic DNA by using 1.0% agarose gel electrophoresis, detect the concentration of the genomic DNA by using ultraviolet spectrophotometer (Eppendorf, AG2231 type), and store it at -20℃ for standby use.

[0064] 2. Perform PCR amplification on the 8 grass carps by using the primer pair (the upstream primer with the nucleotide sequence as shown in SEQ ID NO: 2 and the downstream primer with the nucleotide sequence as shown in SEQ ID NO: 3) shown in Table 1 and referring to the reaction system for PCR amplification shown in Table 2 and the reaction program for PCR amplification shown in Table 3, send the obtained PCR amplification product to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing, and statistically analyze the SNP site and its peak graph of the sequencing result. The result is shown in Table 4. Figure 4

[0065] Table 1 Reaction system for PCR amplification

[0066] Component Amount DNA template (grass carp fin strip genomic DNA) 0.1 μg Mix 10 μL Upstream primer 1 μL Downstream primer 1 μL H2O Supplemented to a total system of 20 μL

[0067] Table 2 Reaction program for PCR amplification

[0068]

[0069] The sequencing result and Figure 4 ​It can be known that the 503th base of the nucleotide sequence of SEQ ID NO: 1 exists a SNP molecular marker in 8 grass carps randomly selected from the test group, the genome of the test grass carp group has polymorphism at the above SNP molecular marker, the polymorphism is T / C, and the SNP molecular marker contains 3 genotypes, which are CC, TC and TT, wherein the proportion of CC genotype in 8 grass carps is 50%, the proportion of TC genotype is 37.5%, and the proportion of TT genotype is 12.5%.

[0070] 3. Referring to steps 1 and 2 above, 100 salt-sensitive grass carps and 100 salt-tolerant grass carps were obtained in the above test group, the fin strip genomic DNA of the grass carp was extracted by marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology), the quality of the genomic DNA was detected by 1.0% agarose gel electrophoresis, the concentration was detected by ultraviolet spectrophotometer (Eppendorf, AG2231 type), and the genomic DNA was stored at -20℃ for standby, the genomic DNA of 100 salt-sensitive grass carps and 100 salt-tolerant grass carps was subjected to PCR amplification by using the primer pair (the upstream primer of the nucleotide sequence as shown in SEQ ID NO: 2 and the downstream primer of the nucleotide sequence as shown in SEQ ID NO: 3) as shown in table 1, and referring to the reaction system and the reaction program of PCR amplification as shown in tables 2 and 3, the PCR amplification product was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing, the sequencing results of the salt-sensitive group and the salt-tolerant group in the test grass carp group at the SNP site and the peak diagram thereof were as shown in tables 4 and 5 respectively, and the genotypes of the test grass carp group were counted according to the SNP site and the peak diagram of the sequencing results, and the results were shown in table 3. Figure 5 、 Figure 6

[0071] Table 3 Genotypes of the test grass carp group

[0072]

[0073] From the sequencing results, Figure 5 、 Figure 6 and table 3, it can be known that there are 90 grass carps with CC genotype in the salt-tolerant grass carp group, accounting for 90% of the total number of the salt-tolerant group, and only 22 grass carps with CC genotype in the salt-sensitive grass carp group, accounting for 22% of the total number of the sensitive group (table 3).

[0074] The above results can prove that the 503th SNP site of the grass carp genomic sequence SEQ ID NO: 1 can provide a reliable basis for the identification of salt-tolerant grass carps.

[0075] ​The above examples are only used to illustrate the technical solutions of the present application and not to limit the protection scope of the present application. Although the present application is described in detail with reference to the above examples, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently, and these modifications or replacements are within the protection scope of the present application.

Claims

1. A SNP molecular marker for identifying salt tolerance of grass carp, characterized in that: The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO:1, wherein the base at position 503 of the sequence is T or C.

2. The SNP molecular marker for identifying salt tolerance of grass carp according to claim 1, wherein the SNP marker is a SNP marker of SEQ ID NO: 1 or 2. The nucleotide sequence of the SNP molecular marker at position 503 of the base corresponds to grass carp with genotype CC, which is salt-tolerant grass carp.

3. Use of the SNP molecular marker for identifying salt-tolerance of grass carp according to any one of claims 1-2 in grass carp assisted breeding.

4. A primer pair for detecting the SNP molecular marker for identifying the salt tolerance of grass carp according to any one of claims 1-2, characterized in that: The primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO:

3.

5. A kit for identifying salt tolerance of grass carp, characterized in that: The kit comprises the primer pair of the SNP molecular marker for identifying salt-tolerance of grass carp according to claim 4.

Images