Gene and primer group for identifying tremella aurantialba and application

Abstract

The invention provides a gene and a primer group for identifying tremella aurantialba and application, and belongs to the technical field of biological detection.Specific gene segments of two strains contained in the tremella aurantialba are obtained through large-scale whole-genome comparative analysis, species specific primers are designed on the basis of the specific gene segments, and then effective strains of the tremella aurantialba are identified; the method is extremely critical in the production process of effective strains of the tremella aurantialba, and the fruiting rate of the tremella aurantialba in the production process can be guaranteed to the maximum extent.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to genes, primer sets and applications for identifying Tremella fuciformis. Background Art

[0002] The typical characteristic of the fruiting body of golden ear (Naematelia aurantialba) is its rubbery or gelatinous brain-like outer layer, which is bright yellow or orange, and its inner layer is fibrous, relatively hard, and off-white. Golden ear is widely distributed throughout the world and is regarded as an important medicinal and edible fungus in Asia. It has a long history in traditional Chinese medicine and is often used to protect the liver, relieve coughs and reduce phlegm. Modern medical research shows that golden ear contains a variety of effective bioactive ingredients, including polysaccharides, ergosterol, vitamins, amino acids, proteins, fats, etc., and exhibits multiple pharmacological activities, including hypoglycemic and lipid-lowering, immunomodulatory, antioxidant, anti-tumor and anticoagulant effects. Golden ear has been widely cultivated on a large scale in China for more than 40 years, with an annual production capacity of approximately 3,000 tons of fresh mushrooms.

[0003] The morphological characteristics of the colloid fruiting body of golden ear resemble those of Tremella, particularly Tremella. Therefore, although the genus Naematelia was established long ago, many scientists considered it a synonym of Tremella (Tremellales). Until recently, molecular phylogenetic analysis has shown that Naematelia and Tremella represent independent phylogenetic lineages. Consequently, the name Naematilia was renamed to accommodate the N. epiphala-N. aurantia (Schwein.) Burt species complex. In fact, unlike Tremella and other homogeneous macrofungi composed of only one fungus, the golden ear fruiting body is considered a heterogeneous structure. Recent microscopic observations and ITS amplification have further confirmed the coexistence of both golden ear and Tremella within the golden ear fruiting body, but the spatial distribution and interactions between the two fungi are still understudied.

[0004] The heterogeneous fruiting body structure suggests a complex interaction between Golden Ear and Stereum hirsutum, which is clearly reflected in the innovation of Golden Ear cultivation technology. Using Golden Ear alone for cultivation cannot form Golden Ear fruiting body structures, and using Stereum hirsutum alone can only produce Stereum hirsutum fruiting bodies, but also cannot obtain Golden Ear fruiting bodies. In fact, only when the strains prepared by both fungi in a specific ratio are sown in the cultivation medium and the nutrient conversion is completed, can healthy Golden Ear fruiting bodies be obtained. This makes the production of effective strains extremely critical. To ensure the normal development of Golden Ear fruiting bodies, a detection method is urgently needed to ensure that both Golden Ear and Stereum hirsutum fungi are present in the production strains. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide genes, primer sets and applications for identifying Tremella fusca and Tremella pubescens.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides genes for identifying golden fungus and hairy leather fungus, wherein the genes are divided into golden fungus-specific genes and hairy leather fungus-specific genes;

[0008] The Tremella fusca-specific genes include Gene001315, Gene001316, Gene005441 or Gene005440;

[0009] The specific genes of the fungus Fisch include Gene000039, Gene002713, Gene005147, Gene006980 or Gene007705;

[0010] The nucleotide sequence of Gene001315 is shown in SEQ ID No. 1;

[0011] The nucleotide sequence of Gene001316 is shown in SEQ ID No. 2;

[0012] The nucleotide sequence of Gene005441 is shown in SEQ ID No. 3;

[0013] The nucleotide sequence of Gene005440 is shown in SEQ ID No. 4;

[0014] The nucleotide sequence of Gene000039 is shown in SEQ ID No. 5;

[0015] The nucleotide sequence of Gene002713 is shown in SEQ ID No. 6;

[0016] The nucleotide sequence of Gene005147 is shown in SEQ ID No. 7;

[0017] The nucleotide sequence of Gene006980 is shown in SEQ ID No. 8;

[0018] The nucleotide sequence of Gene007705 is shown in SEQ ID No.9.

[0019] The present invention provides a primer set for identifying Tremella fusca and Lederma lucidum, wherein the primer set is a primer set for amplifying Tremella fusca specific genes and Lederma lucidum specific genes;

[0020] Primer sets for amplifying T. auricularia-specific genes include N1316F / R or N5440F / R;

[0021] The primer set for amplifying the specific gene of Dermatophagoides pubescens includes primers S0039F / R or S6980F / R;

[0022] N1316F / R is used to amplify the Gene001316 gene. The nucleotide sequence of the forward primer N1316F is shown in SEQ ID No. 12, and the nucleotide sequence of the reverse primer N1316R is shown in SEQ ID No. 13;

[0023] N5440F / R is used to amplify the Gene005440 gene. The nucleotide sequence of the forward primer N5440F is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer N5440R is shown in SEQ ID No. 17;

[0024] S0039F / R is used to amplify the Gene000039 gene. The nucleotide sequence of the forward primer S0039F is shown in SEQ ID No. 18, and the nucleotide sequence of the reverse primer S0039R is shown in SEQ ID No. 19;

[0025] S6980F / R is used to amplify the Gene006980 gene. The nucleotide sequence of the forward primer S6980F is shown in SEQ ID No. 24, and the nucleotide sequence of the reverse primer S6980R is shown in SEQ ID No. 25.

[0026] The present invention provides application of the gene or the primer set in preparing a product for identifying Tremella fuciformis.

[0027] A kit for quantitative and qualitative identification of Tremella fusca and Lederma pubescens, characterized in that the kit comprises the primer set according to claim 2.

[0028] The present invention provides a method for quantitatively and qualitatively identifying Tremella fusca and Tremella pubescens, comprising the following steps:

[0029] (1) Extracting DNA from the sample to be tested;

[0030] (2) using the primer set to perform PCR or RT-PCR amplification on the DNA of the sample to be tested to obtain an amplified product;

[0031] (3) Determine whether the sample to be tested is golden fungus based on the PCR amplification product. If the PCR amplification product includes both golden fungus-specific genes and hairy leather fungus-specific genes, the sample to be tested is golden fungus. If the PCR amplification product contains only golden fungus-specific genes or hairy leather fungus-specific genes, the sample to be tested contains only a single bacterial species corresponding to the golden fungus-specific genes or the hairy leather fungus-specific genes.

[0032] (4) Determine the relative contents of Auricularia auricularia and Lepidoptera in the sample based on the RT-PCR amplification Ct value;

[0033] The primer set is the primer set for amplifying the Tricholoma auricularia specific gene and the Tricholoma auricularia specific gene according to claim 2;

[0034] The sample to be tested includes Tremella fuciformis fruiting bodies or Tremella fuciformis strains.

[0035] Preferably, the reaction system for the PCR amplification in step (2) is 8-12 μl of PCR supermix, 0.5-2 μl of forward primer, 0.5-2 μl of reverse primer, 4-8 μl of ddH2O and 1-3 μl of sample DNA;

[0036] The initial concentration of the forward primer is 8-12 μM;

[0037] The initial concentration of the reverse primer is 8-12 μM.

[0038] Preferably, the reaction procedure of the PCR amplification is pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds and extension at 57-63°C for 30 seconds, for a total of 42 cycles.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] The present invention uses large-scale whole-genome comparative analysis to obtain specific gene fragments of two fungal species contained in golden fungus, and designs species-specific primers based on this, thereby realizing the identification of effective golden fungal species, which is extremely critical in the production process of effective golden fungal species and can maximize the mushroom yield in golden fungus production. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is the distribution map of the slope and sampling points of the golden ear fruiting bodies and mushroom sticks;

[0042] Figure 2 Are the amplification efficiencies of the four candidate specific primer groups, a, b are primer combination S0039F / R; c, d are primer combination S6980F / R; e, f are primer combination N1316F / R; g, h are primer combination N5440F / R. DETAILED DESCRIPTION

[0043] The present invention provides genes for identifying golden fungus, wherein the genes are divided into golden fungus-specific genes and trichome-specific genes;

[0044] The Tremella fusca-specific genes include Gene001315, Gene001316, Gene005441 or Gene005440;

[0045] The specific genes of Stereum hirsutum include Gene000039, Gene002713, Gene005147, Gene006980 or Gene007705;

[0046] The nucleotide sequence of Gene001315 is shown in SEQ ID No.1;

[0047] SEQ ID No.1:

[0048] TCACGCCAATGACCGATGAACAGCTCGAAGACAGCATGGTGCTTGGGTTTCACAAAAGTATCAGAGATCTGTTCGATGGCGACATTGAGAAGAATGATGCGTTCCGGATAGCAGTAAGCAGTTACACTGATGTCCAGTATCCAGGGCTCTGACGTAGTTGTAGGCAGTCATCGTCACCGGTCACCCGAACGGTTTCAACAGCTCCGAGTCCTTCCAACATGAGACCTTTGCAATCCTGGATCGCGCAGTTTATCTGGCAACGCTCAAACGGCGTGGTGACCTGTCAGACGAACAACGGGGCTGGATAAGG;

[0049] The nucleotide sequence of Gene001316 is shown in SEQ ID No.2;

[0050] SEQ ID No.2:

[0051] AGTGGAAAAGGAGACGCAGTCTTCCAAACCACTAGGCATGATAGTGAGTTAGCGTCTTCCGTGGAGATTTCGGAGAGACGCGGCCCAGCTGACACGATTGACAGAAGGTCGTGGTTAGGGGCACTGAGCGGAGTTTGGCACGCTTCAATAAGGTCAAGTACAAGTCGTTTGCCAATCTGAATCGCGCCCAATACCTGGCTTCACATGATCGAAACGACCTCTCACCGAATCAAAGCAATCTGGTCGCCCGTGTCAGGTCATACAGCGATGCTCTGGAGCCTGCGGCCAGGTCTCAAGCCTTATTGACTGCCGTAGAAGCTGTATTCGGTCTTGCCGGTG;

[0052] The nucleotide sequence of Gene005441 is shown in SEQ ID No.3;

[0053] SEQ ID No.3:

[0054] CCCGTAGAGTTCCAGCGTTTCTCCGTTGTCGTCCGATCCAATAACAAACGGCCAATCCGGCAGCTTGGCCAGATACGCGAGGCCGTGAGCGGTCTCATCTTGAAACCGGGTGCACGTATCTCCCAGCTCCCAGTCTTGCCGCATGTGAGCACGGTGCTTCTCACACACACCTTTGGACCGGAACCTTTGACTTATACTGGTACTGTCACCCGGAAGAGCATGCTGCCGTGTGAGTTGACGAGTTTCGCCATACGCGTCGACCCAGAGGCGTGAGGCGTGGGGGCACGCTGATCGCGCTGGCTCGCTGACTAGGTGCCAGACAAGCGGACGCGCAAACCAAGTCAAA;

[0055] The nucleotide sequence of Gene005440 is shown in SEQ ID No.4;

[0056] SEQ ID No.4:

[0057] ATCGAAACTCGCGCAAATCGCTCTGCTGTCGGCCCGCCCCTAGGCTACACGCGCGTAGATGAAACGACCGTCGCCACGAGTGCGCAGAAAATACCCAATCTTTGGCACATCAGAATGCTCAAGCACGGCTTGACTCCCAGTCTGGACGGTGAGTCGTCCGTGGGCTGACGGACCTGCGCATGTATCGTCGTCCCCAATGCAGATGAGACATCCATAGCTGACCTCACGCAGCTCCCGACCCGTCGCGGTCCGGACTTCTCATTGCCCCCGCGCTTCGGGAGGGCGAAGACGGCCGTCAGTGGTTTCAACGGAGCAAGAGCAGTTTCCCGAACCGTA;

[0058] The nucleotide sequence of Gene000039 is shown in SEQ ID No.5;

[0059] SEQ ID No.5:

[0060] ATCCCACCGAAGTCGTTTCTCCTTTGTCAGAAGTTGGTTCAATGCTTCGAATGCCGCCTTGAGCTATTGACAAAGTCGGGTCAGCTTGAGCCTACGGTAGGATGCACCTTACAATTACCTTGCTGAATCTCCTTGAAATGGAGAGGGGTACGTACTGGTACCCATTTCTGAGAAGTTCTTCCGATACTTTTTCATACGCCGCATCGGTGAATTGACCCTTGGACGAAAGCCCATCAGCGCCCGCCTGTGCTAGACTGCTGACAATAATAGTGTCTGCTTCGAGCGTGTAG;

[0061] The nucleotide sequence of Gene002713 is shown in SEQ ID No.6;

[0062] SEQ ID No.6:

[0063] CATTTGTGGTTCGTTCTGCGTCGTACCGGGGTCAATTGAAGCGTACTTGGATTGTGCATATGGCCATGTATTTATTTTGGAGGGATATGTGCTCCTGATTGTATGTTACGACAATCTCTGGCTTGGTGAGTACCCCCCATACCCCCTCACCATCAAAAAATGTGTCGCCCTTGTTCAATTGCGTCTCATTCAGTGTCACACTGGGACCGATTGACACGTA;

[0064] The nucleotide sequence of Gene005147 is shown in SEQ ID No.7;

[0065] SEQ ID No.7:

[0066] ACATCGACACAGCAGGTCTCGCAACTGGGAGTTTTGTTTTAAATGGGTTGAAGTACTGGATTGTCGCACGTCCGGCGCCTCGCGAAGAAAATCCAGACGCTCACCTCCGATATCGTGATTACATGGTGGGCCACCGAGCAACCCGTATCAGACGATCAGATCGGTTTGAGGCTGTATATCTGGAGCAATGTACAGCCTTGTAAGTTCCATTTTTTTCATTGCGTTGAGCCGTATTCTCAATATTTTTTGGTGTAGCCTCATGCGCCCTGGAACACTGCACTACGTTCTTACTCCGTTGTCCTCCTTTGTTGCTGGG;

[0067] The nucleotide sequence of Gene006980 is shown in SEQ ID No.8;

[0068] SEQ ID No.8:

[0069] CAACGGCACACACAAAGAGGTACGGAGATACCTGGGGTACGATCTTTCTTTATTCCTATCTGATGTGGTGTCTCTGACCACGAACCTTCAGCATCACAGCCGAACGCACCGAGATCATACAGAGGTGGTGTGATACAACGTTCCGATATGATGACAGTACTGATAAAAATGCCTCGTAGCACCGTAATACTGTGGATGAGTGGGATAACCTCCAACACTTTGGACAGACCGAAGAAGTGGTCCCCTTCGAGCGTCCCGAACACAAGAAAGTCCTCGAGGTGCAATCTGCGCCACAATCAAGCCGTTTATGCCCGAGGGAGCTT;

[0070] The nucleotide sequence of Gene007705 is shown in SEQ ID No.9

[0071] SEQ ID No.9:

[0072] GGCAGAGGTTCCATACCGAGCGTAAGTACAGGAGCACGCAGAGTGCTGTCGTCGAAGTCGCTGAACAGATGAGAAGGAGGGGGAAACATATGAGCTATCAAACGCCGTTCGGAAAGCTAGCTTTATAACACGAAAACTTACAGCCTCATGTTCTTTCGAATGCTGTCCTGCCGCACTATCGCCCTCATTTCGTCGTC.

[0073] The present invention provides a primer set for identifying Tremella fuciformis, wherein the primer set is a primer set for amplifying Tremella fuciformis-specific genes and Tremella tricholoma-specific genes;

[0074] Primer sets for amplifying T. auricularia-specific genes include N1316F / R or N5440F / R;

[0075] The primer set for amplifying the specific gene of Dermatophagoides pubescens includes primers S0039F / R or S6980F / R;

[0076] N1316F / R is used to amplify the Gene001316 gene. The nucleotide sequence of the forward primer N1316F is shown in SEQ ID No. 12, and the nucleotide sequence of the reverse primer N1316R is shown in SEQ ID No. 13;

[0077] SEQ ID No.12: AGTGGAAAAGGAGACGCAGT;

[0078] SEQ ID No.13: CACCGGCAAGACCGAATACA;

[0079] N5440F / R is used to amplify the Gene005440 gene. The nucleotide sequence of the forward primer N5440F is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer N5440R is shown in SEQ ID No. 17;

[0080] SEQ ID No.16: ATCGAAACTCGCGCAAATCG;

[0081] SEQ ID No.17:TACGGTTCGGGAAACTGCTC;

[0082] S0039F / R is used to amplify the Gene000039 gene. The nucleotide sequence of the forward primer S0039F is shown in SEQ ID No. 18, and the nucleotide sequence of the reverse primer N0039R is shown in SEQ ID No. 19;

[0083] SEQ ID No.18: ATCCCACCGAAGTCGTTTCT;

[0084] SEQ ID No.19: CTACACGCTCGAAGCAGACA;

[0085] S6980F / R is used to amplify the Gene006980 gene. The nucleotide sequence of the forward primer S6980F is shown in SEQ ID No. 24, and the nucleotide sequence of the reverse primer N6980R is shown in SEQ ID No. 25.

[0086] SEQ ID No.24: CAACGGCACACACAAAGAGG;

[0087] SEQ ID No. 25: AAGCTCCCTCGGGCATAAAC.

[0088] The present invention provides application of the gene or the primer set in preparing a product for qualitatively and quantitatively identifying Tremella fuciformis.

[0089] The invention provides a kit for qualitatively and quantitatively identifying Tremella fuciformis. The kit preferably comprises the primer set, PCR supermix and ddH2O.

[0090] The present invention provides a method for qualitatively and quantitatively identifying Tremella thunbergii, comprising the following steps:

[0091] (1) Extracting DNA from the sample to be tested;

[0092] (2) using the primer set to perform PCR or RT-PCR amplification on the DNA of the sample to be tested to obtain an amplified product;

[0093] (3) Determine whether the sample to be tested is golden fungus or the bacterial distribution of golden fungus based on the PCR amplification product. If the PCR amplification product includes both golden fungus-specific genes and hairy leather-like fungus-specific genes, the sample to be tested is golden fungus. If the PCR amplification product only contains golden fungus-specific genes or hairy leather-like fungus-specific genes, the sample to be tested only contains a single bacterial species corresponding to the golden fungus-specific genes or hairy leather-like fungus-specific genes.

[0094] (4) Determine the relative contents of Auricularia auricularia and Lepidoptera in the sample based on the RT-PCR amplification Ct value;

[0095] The primer set is a primer set for amplifying the Tremella fusca-specific gene and the Tremella pubescens-specific gene;

[0096] The sample to be tested includes Tremella fuciformis fruiting bodies or Tremella fuciformis strains.

[0097] In the present invention, the reaction system of the PCR amplification in step (2) is a PCR supermix, a forward primer, a reverse primer, ddH2O and a sample DNA;

[0098] The volume of the PCR supermix is preferably 8 to 12 μl, more preferably 9 to 11 μl, and even more preferably 10 μl;

[0099] The volume of the forward primer is preferably 0.5 to 2 μl, more preferably 0.7 to 1.5 μl, and even more preferably 1 μl; the initial concentration of the forward primer is preferably 8 to 12 μM, more preferably 9 to 11 μM, and even more preferably 10 μM;

[0100] The reverse primer is preferably 0.5 to 2 μl, more preferably 0.7 to 1.5 μl, and even more preferably 1 μl; the initial concentration of the reverse primer is preferably 8 to 12 μM, more preferably 9 to 11 μM, and even more preferably 10 μM;

[0101] The volume of ddH2O is preferably 4 to 8 μl, more preferably 5 to 7 μl, and even more preferably 6 μl;

[0102] The volume of the sample DNA is preferably 1-3 μl, more preferably 1.5-2.5 μl, and even more preferably 2 μl; the initial concentration of the sample DNA is preferably 10-50 μM, more preferably 15-35 μM, and even more preferably 25 ng / uL.

[0103] In the present invention, the reaction procedure of PCR amplification is pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds and extension for 30 seconds, for a total of 42 cycles. The extension temperature is preferably 57-63°C, more preferably 58-61°C, and even more preferably 60°C.

[0104] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0105] Example 1 Development of species-specific primers for Tremella fuciformis and Lepidoptera

[0106] We downloaded the published genomes of 54 species of the Agaricomycetes (Table 1), including 12 species of Tremellomycetes, 2 species of Dacrymycetes, 38 species of Agaricomycetes, and 2 species of Wallemiomycetes. We performed comparative genomic analysis and compared these 56 genomes with the genomes of Agaricus spp. and Dermatophytes spp. We identified species-specific genes in Agaricus spp. and Dermatophytes spp., and used these as a basis for designing species-specific primers. Details of the 56 genomes are shown in Table 1.

[0107] Table 1 Detailed information of the 56 genomes used for comparative genomic analysis

[0108]

[0109]

[0110]

[0111] The genomes of Auricularia auricularia and Dermatophagoides tricholoma have been uploaded to https: / / doi.org / 10.6084 / m9.figshare.28581020.

[0112] The specific operation of the method for screening specific genes is briefly described as follows: first, based on the coding proteins of 56 species, OrthoFinder was used to analyze the orthologous genes, and the coding proteins that only exist in the genomes of Auricularia auricularia and Lepidoptera were selected. The genes and genomic sequences corresponding to the coding proteins were extracted as candidate species-specific gene sequences; then, the candidate sequences were compared with the genomes of other species using blastn, and the sequences with an evalue less than 10 were eliminated. -20 Potential homologous sequences with a length of more than 200 bp were selected; finally, the remaining species-specific sequences were compared with the NCBI database to confirm that they had the highest homology only in the target species.

[0113] Homology analysis showed that the 56 species had an average of 1,610 orthologous genes, and each species had a varying number of species-specific genes, with Auricularia auricularia and Lederma lucidum having 506 and 3,614 genes, respectively.

[0114] By comparing the nucleic acid sequences of the target genes within and between species and eliminating potential non-specific sequences, we ultimately selected four species-specific genes, Gene001315, Gene001316, Gene005441, and Gene005440, from Auricularia auricularia, and five species-specific genes, Gene000039, Gene002713, Gene005147, Gene006980, and Gene007705, from Dermatophagoides pubescens, as species-specific sequence fragments. These genes were found to have no homologous sequences outside the target species in 56 candidate species, as well as in the NCBI Nucleotide collection (nr / nt), Whole-genome shotgun contigs (wgs), Expressed sequence tags (est), Transcriptome Shotgun Assembly (TSA), and High throughput genomic sequences (HTGS) databases, indicating their species specificity. The specific nucleotide sequences of the specific genes are as follows:

[0115] The nucleotide sequence of Gene001315 is shown in SEQ ID No. 1;

[0116] SEQ ID No. 1:

[0117] TCACGCCAATGACCGATGAACAGCTCGAAGACAGCATGGTGCTTGGGTTTCACAAAAGTATCAGAGATCTGTTCGATGGCGACATTGAGAAGAATGATGCGTTCCGGATAGCAGTAAGCAGTTACACTGATGTCCAGTATCCAGGGCTCTGACGT AGTTGTAGGCAGTCATCGTCACCGGTCACCCGAACGGTTTCAACAGCTCCGAGTCCTTCCAACATGAGACCTTTGCAATCCTGGATCGCGCAGTTTATCTGGCAACGCTCAAACGGCGTGGTGACCTGTCAGACGAACAACGGGGCTGGATAAGG;

[0118] The nucleotide sequence of Gene001316 is shown in SEQ ID No. 2;

[0119] SEQ ID No. 2:

[0120] AGTGGAAAAGGAGACGCAGTCTTCCAAACCACTAGGCATGATAGTGAGTTAGCGTCTTCCGTGGAGATTTCGGAGAGACGCGGCCCAGCTGACACGATTGACAGAAGGTCGTGGTTAGGGGCACTGAGCGGAGTTTGGCACGCTTCAATAAGGTCAAGTACAAGTCGTTTGCCAATCTGAATCGCGCCCAATACCTGGCTTCACATGATCGAAACGACCTCTCACCGAATCAAAGCAATCTGGTCGCCCGTGTCAGGTCATACAGCGATGCTCTGGAGCCTGCGGCCAGGTCTCAAGCCTTATTGACTGCCGTAGAAGCTGTATTCGGTCTTGCCGGTG;

[0121] The nucleotide sequence of Gene005441 is shown in SEQ ID No.3;

[0122] SEQ ID No.3:

[0123] CCCGTAGAGTTCCAGCGTTTCTCCGTTGTCGTCCGATCCAATAACAAACGGCCAATCCGGCAGCTTGGCCAGATACGCGAGGCCGTGAGCGGTCTCATCTTGAAACCGGGTGCACGTATCTCCCAGCTCCCAGTCTTGCCGCATGTGAGCACGGTGCTTCTCACACACACCTTTGGACCGGAACCTTTGACTTATACTGGTACTGTCACCCGGAAGAGCATGCTGCCGTGTGAGTTGACGAGTTTCGCCATACGCGTCGACCCAGAGGCGTGAGGCGTGGGGGCACGCTGATCGCGCTGGCTCGCTGACTAGGTGCCAGACAAGCGGACGCGCAAACCAAGTCAAA;

[0124] The nucleotide sequence of Gene005440 is shown in SEQ ID No.4;

[0125] SEQ ID No.4:

[0126] ATCGAAACTCGCGCAAATCGCTCTGCTGTCGGCCCGCCCCTAGGCTACACGCGCGTAGATGAAACGACCGTCGCCACGAGTGCGCAGAAAATACCCAATCTTTGGCACATCAGAATGCTCAAGCACGGCTTGACTCCCAGTCTGGACGGTGAGTCGTCCGTGGGCTGACGGACCTGCGCATGTATCGTCGTCCCCAATGCAGATGAGACATCCATAGCTGACCTCACGCAGCTCCCGACCCGTCGCGGTCCGGACTTCTCATTGCCCCCGCGCTTCGGGAGGGCGAAGACGGCCGTCAGTGGTTTCAACGGAGCAAGAGCAGTTTCCCGAACCGTA;

[0127] The nucleotide sequence of Gene000039 is shown in SEQ ID No.5;

[0128] SEQ ID No.5:

[0129] ATCCCACCGAAGTCGTTTCTCCTTTGTCAGAAGTTGGTTCAATGCTTCGAATGCCGCCTTGAGCTATTGACAAAGTCGGGTCAGCTTGAGCCTACGGTAGGATGCACCTTACAATTACCTTGCTGAATCTCCTTGAAATGGAGAGGGGTACGTACTGGTACCCATTTCTGAGAAGTTCTTCCGATACTTTTTCATACGCCGCATCGGTGAATTGACCCTTGGACGAAAGCCCATCAGCGCCCGCCTGTGCTAGACTGCTGACAATAATAGTGTCTGCTTCGAGCGTGTAG;

[0130] The nucleotide sequence of Gene002713 is shown in SEQ ID No.6;

[0131] SEQ ID No.6:

[0132] CATTTGTGGTTCGTTCTGCGTCGTACCGGGGTCAATTGAAGCGTACTTGGATTGTGCATATGGCCATGTATTTATTTTGGAGGGATATGTGCTCCTGATTGTATGTTACGACAATCTCTGGCTTGGTGAGTACCCCCCATACCCCCTCACCATCAAAAAATGTGTCGCCCTTGTTCAATTGCGTCTCATTCAGTGTCACACTGGGACCGATTGACACGTA;

[0133] The nucleotide sequence of Gene005147 is shown in SEQ ID No. [CDATA[7]];

[0134] SEQ ID No.7:

[0135] ACATCGACACAGCAGGTCTCGCAACTGGGAGTTTTGTTTTAAATGGGTTGAAGTACTGGATTGTCGCACGTCCGGCGCCTCGCGAAGAAAATCCAGACGCTCACCTCCGATATCGTGATTACATGGTGGGCCACCGAGCAACCCGTATCAGACGATCAGATCGGTTTGAGGCTGTATATCTGGAGCAATGTACAGCCTTGTAAGTTCCATTTTTTTCATTGCGTTGAGCCGTATTCTCAATATTTTTTGGTGTAGCCTCATGCGCCCTGGAACACTGCACTACGTTCTTACTCCGTTGTCCTCCTTTGTTGCTGGG;

[0136] The nucleotide sequence of Gene006980 is shown in SEQ ID No. [CDATA[8]];

[0137] SEQ ID No.8:

[0138] CAACGGCACACACAAAGAGGTACGGAGATAACCTGGGGTACGATCTTTCTTTATTCCTATCTGATGTGGTGTCTCTGACCACGAACCTTCAGCATCACAGCCGAACGCACCGAGATCATACAGAGGTGGTGTGATACAACGTTCCGATATGATGACAGTACTG ATAAAAATGCCTCGTAGCACCGTAATACTGTGGATGAGTGGGATAACCTCCAACACTTTGGACAGACCGAAGAAGTGGTCCCTTCGAGCGTCCCGAACACAAGAAAGTCCTCGAGGTGCAATCTGCGCCACAATCAAGCCGTTTATGCCCGAGGGAGCTT;

[0139] The nucleotide sequence of Gene007705 is shown in SEQ ID No. 9

[0140] SEQ ID No.9:

[0141] GGCAGAGGTTCCATACCGAGCGTAAGTACAGGAGCACGCAGAGTGCTGTCGTCGAAGTCGCTGAACAGATGAGAAGGAGGGGGAAACATATGAGCTATCAAACGCCGTTCGGAAAGCTAGCTTTATAACACGAAAACTTACAGCCTCATGTTCTTTCGAATGCTGTCCTGCCGCACTATCGCCCTCATTTCGTCGTC.

[0142] Primer design was performed using the primer-BLAST program. Upstream and downstream primers were preferably adapted to the exon region, with target sequence lengths ranging from 150 to 350 bp, an annealing temperature of 60°C ± 3°C, and a preferred primer length of 20 bp. Primer sets were selected as candidate primers if each upstream and downstream primer had no more than four self-complementarities and no more than two self-3' complementarities. Primer synthesis was performed by Qingke Biotechnology Co., Ltd. (Beijing, China).

[0143] To verify primer specificity, the designed primers were used to amplify pure strains of Dermatophagoides pubescens and Auricularia auricularia. The results showed that the species-specific primers only effectively amplified the corresponding species, with no amplification between the corresponding species, confirming the species specificity of these primers. See Table 2 for details of the primers.

[0144] Table 2 Species-specific primers for Auricularia auricularia and Auricularia pubescens

[0145]

[0146]

[0147] ND means that the specific fragment was not detected.

[0148] Example 2 Cultivation and Sample Collection of Tremella fuciformis Fruiting Bodies

[0149] The golden ear fruiting bodies (with fresh mushroom sticks) used in this experiment were cultivated under factory-scale conditions. The cultivation method is briefly described as follows: the cultivation bags measured 18 x 33 cm, each mushroom stick weighed approximately 2 kg, and the compost mixture consisted of 58.5% sawdust, 30% cottonseed hulls, 10% bran, and 1.5% lime. A liquid inoculum mixture of golden ear and leather fungi was used. Two inoculations were made on one side of the mushroom stick, with 1 mL of the mixed inoculum at each site. After inoculation, the fruiting bodies were incubated at a constant temperature of 24°C. After approximately 25 days, the mycelium grew completely throughout the entire stick. Thirty days after inoculation, the fruiting bodies were transferred to the fruiting room for stimulating and managing the fruiting process. The fruiting body cultivation temperature was 22-23°C, and the air humidity was 85-95%. Healthy, mature fruiting bodies (with mushroom sticks) were selected for subsequent experiments.

[0150] Cut the complete golden ear fruiting body and the matrix in half along the central position of the golden ear fruiting body and the vertical surface of the mushroom stick (see Figure 1 ), nine regional samples were cut from the upper to the lower part of the cross section, including the outermost extension of the golden ear fruiting body (mainly golden yellow tissue) as L01, the intersection of the golden yellow tissue and the white tissue as L02, the center of the fruiting body as L03, the mushroom flesh as L04, and the intersection of the fruiting body and the matrix as L05; continue straight down, and evenly sample 4 points (the sampling point spacing is about 3cm), which are L06-L09 in turn, among which L07 is the middle point of the mushroom stick. The size and volume of the samples taken are all 1cm 3 , equal amounts of samples were taken from the corresponding positions of three different samples, and the samples from the same sampling point were mixed before use.

[0151] Example 3 Extraction of genomic DNA

[0152] The genomic DNA was extracted using a magnetic bead plant DNA extraction kit (the source of the magnetic bead plant DNA extraction kit was ONREW, Plant DNA Extraction CZ kit, DNP621-02C, Guangzhou Haiyan, China; the cleaning solution was Buffer W1A in the kit, and the dissolving solution was Buffer EB in the kit), and genomic DNA was extracted with the help of a fully automatic DNA extractor. The extraction method is briefly described as follows: first, the sample obtained in Example 2 was ground into powder using liquid nitrogen, and about 0.2 g of powder was added to 500 μl of lysis buffer. After vortexing and dispersion, the mixture was allowed to stand for 15 minutes, and then centrifuged at 13,000 rpm to obtain a supernatant. Then, according to the instructions of the fully automatic DNA extractor, the supernatant, MagExtract Suspension, cleaning solution, 70% ethanol and dissolving solution were placed in the corresponding equipment chambers for automatic DNA extraction. After the extracted DNA was quality inspected by nanodrop, it was stored at 4°C or used directly.

[0153] Example 4 Detection of amplification efficiency of species-specific primers

[0154] Three samples, L02, L03 and L05, were randomly selected to test the amplification efficiency of the designed species-specific primers. The initial genome concentration obtained from the samples was diluted to a final concentration of 100 ng / ul, and then diluted in a gradient of 1 / 10 to 10 - 3 ng / ul, a total of 6 dilution gradients. Detection was performed on a Bio-rad CFX quantitative PCR instrument, and the 20μl PCR reaction system was 10μl iTaq Universal Green Supermix, 1 μl of 10 μM forward and reverse primers, 6 μl of ddH₂O, and 2 μl of DNA template. The PCR reaction program was: 95°C initial denaturation for 5 min, followed by 42 cycles of denaturation at 95°C for 10 s and extension at 60°C for 30 s. Fluorescence signals were read after each reaction, and melting curves were performed after the reaction was complete. Each reaction was performed in triplicate.

[0155] After the PCR reaction, a standard curve is drawn with the logarithmic value of the template series concentration multiple as the X-axis and the corresponding Ct value as the Y-axis. After the standard curve is drawn, it needs to be evaluated. There are two evaluation indicators: correlation coefficient R 2 and amplification efficiency (E). Correlation coefficient R 2 It not only reflects the linear relationship of the data, but is also mainly used to evaluate the repeatability of repeated samples and whether the initial templates with different concentrations have the same amplification efficiency. 2The value should be greater than 0.98. Values closer to 1 indicate a stronger linear relationship and higher data accuracy. Amplification efficiency (E) is calculated as follows: E = (10^(-1 / slope)) - 1. It is generally believed that amplification efficiency (E) should be between 90% and 100%, corresponding to a slope between -3.58 and -3.1.

[0156] Agarose gel electrophoresis results showed that the four primer sets S0039F / R, S6980F / R, N1316F / R and N5440F / R could all produce clear amplification bands. Quantitative PCR analysis of the amplification melting curves and amplification efficiency of the candidate primers showed that the amplification efficiencies of S0039F / R and S6980F / R were 92.03% and 97.17%, respectively, and the melting curves showed a sharp single peak. The amplification efficiencies of N1316F / R and N5440F / R were 98.72% and 99.40%, respectively, and the melting curves showed a sharp single peak, indicating their effectiveness ( Figure 2 ).

[0157] Example 5 Detection of the spatial position of Tricholoma auricularia fruiting bodies and fungus rods using species-specific primers

[0158] RT-PCR detection was performed on the two genotype contents in 9 spatial locations of the golden ear fruiting body and its matrix using the four pairs of primers S0039F / R, S6980F / R, N1316F / R and N5440F / R screened out to determine the gene content of golden ear and leather fungus in different spatial locations, and 3 biological replicates were performed for each sample. The PCR reaction system and amplification conditions are as described in Example 4. The difference in the relative gene content of golden ear and leather fungus was calculated as follows: in the same sample tissue, the Ct value (threshold cycle number) of the leather fungus species-specific gene amplification was subtracted from the Ct value of the golden ear species-specific gene amplification to obtain ΔCt. The relative ratio of the gene content between the two species was then obtained by exponential operation 2^(-ΔCt).

[0159] The amplification results showed that the two primers for Dermatophagoides pubescens could amplify effective results at 9 spatial positions, with amplification Ct values ranging from 18.94 to 25.79. There was no significant difference in the amplification between the two primers at the 9 spatial positions (p=0.0001), indicating the stability of their amplification.

[0160] The two T. auriculariae-specific primers effectively amplified the gene at nine spatial locations, L01-L07, with Ct values ranging from 21.91 to 35.21. There was no significant difference in amplification between the two primers across the seven samples (p = 1.12e-05). In fact, a Ct value greater than 35 indicates extremely low gene content, which is consistent with the absence of T. auriculariae-specific genes at locations L08-L09.

[0161] The gene content of the two species at nine spatial locations was calculated using the average difference in Ct values amplified using two primers specific for each species. The results showed that the gene content ratio between the two species gradually increased from the top of the fruiting body to the bottom of the matrix. The two species were closest at the top, with a gene content difference of 1.51-fold. This difference reached 6.52-fold at the base of the fruiting body, and as high as 520.95-fold at the center of the matrix. Further down, no T. auricularia-specific genes were detected. This difference in gene content indicates the heterogeneity of the fruiting body and that nutritional metabolism in the matrix is dominated by C. tomentosa (Table 3).

[0162] Table 3 Differences in gene content between the fungi Ceratium pubescens and Auricularia auricularia in the fruiting bodies and culture medium

[0163]

[0164] Experimental Example 6 Detection of the genotype content of two fungi in commercial strains

[0165] Three valid samples (producing mushrooms normally) and three invalid samples (not producing mushrooms normally) of golden ear fungus were collected from the market for genotyping. The specific steps included centrifuging the liquid culture at 12,000 rpm to obtain a mycelial pellet; extracting genomic DNA according to the aforementioned DNA extraction method, testing it with a nanodrop, and then diluting it to a final concentration of 25 ng / uL. The DNA was then stored at 4°C or used directly. The genotypes of the two fungi were quantitatively detected and analyzed using the aforementioned amplification conditions, with three biological replicates performed for each sample.

[0166] The results are shown in Table 4. Both P. pubescens and A. fusca were detected in all three valid samples (Sample 01-Sample 03). The average Ct values for P. pubescens ranged from 19.23 to 20.74, while those for A. fusca ranged from 23.36 to 25.22, indicating that the genotype content of P. pubescens was significantly higher than that of A. fusca. Relative content calculations showed significant differences among the three valid samples, ranging from a low of 6.63 times (Sample 01) to a high of 37.05 times (Sample 02).

[0167] Testing of the three samples that failed to produce mushrooms (Sample 04-Sample 06) revealed that they all successfully amplified genes specific to the fungus Lederma lucidum, but were negative for specific amplification of the golden fungus. Further quantitative RT-PCR analysis revealed that the Ct values for Lederma lucidum ranged from 18.04 to 18.98, with average amplification values ranging from 18.46 ± 0.48 (primer set S0039R / F) to 18.50 ± 0.31 (primer set S6980R / F). No golden fungus genes were amplified (Table 4). These data suggest that the fungus strains that failed to produce mushrooms contained only Lederma lucidum and lacked golden fungus, which may be the root cause of the failure.

[0168] Table 4 Analysis of genotype content of two fungi in commercial liquid culture

[0169]

[0170]

[0171] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A gene for identifying golden ear, characterized in that The genes are Tricholoma auricularia specific genes and Tricholoma auricularia specific genes; The Tremella fusca-specific genes include Gene001315, Gene001316, Gene005441 or Gene005440; The specific genes of the fungus Fisch include Gene000039, Gene002713, Gene005147, Gene006980 or Gene007705; The nucleotide sequence of Gene001315 is shown in SEQ ID No. 1; The nucleotide sequence of Gene001316 is shown in SEQ ID No. 2; The nucleotide sequence of Gene005441 is shown in SEQ ID No. 3; The nucleotide sequence of Gene005440 is shown in SEQ ID No. 4; The nucleotide sequence of Gene000039 is shown in SEQ ID No. 5; The nucleotide sequence of Gene002713 is shown in SEQ ID No. 6; The nucleotide sequence of Gene005147 is shown in SEQ ID No. 7; The nucleotide sequence of Gene006980 is shown in SEQ ID No. 8; The nucleotide sequence of Gene007705 is shown in SEQ ID No.

9.

2. A primer set for identifying Tremella fuciformis, characterized in that: The primer set is a primer set for amplifying the specific gene of Tremella fusca and the specific gene of Lepidoptera: Primer sets for amplifying T. auricularia-specific genes include N1316F / R or N5440F / R; The primer set for amplifying the specific gene of Dermatophagoides pubescens includes primers S0039F / R or S6980F / R; N1316F / R is used to amplify the Gene001316 gene according to claim 1, the nucleotide sequence of the forward primer N1316F is shown in SEQ ID No. 12, and the nucleotide sequence of the reverse primer N1316R is shown in SEQ ID No. 13; N5440F / R is used to amplify the Gene005440 gene according to claim 1, the nucleotide sequence of the forward primer N5440F is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer N5440R is shown in SEQ ID No. 17; S0039F / R is used to amplify the Gene000039 gene according to claim 1, the nucleotide sequence of the forward primer S0039F is shown in SEQ ID No. 18, and the nucleotide sequence of the reverse primer S0039R is shown in SEQ ID No. 19; S6980F / R is used to amplify the Gene006980 gene according to claim 1. The nucleotide sequence of the forward primer S6980F is shown in SEQ ID No. 24, and the nucleotide sequence of the reverse primer S6980R is shown in SEQ ID No.

25.

3. Use of the gene according to claim 1 or the primer set according to claim 2 in identifying Tremella fuciformis products.

4. A kit for quantitative and qualitative identification of Tremella fuciformis and Lederma lucidum, characterized in that: The kit comprises the primer set according to claim 2.

5. A method for quantitatively and qualitatively identifying Tremella fuciformis and Lederma lucidum, characterized in that: The steps include: (1) Extracting DNA from the sample to be tested; (2) performing PCR or RT-PCR amplification on the DNA of the sample to be tested using the primer set to obtain an amplified product; (3) Determine whether the sample to be tested is golden fungus based on the PCR amplification product. If the PCR amplification product includes both golden fungus-specific genes and hairy leather fungus-specific genes, the sample to be tested is golden fungus. If the PCR amplification product contains only golden fungus-specific genes or hairy leather fungus-specific genes, the sample to be tested contains only a single bacterial species corresponding to the golden fungus-specific genes or the hairy leather fungus-specific genes. (4) Determine the relative contents of Auricularia auricularia and Lepidoptera in the sample based on the RT-PCR amplification Ct value; The primer set is the primer set for amplifying the Tricholoma auricularia specific gene and the Tricholoma auricularia specific gene according to claim 2; The sample to be tested includes Tremella fuciformis fruiting bodies or Tremella fuciformis strains.

6. The method according to claim 5, characterized in that The reaction system for the PCR amplification in step (2) is 8-12 μl of PCR mixture, 0.5-2 μl of forward primer, 0.5-2 μl of reverse primer, 4-8 μl of ddH2O and 1-3 μl of sample DNA; The initial concentration of the forward primer is 8-12 μM; The initial concentration of the reverse primer is 8-12 μM; The initial concentration of the sample DNA is 10-50 ng / uL.

7. The method according to claim 6, characterized in that The reaction procedure of the PCR amplification was 95° C. pre-denaturation for 5 min; 95° C. denaturation for 10 s and 57-63° C. extension for 30 s, for a total of 42 cycles.

Images