Exosome multi-target detection method based on nano-frame multi-satellite mode

Abstract

According to the exosome multi-target detection method based on the nano-frame multi-satellite mode, a high-stability tetrahedron is used as a core skeleton, multiple high-protein-affinity nucleic acid aptamer tongs are assembled and matched according to needs to construct a high-reproducibility biomarker recognition element, a molecular form with multiple satellites wrapping exosome is constructed, and the exosome multi-target detection method based on the nano-frame multi-satellite mode is obtained. According to the method, a'free satellite 'element is formed, and flow cytometry is utilized to detect the particle size and output signals with ultralow background interference, so that multiple detection requirements of different tumors on different expression levels of different markers in different development processes can be met, and an identification-separation-detection integrated high-specificity exosome detection strategy is realized. Clinical examination and diagnosis requirements serve as fundamental guidance, detection potential is excavated on an existing basic flow platform, instrument detection particle size limitation is turned into background killer, a new instrument detection thought is widened, detection performance is improved, exosome encrypted information decoding is accelerated, and the transformation progress of clinical disease prevention and treatment and tumor diagnosis and treatment is promoted and guided.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and specifically relates to a multi-target exosome detection method based on a nanoframe multi-satellite modality. Background Art

[0002] Exosomes act as "postmen" and transport a large amount of

[0003] Biomacromolecules such as microRNA, mRNA, and proteins, rich in stable, sensitive, and unique genetic and disease information, circulate extensively and stably in biological fluids. They "secretly" transport substances and transmit information between cells, regulating environmental homeostasis and participating in immune evasion and tumor invasion and metastasis. Intercepting exosome transporters, deciphering this information, and obtaining cellular epigenetic profiles and multi-omics information are crucial for early cancer diagnosis and treatment, disease progression monitoring, and prognosis. To improve detection rates and reduce nonspecific interference, exosomes require isolation and enrichment pretreatment before detection. Traditional methods for separation and purification include density gradient centrifugation, differential centrifugation, ultrafiltration, immunoaffinity capture, and size exclusion chromatography (SEC). While these traditional methods offer significant advantages in stability and versatility, conventional centrifugation methods suffer from operational complexity, time-consuming procedures, low exosome recovery rates, and low purity due to the inclusion of small vesicles and low-molecular-weight proteins. While ultrafiltration is simple and can handle large sample volumes, exosomes are susceptible to damage such as morphological changes and functional loss due to filtration pressure. High-cost, low-throughput immunocapture methods rely solely on highly specific antibody recognition, which can lead to a hook effect that compromises extraction recovery. These limitations hinder clinical translation.

[0004] Exosomal proteins are the ultimate executors of life's activities. Their characteristics, such as species, abundance, modifications, and interactions, play a crucial role in the development of life and tumors. Proteomics, a key research field in the post-genomic era, aims to holistically analyze the structure, function, and dynamic changes of exosomal proteins, thereby revealing the essence and laws of life's activities. The emergence of high-throughput mass spectrometry technology has provided powerful technical support for the precise analysis and quantification of exosomal proteins. However, the high cost, high precision of diverse instruments, complex operation, and a shortage of professional and technical personnel have greatly limited the implementation of precision medicine at the grassroots level.

[0005] Deoxyribonucleic acid (DNA), as a carrier of genetic information, participates in the growth and development of organisms and the progression of disease. In recent years, its excellent physicochemical properties, including high biocompatibility and highly programmable properties, have made it a high-performance signal recognition and amplification element in disease diagnosis, testing, and treatment. Aptamers, a class of single-stranded oligonucleotides screened through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process, can form three-dimensional folded structures and bind to target molecules with high specificity and selectivity. Their low cost, low immunogenicity, high specificity, high affinity, high stability, and reversibility have challenged the entrenched position of antibodies in covalent recognition, making them ideal tools for identifying exosomes.

[0006] In recent years, researchers have innovatively proposed multimodal, multichannel, high-throughput intelligent biosensor platforms, providing more comprehensive and accurate information for disease diagnosis, treatment, and prognosis assessment. Li et al. developed a paper-based surface-enhanced Raman spectroscopy (SERS)-vertical flow biosensor to quantitatively analyze the clinical utility of MUC1, HER2, and CEA, which is helpful for non-invasive breast cancer subtyping and longitudinal treatment monitoring, and realizes the transformation of micro-sample POCT rapid detection. Weissleder et al. are also committed to distinguishing heterogeneous exosomes. By developing high-throughput fluorescence detection channels, they use antibody-specific capture and super-resolution imaging to achieve high-specificity detection of exosomes. However, the low sensitivity caused by the chain reaction of low amplification intensity, the high difficulty of paper-based production, the result errors caused by crosstalk between the porous substrates, the antibody hook effect, and the high cost are key points that need to be improved in the future development process.

[0007] Subsequently, researchers leveraged the high specificity and affinity of aptamers to design a series of recognition probes targeting exosome surface markers. These probes can accurately recognize and bind to target exosomes, enabling efficient isolation and purification of exosomes and providing strong support for disease diagnosis. Chen et al. developed a separation- and label-free portable aptamer sensor for rapid and sensitive analysis of lung cancer exosome markers PD-L1 and MUC-1. The handheld fluorometer achieved a limit of detection (LOD) of as low as 30 particles / mL for cell-derived exosomes. Li et al. designed a DNA cascade reaction-triggered individual exosome nanoencapsulation strategy. This strategy eliminates the need for ultracentrifugation purification of serum samples and enables ultrasensitive and specific detection of liver cancer-derived exosome subpopulations using conventional flow cytometry in a one-pot, one-step approach, effectively differentiating between HCC, cirrhosis, and healthy donors. However, the difficulty of system construction, implementation stability, and complexity of experimental conditions are key considerations for clinical application.

[0008] Therefore, how to use the highly programmable and low-cost DNA self-assembly technology to identify and detect multiple biomarkers of exosomes is an important way to improve the accuracy of exosome detection and enhance the efficiency of disease diagnosis. Summary of the Invention

[0009] 1. Assembly of highly stable nucleic acid nanoelement

[0010] Four DNA chains with linker sequences are assembled based on the principle of complementary base pairing to form a regular tetrahedral structure in space. Due to the high stability of the tetrahedron, nuclease resistance is guaranteed during system detection, safeguarding the detection of sample exosomes. The exposed linkers act as grippers at the four corners of the tetrahedron. By adding different DNA aptamer sequences that are complementary to the linkers, the assembly can be completed to construct a basic nanoelement. Each type of aptamer is modified with a different fluorescent group at the 3' end. When the target is present, the aptamer specifically recognizes the protein, undergoes conformational changes to produce an active site, and then connects. The fluorescent group can then label specific exosomes.

[0011] 2. Evaluation of exosome detection performance based on multiple nanosatellite components

[0012] Four tetrahedrons, each linked to a different aptamer, were constructed as assembly elements. The same concentration of these elements was added to form a mixture, to which exosomes of varying concentrations were added. After a two-hour incubation, the mixture was analyzed for signal detection using a flow cytometer. Because each aptamer type is modified with a different fluorophore at its 3' end, the satellite elements form a bridge between molecular entanglement and collisions, connecting to specific exosomes to form multimers larger than 500 nanometers. The flow cytometer then outputs signals of varying fluorescence intensity.

[0013] 3. Compared with the current detection methods for exosomes, the benefits of the present invention are:

[0014] 2) Compared with other exosome detection sensors, this method innovatively develops a simple and clever assembly and highly flexible nucleic acid nanoframe structure with simple principle, easy installation, small clinical transformation span, and easy to compare with various clinical indicators.

[0015] Combined detection improves diagnostic efficiency.

[0016] 3) Compared with other exosome detection methods, this method cleverly utilizes the inherent limitations of the detection range of ordinary flow cytometers.

[0017] The sensitivity defect is converted into a background signal filter, and a multi-layer filter with a simple platform and easy construction is developed.

[0018] Target-type simple detection device.

[0019] 4) Compared with the traditional exosome step-by-step detection method, this method builds a multi-satellite detection system based on a highly compatible nucleic acid assembly system.

[0020] The detection mode breaks through the cumbersome mode of traditional exosome pre-treatment, enriches sample exosomes without separation, and specifically

[0021] Realizes simultaneous detection of multiple targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the scheme of the present invention's multi-target detection method for exosomes based on nanoframe multi-satellite modality.

[0023] Figure 2 This is the result of the detection of four markers in exosomes based on a flow cytometry platform in the present invention.

[0024] Figure 3 These are the detection results of four markers of different tumor-derived exosomes based on the nanoframe multi-satellite modality of the present invention.

[0025] Figure 4 This is the condition optimization result of the present invention for multi-target detection of different tumor-derived exosomes based on nanoframe multi-satellite modality.

[0026] Figure 5 This is the sensitivity result of the present invention for multi-target detection of exosomes based on the nanoframe multi-satellite modality.

[0027] TNFS: Tetrahedral Nanoframe Satellite

[0028] Apt: aptamer

[0029] PD-L1: Programmed cell death-ligand 1

[0030] MUC1: mucin

[0031] EpCAM: epithelial cell adhesion molecule

[0032] HER2: human epidermal growth factor receptor-2 DETAILED DESCRIPTION

[0033] The present invention relates to a method for detecting exosomes, which is specifically implemented as follows: first, Figure 1As shown, four DNA chains with linker sequences are assembled according to the principle of base complementary pairing to form a regular tetrahedron structure in space. The regular tetrahedron has a high degree of stability and can ensure nuclease resistance in system detection, which provides a stable basis for exosome detection. The linkers exposed on the four corners of the tetrahedron can act as grippers, and the assembly is completed by adding different DNA aptamer sequences containing linker complementarity to construct a basic nanoelement. The 3' end of each type of aptamer is modified with a different fluorescent group. Then, the four constructed tetrahedrons connected with different aptamers are used as assembly elements, and these assembly elements of the same concentration are added to form a mixture.

[0034] Exosomes at varying concentrations were then added to the mixture, followed by a two-hour incubation. During this process, when the target is present, the aptamer specifically recognizes the protein, undergoes conformational changes, and creates an active site for binding. The fluorescent group at its 3' end can then label specific exosomes. Due to the specific binding of each aptamer and the role of the satellite elements in bridging molecular entanglement and collisions, specific exosomes are linked to form multimers exceeding 500 nanometers in size.

[0035] Finally, the incubated mixture is subjected to signal detection in a flow cytometer. Since different types of aptamers are linked to different fluorescent groups, the flow cytometer can output signals of different fluorescence and different intensities, thereby enabling the detection of exosomes. This exosome detection method based on tetrahedral structure and aptamer-specific recognition is innovative. Traditional detection methods may lack such a stable structural basis and highly specific and flexible labeling methods. The present invention utilizes the stability of the tetrahedral structure to ensure the stability of the detection system, while achieving efficient and specific detection of exosomes through the specific recognition of aptamers and fluorescent labeling, providing a new and reliable detection idea and technical means for the field of exosome detection.

[0036] Experimental Materials

[0037] HPLC-purified oligonucleotide chains and PBS buffer were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. Human breast adenocarcinoma cells (SK-BR-3), human breast cancer cells (MDA-MB-231), a breast cancer cell line (MCF-7), and normal human mammary epithelial cells (MCF 10A) were purchased from ATCC (USA). All aqueous solutions were prepared using deionized water.

[0038] Experimental instruments

[0039] CytoFLEX flow cytometer (Beckman Coulter, USA)

[0040] It should be understood that the following examples are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. The present invention may also be implemented or applied through other different specific embodiments, and the various details in this specification may also be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection intended by the present invention.

[0041] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0042] The nucleotide sequences involved in the present invention are shown in Table 1.

[0043] Table 1

[0044]

[0045] Case Study 1: Construction of Nanoframe Multi-satellite Modality and Validation of Exosome Detection

[0046] 1.1 Construction of nanoframe multi-satellite mode

[0047] The ordered nucleotide powder was dissolved and diluted to 20 μM in PBS buffer and the aptamer sequences were diluted to 2.5-5 μM. The DNA tetrahedron sequences probeA, probeB, probeC, and probeD were mixed and the concentration was adjusted to 2.5-5 μM. They were annealed in a water bath, cooled to room temperature, and placed in a 4°C refrigerator for later use. DNA tetrahedrons and different aptamer sequences were mixed in a 1:4 ratio. The tetrahedron concentration was used as the concentration to describe the multi-satellite modality of the overall nanoframework. The tetrahedron concentration was diluted and adjusted to 100 nM. The nanoframework multi-satellite modality was constructed by incubating at 37°C for 1 hour.

[0048] 1.2 Feasibility verification of nanoframe multi-satellite modality for exosome detection

[0049] The exosomes derived from SK-BR-3 and MCF-10A were extracted and used as the experimental group and control group samples, respectively. 40 μL of the nanoframe satellite probe system was added to each of the two EP tubes, and 5-10 μL of the exosomes derived from SK-BR-3 and MCF-10A were added to each of the two EP tubes. The exosome concentration was 1×10 8 Add PBS to adjust the volume of each group to 200 μL, incubate at 37°C for 2 hours, turn on the flow cytometer, open the Green 405, Blue 488, and Red 638 channels, and detect. Figure 2As shown, fluorescence intensity analysis of different channels revealed overexpression of exosome protein markers derived from breast cancer, while exosome protein expression in normal cell-derived exosomes was low. The fluorescence intensity in the experimental groups was higher than that in the control group, successfully demonstrating that the nanoframe multi-satellite modality of the present invention can detect tumor-derived exosomes.

[0050] Case Study 2: Detection of Different Tumor-derived Exosome Markers Based on Nanoframe Multi-satellite Modality

[0051] The nanoframe multi-satellite modality constructed by the synthesis steps of Example 1 was used to detect four markers (PD-L1, MUC1, HER2, EpCAM) of different tumor-derived exosomes (MCF-10A, MCF7, SK-BR-3, MDA-MB-231). The results are as follows Figure 3 As shown in the figure, due to the different expression levels of exosome proteins from different tumors and the different excitation intensities of the fluorescent probes themselves, the fluorescence intensities of different markers vary greatly, proving that the nanoframe multi-satellite modality has good recognition, binding and detection capabilities for protein markers of exosomes from different sources. At the same time, the results show that the expression levels of the four markers of SK-BR-3 cell-derived exosomes are the highest.

[0052] Case Study 3: Optimization of Conditions for Detecting Different Tumor-Derived Exosome Markers Based on Nanoframe Multi-Satellite Modality

[0053] In order to explore the optimal time for the recognition and binding of aptamers to proteins, different time gradients were set for exploration. SK-BR-3 cell-derived exosomes were selected as the experimental group and MCF-10A cells were selected as the control group to optimize the experimental conditions. PD-L1 single aptamer nanoframe satellite probe was selected as the recognition target at a concentration of 100 nM. The results are shown in Figure 2. Figure 4 As shown in the figure, the binding efficiency of the aptamer to the protein was poor within 1.5 hours, and the protein recognition was not fully performed; at 2 hours and 2.5 hours, the fluorescence signal of the experimental group was significantly improved, and the fluorescence signal of the control group also increased with time. Therefore, a comprehensive comparison of the signal-to-noise ratio concluded that a 2-hour incubation time is the optimal condition for the nanoframe multi-satellite modality aptamer to recognize proteins.

[0054] Case Study 4: Validation of the Sensitivity of Detecting Different Tumor-derived Exosome Markers Based on Nanoframe Multi-satellite Modality

[0055] In order to explore the detection sensitivity performance of the nanoframe multi-satellite modality, seven groups of different exosome concentration gradients (1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×109 , 1×10 10 , 1×10 11 Particles / mL) were used as the control for detection. SK-BR-3 cell-derived exosomes were selected as the experimental group, MCF-10A cells as the control group, the incubation time was selected as 2 hours, and PD-L1 and EpCAM protein markers with higher expression levels in SK-BR-3 cell-derived exosomes were selected as the research objects of this implementation case. The results are shown in Figure 2. Figure 5 As shown, the fluorescence intensity varies with different exosome concentrations. When the exosome concentration increases, as the number of exosomes in the system increases, the number of macromolecular exosome aggregates formed with the nanoframe multi-satellite modality increases, and the fluorescence is enhanced. There is a linear relationship between exosome concentration and fluorescence intensity. The linear fitting formula for PD-L1 is: y = 80910.7155lgC EVs -484355.2878,R 2 =0.9993; the linear fitting formula for EpCAM detection is: y = 492979.54151gC EVs -2960713.9433,R 2 =0.9859. After calculation, the detection limit of PD-L1 marker reached LOD=9.6895×10 5 particles / mL, and the detection limit for EpCAM markers reached LOD = 1.0134 × 10 6 particles / mL; the results showed that the exosome detection platform based on the nanoframe multi-satellite modality has good sensitivity performance.

Claims

1. A method for detecting multi-target exosomes based on nanoframe multi-satellite modality, characterized in that: The nanoframework multi-satellite modality is composed of a DNA tetrahedral framework combined with different aptamer sequences modified with different fluorescent probes. The aptamer sequences recognize and bind to exosome surface proteins, producing high-molecular-weight exosome-tetrahedral nucleic acid framework aggregates. The fluorescent signals are detected by the flow cytometry platform. The aptamer sequences for PD-L1, MUC1, EpCAM, and HER2 are single-stranded, containing the aptamer sequence portion that recognizes the protein marker and a linker portion. The tetrahedral nanoframework sequence comprises four chains, probeA, probeB, probeC, and probeD, comprising the tetrahedral main body and a linker portion. The aptamer sequence linker complements the tetrahedral nanoframe linker, synergistically forming the nanoframework multi-satellite modality.

2. The novel strategy for multi-target detection of exosomes based on nanoframe multi-satellite modality according to claim 1, characterized in that: The nanoframe multi-satellite modality is constructed, including an aptamer probe portion and a DNA tetrahedron framework portion; the aptamer probe portion includes PD-L1, MUC1, EpCAM, and HER2 sequence probes; The PD-L1 nucleotide probe (PD-L1) sequence is: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTGTGAGAGTGTGGGT-FAM (SEQ ID NO.1) The sequence of the MUC1 nucleotide probe (MUC1) is: GCAGTTGATCCTTTGGATACCCTGGGTGAGAGTGTGGGTT-Cy3(SEQ ID NO.2) The EpCAM nucleotide probe (EpCAM) sequence is: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGGTGAGAGTGTGGGTT-Cy5(SEQID NO.3) The HER2 nucleotide probe (HER2) sequence is: GGTGCACAGTCTAACGCAACAGAAAGCCAGCACCAACGCCGTGAGAGTGTGGGTT-ROX(SEQ ID NO.4) The DNA tetrahedron framework includes probes A, probe B, probe C, and probe D; The probeA nucleotide probe sequence is: ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTTTTAACCCACACTCTCAC(SEQ ID NO.5) The probeB nucleotide probe sequence is: TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATACTTTTTAACCCACACTCTCAC(SEQ ID NO.6) The probeC nucleotide probe sequence is: TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTCTTTTTAACCCACACTCTCAC(SEQ ID NO.7) The probeD nucleotide probe sequence is: TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCATTTTTTAACCCACACTCTCAC (SEQ ID NO. 8).

3. The method for preparing the exosome multi-target detection system based on the nanoframe multi-satellite modality according to claim 1, wherein: The following steps are involved: a) The DNA aptamers are annealed separately for later use, and a PBS solution is used as the reaction solution environment. b) The tetrahedral nanoframes were sequentially mixed and annealed for use, and PBS solution was used as the reaction solution environment. c) The different DNA aptamers in steps a) and b) above were mixed with the tetrahedral nanoframes and incubated for 1 hour. d) In steps a), b), and c), the incubation is performed in the dark.

4. The different DNA aptamers as claimed in claim 3 are mixed with the tetrahedral nanoframes in a ratio of 4:

1.

5. The water bath annealing operation according to claim 3, characterized in that: Heat the water bath to 95°C and incubate the probe at 95°C for 5 minutes. Turn off the constant temperature function of the water bath and wait for it to slowly cool to room temperature. Take it out and store it at 4°C.

6. The preparation method according to claim 3, wherein The incubation temperature was 37°C.

7. The operation according to any one of claims 3 to 6, characterized in that: The reaction solution was 1×PBS buffer, the main components of which were: 10 mM Na2HPO4, 2 mM NaH2PO4, 135 mM NaCl, 4.7 mM KCl, pH 7.

4.

8. A novel strategy for multi-target detection of exosomes based on nanoframe multi-satellite modality, using the nanoframe multi-satellite modality fluorescence system prepared as described in claims 3-7.

9. The fluorescence detection method according to claim 8, wherein Signal detection was performed using flow cytometry. The assay method involved setting instrument parameters, including excitation wavelength, emission wavelength, and fluorescence channels. During the blank sample test, the voltage and gate range were adjusted. A sample tube was placed and the assay was run to obtain a graph showing the relationship between fluorescence signal intensity and particle count.

Images