Use of simplicillium lanosoniveum in oil degradation

By using microbial agents prepared from Simplicillium lanosoniveum fungi, the problem of oil and grease treatment in kitchen waste in remote rural areas has been solved, achieving efficient degradation and resource utilization, and protecting aquatic ecosystems.

CN120442418BActive Publication Date: 2025-11-21ACADEMY OF PLANNING & DESIGNING OF THE MINIST OF AGRI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510908822.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-11-21
Estimated Expiration
2045-07-02

AI Technical Summary

Technical Problem

Food waste in remote rural areas has a high oil content, which makes transportation difficult and hinders the fermentation and humification process. In addition, oil pollutants affect the self-purification capacity of water bodies. Traditional physical and chemical methods are inefficient and pose a risk of secondary pollution. Therefore, efficient and pollution-free oil degradation technology is needed.

Method used

The fungus *Simplicillium lanosoniveum* is used to prepare a microbial agent through fermentation, which is used to degrade kitchen waste and oily waste. When combined with other oil-degrading strains, it can achieve efficient degradation.

Benefits of technology

It significantly improves the efficiency of oil degradation, enhances the resource utilization of kitchen waste, reduces the risk of sewage pipe blockage, and protects aquatic ecosystems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442418B_ABST
    Figure CN120442418B_ABST
Patent Text Reader

Abstract

The application provides a kind of Simplicillium lanosoniveum In the application of oil degradation. Simplicillium lanosoniveum On November 20, 2023, it was deposited in the China General Microbiological Culture Collection Center, and the deposit number was CGMCC No.40987. The provided column single-stranded mold can effectively degrade oil.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural microbial technology, and specifically to a strain Simplicillium lanosoniveum Application in oil and fat degradation. Background Technology

[0002] In remote rural areas, food waste and other oily waste are difficult to transport to towns for centralized processing, and oil-water separation technology is not yet widespread. The high oil content affects the aerobic fermentation and humification process of food waste and the quality of fertilizer products, necessitating oil treatment technologies similar to those used in this scenario to improve the resource utilization of oily pollutants. Furthermore, sewage pipes used for catering wastewater discharge are frequently clogged due to oil issues. When oily wastewater is discharged into water bodies, the oil floats on the surface, hindering oxygen dissolution, damaging the water body's self-purification capacity, and harming aquatic ecosystems.

[0003] Traditional physicochemical degradation methods (such as suspension polymerization and chemical flocculation) involve high investment costs, risks of secondary pollution, and low COD / BOD removal rates, limiting their practical application. Microbial degradation, due to its low cost and lack of secondary pollution, is emerging as a new trend. However, highly efficient bacteria for degrading oils and fats still need to be discovered and identified. Summary of the Invention

[0004] This invention aims to at least partially solve one of the technical problems in related technologies. This invention provides a method for the degradation of oils and fats. Simplicillium lanosoniveum It can be used for lipid degradation, acting as a highly efficient lipid-degrading fungus, and can supplement the existing pool of lipid-degrading bacteria, providing more options. It can also be combined with other known or unknown bacteria or fungi with lipid-degrading functions, such as Fusarium moniliformes. Fusarium proliferatum The combination works together to enhance the degradation of oils and fats.

[0005] Specifically, the present invention provides the following technical solution:

[0006] The first aspect of the present invention provides Simplicillium lanosoniveum Its use in oil degradation, the Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

[0007] According to an embodiment of the present invention, the Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:1.

[0008] A second aspect of the invention provides the use of microbial agents in oil degradation, said microbial agents comprising... Simplicillium lanosoniveum The Simplicillium lanosoniveumIt was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

[0009] According to an embodiment of the present invention, the Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:1.

[0010] According to an embodiment of the present invention, the microbial agent is a dry powder or a bacterial solution, wherein the dry powder or agent contains... Simplicillium lanosoniveum The effective viable count is at least 1×10⁻⁶. 10 CFU / mL.

[0011] According to an embodiment of the present invention, the microbial agent is obtained through the... Simplicillium lanosoniveum It is obtained by fermentation culture in an enriched medium containing 0.16wt%~1.6wt% animal and vegetable oils.

[0012] According to an embodiment of the present invention, the enrichment culture medium comprises 0.1-0.5 g of MgSO4·7H2O, 1-2 g of (NH4)2SO4, 0.3-1 g of KH2PO4, 1-2 g of K2HPO4, 3-8 g of NaCl, 1.6-16 g of soybean oil, 1000 mL of deionized water, and pH 7.0-7.2.

[0013] The fermentation culture conditions are as follows: when the fermentation culture is carried out... Simplicillium lanosoniveum After inoculation into the enrichment medium, fermentation culture was carried out at 28-32℃ and 100-150 r / min for 2-7 days.

[0014] A third aspect of the present invention provides a method for degrading grease in a sample or location, comprising: […]. Simplicillium lanosoniveum or include Simplicillium lanosoniveum The microbial agent is mixed with the sample and cultured, or placed in an oil-containing environment, in order to degrade the sample or the oil in the environment.

[0015] According to an embodiment of the present invention, the Simplicillium lanosoniveum The inoculation amount is 0.2-5% (w / w) of the amount of the sample.

[0016] According to an embodiment of the present invention, the sample is selected from kitchen waste, grease-containing waste (e.g., wastewater, waste gas, waste residue), etc., and the location includes at least one of grease-containing sewage pipes and grease-containing pollutant collection locations.

[0017] A fourth aspect of the invention provides Simplicillium lanosoniveum The Simplicillium lanosoniveumIt was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40761. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0018] According to an embodiment of the present invention, the Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:1.

[0019] The beneficial effects achieved by this invention are at least as follows:

[0020] The present invention provides Simplicillium lanosoniveum It can effectively degrade oils, and its main function is to accelerate the oil metabolism process. In addition, the provided... Simplicillium lanosoniveum It can improve the original microbial community structure and microecology, and reduce the pollution of the environment by oil-containing pollutants. (Provided) Simplicillium lanosoniveum Exogenous microbial agents can be prepared into solid powders or liquids as needed for use in the field of oil degradation.

[0021] Preservation Certificate

[0022] Category naming Simplicillium lanosoniveum The accession number is CGMCC No.40987, the depository is China General Microbiological Culture Collection Center, the deposit date is November 20, 2023, and the deposit address is No.3, No.1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0023] Figure 1 Provided according to embodiments of the present invention Simplicillium lanosoniveum A schematic diagram of the characteristics of bacterial colonies.

[0024] Figure 2 Provided according to embodiments of the present invention Simplicillium lanosoniveum Schematic diagram of morphological characteristics.

[0025] Figure 3 A diagram of oil degradation provided according to an embodiment of the present invention.

[0026] Figure 4 Provided according to embodiments of the present invention Simplicillium lanosoniveum Growth trend chart.

[0027] Figure 5 Provided according to embodiments of the present invention Simplicillium lanosoniveum pH trend chart.

[0028] Figure 6 Provided according to embodiments of the present invention Simplicillium lanosoniveum Graph showing changes in fat content. Detailed Implementation

[0029] The embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention.

[0030] This invention provides Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40987 and address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0031] Provided Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:1.

[0032] Its 18S rDNA sequence is shown below:

[0033] CGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTTATCCAACTCCCAACCCTATGTGAACCTACCTTTATGTTGCTTCGGCGGTCTCGCGCCGGGTTGCTCCCCTGGGGGCTCCCGGGACCACGCGTCCGCCGGAGACCACAAACTCTTG ATTTTCGCGAAAGCAGTATTATTCTGAGTGGCCGAAAGGCAAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCTCGAGCTCGTCTTCATTGACGGGATCGGTGTTGGGACCCGGCGAGCGGGGACTTTTGTCCTCTGCCGGCCCCGAAATTCAGT GGCGGCCCGTTGCGGCGACCTCTGCGTAGTAACTCAACCTCGCACCGGTAACAGCATCGTGGCCACGCCGTAAAACCCCCGACTTTTATAAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGA

[0034] (SEQ ID NO:1)

[0035] Provided Simplicillium lanosoniveum The material was obtained from kitchen waste and subjected to a stepwise gradient screening process using a culture medium containing animal and vegetable oils. After gradient acclimation using an enrichment culture medium containing animal and vegetable oils, the resulting product was obtained through streak separation. Simplicillium lanosoniveum The animal and vegetable oils mentioned include, but are not limited to, soybean oil, corn oil, peanut oil, and lard. According to a preferred embodiment, the vegetable oil mentioned is soybean oil.

[0036] The present invention also provides a microbial inoculant, comprising the aforementioned Simplicillium lanosoniveum. According to a specific embodiment, the provided microbial agent is based on the above-described... Simplicillium lanosoniveum Preparation and acquisition. According to specific embodiments, the microbial agent can be prepared in the form of dry powder or bacterial solution, wherein the dry powder or bacterial solution contains... Simplicillium lanosoniveum The effective viable count is at least 1×10⁻⁶. 10 CFU / mL, for example, approximately 1.5 × 10⁻⁶. 10 CFU / mL, 2×10 10 CFU / mL, 3×10 10 CFU / mL, 4×10 10 CFU / mL, 5×10 10 CFU / mL, 6×10 10 CFU / mL, 7×10 10 CFU / mL, 8×10 10 CFU / mL, 9×10 10 CFU / mL, etc. Before use, the dry powder can be pre-activated with a certain amount of sterile water or special culture medium, for example, for 2-8 hours.

[0037] The microbial agent can be obtained through fermentation. According to a specific embodiment, the microbial agent is obtained through... Simplicillium lanosoniveum It is obtained by fermentation culture using an enrichment medium containing 0.16wt%~1.6wt% animal or vegetable oil (preferredly soybean oil). The fermentation culture conditions are as follows: Simplicillium lanosoniveum After inoculation into the enrichment medium, fermentation is carried out at 28–32°C and 100–150 r / min for 2–7 days. For example, fermentation is carried out for 5–7 days.

[0038] According to an embodiment of the present invention, the enrichment culture medium comprises 0.1-0.5 g of MgSO4·7H2O, 1-2 g of (NH4)2SO4, 0.3-1 g of KH2PO4, 1-2 g of K2HPO4, 3-8 g of NaCl, 1.6-16 g of soybean oil, 1000 mL of deionized water, and pH 7.0-7.2.

[0039] The above-mentioned ingredients can be added to the base fertilizer. Simplicillium lanosoniveum Alternatively, microbial fertilizers can be obtained from the aforementioned microbial agents and used in locations requiring oil degradation. The basic fertilizer mentioned can be composted organic fertilizer. This composted organic fertilizer can be household waste compost (using raw kitchen waste (food waste) for composting); livestock and poultry manure compost; or some types of deadwood compost (adding chicken manure or oil residue as fermentation aids to tree bark for composting); or leaf mold compost (made from fallen leaves of deciduous broad-leaved trees), etc.

[0040] The present invention also provides a method for degrading grease in a sample or location, comprising: taking the above-described... Simplicillium lanosoniveum Alternatively, the microbial inoculant or microbial fertilizer described above may be mixed with the sample for cultivation, or placed in an oil-containing environment to degrade the oil in the sample or the environment. The environments mentioned include, but are not limited to, food waste collection sites, food waste that is difficult to transport and centrally process in remote rural areas, and oil-rich sewage pipes.

[0041] The above provided Simplicillium lanosoniveum Alternatively, microbial agents can be applied to the field of oil degradation, such as in the aerobic fermentation of kitchen waste. When the initial oil content of the material is around 20% (e.g., 15-20% oil content), the oil degradation efficiency is at least 40%, for example, 42%, 45%, 48%, 50%, 52%, 55%, 58%, or 60%. The aforementioned oil degradation efficiency can be achieved after fermentation for more than 20 days (e.g., around 25 days).

[0042] The technical solution of the present invention will be described below through specific embodiments. It should be noted that these embodiments are only used to facilitate understanding by those skilled in the art and should not be considered as limiting the scope of protection of the present invention. Unless otherwise specified, the reagents used in the embodiments are all commercially available.

[0043] Example 1

[0044] Example 1: A plant was obtained by screening using the following method. Simplicillium lanosoniveum Specifically, it includes:

[0045] Five g samples were taken from the high-temperature composting process of kitchen waste from a food waste treatment company in Suzhou, Suzhou Research Institute of China Agricultural University. These samples were placed in 250 mL of enrichment medium (first concentration soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L) and incubated at 30 ℃ and 120 r / min for 6-7 days. Then, 5 mL of the bacterial solution was transferred to 250 mL of fresh enrichment medium (second concentration soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L) and incubated under the same conditions for 6-7 days. This gradient acclimatization was repeated for six cycles (third concentration soybean oil gradient: 3.2 g / L, 4 g / L, 4.8 g / L, 5.6 g / L, 6.4 g / L; fourth concentration soybean oil gradient: 3.2 g / L, 4.8 g / L). The concentration gradients were as follows: 5.6 g / L, 6.4 g / L, 8 g / L; fifth concentration soybean oil gradient: 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, 16 g / L; sixth concentration soybean oil gradient: 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, 16 g / L). Each time, the bacterial population with the best growth and oil-degrading performance in each cycle was selected for the next stage of gradient acclimatization.

[0046] Then, the well-grown bacterial cultures after six cycles of acclimatization were serially diluted and inoculated onto medium supplemented with neutral red. The cultures were incubated at 30 °C for 48 hours, and the colonies were observed to see if they turned red. If they turned red, it indicated that the strain could degrade oils and produce fatty acids.

[0047] The reddened colonies were screened, picked up with an inoculation loop and streaked to separate them. The purified strains were stored in beef extract peptone solid slant medium for later use.

[0048] The enrichment culture medium used included a basal culture medium and soybean oil at varying concentrations. The basal culture medium consisted of: 0.1 g MgSO4·7H2O, 1.0 g (NH4)2SO4, 0.3 g KH2PO4, 1.5 g K2HPO4, 5.0 g NaCl, 1000 mL deionized water, and a pH of 7.0–7.2. The soybean oil at varying concentrations (using soybean oil as the sole carbon source for gradient screening and domestication of microorganisms) increased in concentration with each domestication cycle (as shown above).

[0049] The formula for the beef extract peptone solid culture medium used is as follows: 5 g beef extract, 5 g NaCl, 10 g peptone, 20 g agar powder, 1000 mL deionized water, pH 7.0. It includes both plate and slant agar plates.

[0050] The culture medium containing neutral red used was formulated as follows: 1 mL of 1.6% (mass fraction) neutral red aqueous solution and 5.0 g of soybean oil were added to beef extract peptone solid medium.

[0051] The strain obtained through this screening method was named NHYJZ2. The obtained strain was then characterized as follows:

[0052] (1) Colony characteristics

[0053] like Figure 1 As shown, the colonies produced by strain NHYJZ2 are milky white with clear edges. Within a week, the colonies expanded to a diameter of approximately 4 cm.

[0054] (2) Colony morphology

[0055] Inoculate the bacterial strain from solid or liquid culture medium onto blank glass slides and stain using Gram staining. Observe the detailed features of the colonies using optical microscopes equipped with magnifications of 100x, 200x, 500x, 630x, and 1000x. Take images using LASV4.3 software.

[0056] Microscopic observation Figure 2 As shown, from Figure 2 Obvious hyphae and spores can be observed.

[0057] (3) Identification of strains

[0058] Genomic DNA was extracted using a DNA extraction kit (manufacturer: Beijing Boyoushun Biotechnology Co., Ltd.). The extracted DNA was used as a PCR template, and PCR amplification was performed using primers (synthesized by BGI Genomics) and a PCR instrument (Biometra Tgradient). PCR amplification products were obtained. All reagents used for amplification, including Taq DNA polymerase, were purchased from TaKaRa.

[0059] The universal primers used include:

[0060] ITS1:TCCGTAGGTGAACCTGCGG (SEQ ID NO:2);

[0061] ITS4:TCCTCCGCTTATTGATATGC (SEQ ID NO:3).

[0062] The PCR amplification system consisted of: 2 μL of treated sample (20 ng / μL) template, 2.5 μL of dNTP mixture (2.5 mM), 1.5 μL each of primers (20 μM), and 10×ExTaq buffer (Mg2+). 2+Add 5 μL of ExTaq enzyme (5 U / μL) and 0.2 μL of ddH2O to a final volume of 50 μL.

[0063] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, 30 cycles; 72℃ extension for 5 min.

[0064] After PCR amplification products were analyzed with 1.5% agarose gel, the target band was recovered and purified using a PCR purification kit (Promega). Bidirectional sequencing was then performed using amplification primers (ABI sequencer 3730xl). The sequencing results were assembled, entered into GenBank, and compared online using BLAST. Ultimately, this strain was identified as *Monochorhynchus spp.* Simplicillium cylindrosporum The 18S rDNA sequence is shown in SEQ ID NO:1. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40761.

[0065] Example 2

[0066] Example 2 identified the lipid degradation ability of the strain prepared in Example 1.

[0067] (1) Lipid degradation ability

[0068] To enhance the lipid degradation ability of this strain, its performance was tested using an enrichment medium (the basal medium formulation was the same as in Example 1 above, except that soybean oil was added at 10 g / L). The culture was conducted at 30°C and 120 r / min. The results showed that the lipid degradation efficiency of this strain exceeded 80% on the second day, exhibiting a shorter degradation time and efficiency, not limited by theoretical limits, possibly related to the production of mycelia and spores by the fungus. The increased specific surface area of ​​the mycelium and the formation of a trapping network enhanced its ability to capture and degrade lipids. These results are as follows... Figure 3 As shown.

[0069] The formula for calculating the oil degradation efficiency mentioned is as follows:

[0070] (Oil content on day 0 - Oil content on day n) / Oil content on day 0 × 100%

[0071] (2) Growth

[0072] The growth rate of this bacterium was evaluated using the OD600 value. The OD600 value represents the growth rate of the bacterial community; a higher OD600 value corresponds to a higher bacterial concentration. During the acclimatization process, vegetable oil was used as the sole carbon source. The oil degradation efficiency represents the lipolysis ability of the bacterial community; a higher oil degradation efficiency indicates better oil degradation performance.

[0073] The strain was cultured in an enrichment medium (the basic medium formulation was the same as in Example 1 above, with soybean oil added at 10 g / L) at 30°C and 120 r / min for 6 days, and the OD600 reached approximately 3.38. Figure 4 As shown.

[0074] (3) Acid production capacity

[0075] To investigate the acid-producing ability of this bacterium, pH value was used to evaluate this indicator. The change in pH value of the nutrient solution represents the acidity or alkalinity of metabolic products during the growth of the bacterial community. A decrease in pH value indicates that acidic substances are produced during the life activities of microorganisms, and vice versa.

[0076] like Figure 5 As shown, this strain was cultured in enrichment medium (the basic medium formula of which is the same as that in Example 1 above, with soybean oil added at 10 g / L) at 30°C and 120 r / min for 6 days, with a pH of about 3.1.

[0077] Example 3

[0078] Example 3 verified the lipid degradation ability of the provided strain.

[0079] Prepare a 725 mL simulated fermenter, placed in a programmable temperature-controlled insulated box. Eight temperature platforms are set up to simulate the actual fermentation process: Platform 1: 30℃ for 1 day; Platform 2: 40℃ for 1 day; Platform 3: 50℃ for 1 day; Platform 4: 55℃ for 1 day; Platform 5: 60℃ for 7 days; Platform 6: 40℃ for 4 days; Platform 7: 45℃ for 4 days; Platform 8: 30℃ for 8 days. Fill the fermenter with a mixture of kitchen waste and corn stalks (kitchen waste:corn stalks = 4:1 mass ratio). The filling rate is 83%, i.e., 600 mL of material. Two experimental groups are set up. The experimental group is then inoculated at a 1% (w / w) inoculation rate. Simplicillium lanosoniveum The viable count of this bacterium, measured before inoculation, was 1×10⁻⁶. 10 CFU / mL, 6 mL was administered. The control group received no vaccination. Simplicillium lanosoniveumDuring composting, samples were taken on days 0, 3, 7, 13, 20, and 27. The ventilation rate was 0.2 L / (min·kg dry weight), with ventilation intervals of 30 min every 30 min.

[0080] Then the oil content of the material was measured at different time periods. For example... Figure 6 As shown, after 27 days of aerobic fermentation, the oil degradation rate was 26.59% higher than that of the control group. [The text then abruptly shifts to a seemingly unrelated topic:] ...added... Simplicillium lanosoniveum The experimental group had a higher oil degradation efficiency of 47.25%, which was 20.66% higher.

[0081] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A kind Simplicillium lanosoniveum Its use in oil degradation, characterized in that, The Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

2. The use according to claim 1, characterized in that, The Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:

1.

3. The use of microbial agents in oil degradation, characterized in that, The microbial agent includes Simplicillium lanosoniveum The Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

4. The use according to claim 3, characterized in that, The microbial agent is a dry powder or a bacterial solution, wherein the dry powder or bacterial solution contains the... Simplicillium lanosoniveum The effective viable count is at least 1×10⁻⁶. 10 CFU / mL.

5. The use according to claim 3, characterized in that, The microbial agent is obtained through the Simplicillium lanosoniveum It is obtained by fermentation culture in an enrichment medium containing 0.16wt%~1.6wt% animal and vegetable oils; The enrichment medium is formulated with 0.1-0.5 g of MgSO4·7H2O, 1-2 g of (NH4)2SO4, 0.3-1 g of KH2PO4, 1-2 g of K2HPO4, 3-8 g of NaCl, 1.6-16 g of soybean oil, 1000 mL of deionized water, and pH 7.0-7.

2.

6. The use according to claim 5, characterized in that, The fermentation culture conditions are as follows: when the fermentation culture is carried out... Simplicillium lanosoniveum After inoculation into the enrichment medium, fermentation culture was carried out at 28-32℃ and 100-150 r / min for 2-7 days.

7. A method for degrading grease in a sample or location, characterized in that, include: Will Simplicillium lanosoniveum or include Simplicillium lanosoniveum The microbial agent is mixed with the sample and cultured, or placed in an oil-containing environment, in order to degrade the sample or the oil in the environment; The Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

8. The method according to claim 7, characterized in that, The Simplicillium lanosoniveum The inoculation amount is 0.2-5% (w / w) of the amount of the sample.

9. The method according to claim 7, characterized in that, The sample is grease-containing waste, and the location is selected from at least one of grease-containing sewage pipes and grease-containing pollutant collection sites.

10. The method according to claim 7, characterized in that, The sample was kitchen waste.

11. A kind Simplicillium lanosoniveum The Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

Citation Information

Patent Citations

  • Simplicillium lanosoniveum and application of simplicillium lanosoniveum in dissolving lignite to prepare phthalic acid ester

    CN110747132A

  • New simplicillium microorganism having ability to control citrus disease injury and microbe-controlling method using the same

    JP2005073583A