Application of YJL151C gene or protein thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to an application of a YJL151C gene or a protein thereof. On the basis of SCRaMbLE rearrangement, bioinformatics analysis and phenotypic analysis are combined for gene mining work, and a series of tolerance-related genes are obtained. The research finally finds that the over-expression of the YJL151C gene can improve the drug resistance of the strain to nystatin, and a drug-resistant strain with precise corrosion resistance is provided for the food fermentation industry. The strain can also be cooperated with other antagonistic microorganisms to be used for biological prevention and control of crops or feed.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the application of YJL151C gene or its protein. Background Art

[0002] Nystatin is a polyene antifungal antibiotic produced by Streptomyces noursei with the chemical formula C 47 H 75 NO 17 , molecular weight 926.09. It appears as a yellow or yellow-brown powder, is slightly soluble in water, readily soluble in organic solvents such as methanol and ethanol, and is sensitive to light, heat, acid, and alkali. It binds to ergosterol in the fungal cell membrane, disrupting the membrane structure and causing the outflow of intracellular substances. It also inhibits key fungal metabolic enzymes such as choline acetyltransferase and dehydrogenase, interfering with oxidative phosphorylation and nucleic acid synthesis, ultimately killing the fungus.

[0003] Nystatin is primarily used clinically to treat digestive tract infections, oral infections, and skin and mucosal infections caused by Candida albicans. It can also be used as an adjunctive treatment for systemic fungal infections and to prevent superinfections. Nystatin is also widely used in veterinary and agricultural applications, such as combating mold in feed and fungal diseases in livestock.

[0004] Microbial contamination is a significant issue during food processing and storage. Saccharomyces cerevisiae strains with enhanced nystatin tolerance can be added to foods as a biopreservative. By competing with harmful fungi for nutrients and living space, they inhibit their growth and reproduction, extending the shelf life of foods while reducing the use of chemical preservatives and improving food safety and quality. Therefore, drug-resistant strains are urgently needed for food preservation and antiseptic treatment, as well as for the production of fermented foods, with applications in food, industrial fermentation, medicine, and other fields. Furthermore, the discovery of new targets can serve as a new mechanism for the development of fungal resistance. Summary of the Invention

[0005] In view of this, the technical problem solved by the present invention is to provide the use of the YJL151C gene or its protein in regulating yeast resistance to nystatin, and further provide a genetically modified yeast engineered bacteria, which can be used in food preservation, antiseptic treatment and fermented food production.

[0006] The present invention provides use of any one of the following in improving yeast resistance to nystatin:

[0007] (1) Overexpression of the YJL151C gene or an agent that overexpresses the YJL151C gene;

[0008] (2) Increasing the activity and / or protein level of YJL151C protein, or an agent for increasing the activity and / or protein level of YJL151C protein.

[0009] YJL151C is an open reading frame (ORF) on chromosome X of the yeast Saccharomyces cerevisiae. It is relatively poorly studied and is involved in efficient MVB sorting of proteins into the vacuole, acting as an RSP5 adaptor protein for MVB cargo.

[0010] Nystatin is a polyene macrolide antifungal antibiotic produced by Streptomyces. 47 H 75 NO 17 .

[0011] The present invention discovered for the first time that overexpression of the YJL151C gene can enhance the strain's resistance to nystatin, providing a new approach for precise preservation in the food fermentation industry and synergistic biological control of crops or feed.

[0012] In the present invention, the sequence of the YJL151C gene can be a wild-type sequence encoding the mutant, or a sequence optimized according to the codon preference of the selected host. In the present invention, the nucleic acid sequence of the YJL151C gene is a wild-type sequence, specifically selected from any one of the following:

[0013] (1) the nucleotide sequence shown in SEQ ID NO: 1;

[0014] (2) A nucleotide sequence having the same or similar function as the nucleotide sequence shown in (1) obtained by substituting, deleting, adding or modifying one or more bases in the sequence shown in (1);

[0015] (3) A nucleotide sequence having at least 80% identity with the sequence shown in (1) or (2).

[0016] In the present invention, the yeast includes yeast strains containing homologous genes such as Saccharomyces cerevisiae, Saccharomyces cerevisiae, and Saccharomyces cerevisiae. In some specific embodiments of the present invention, the Saccharomyces cerevisiae is preferably BY4741, BY4742, BY4743, etc. Other common Saccharomyces cerevisiae strains in the art can also be used in the present invention.

[0017] The present invention also provides a product for improving yeast resistance to nystatin, which is a biological material containing the YJL151C gene. The biological material overexpressing the YJL151C gene includes any of the following:

[0018] (1) an expression cassette containing the YJL151C gene;

[0019] (2) a recombinant vector containing the expression cassette described in (1);

[0020] (3) Transfect or transform the host with the recombinant vector (2), or the host with the expression cassette (1) integrated into its genome.

[0021] In the present invention, the expression cassette includes a promoter and a YJL151C gene. The promoter is selected from TDH3p, TEF1p, PGK1p, GAL1p, etc. In some embodiments, the expression cassette also includes a terminator. The terminator is selected from MPE1t, CYC1t, TEF1t, PGK1p, etc.

[0022] In the present invention, the recombinant vector is a vector for overexpressing the YJL151C gene, and its backbone includes, but is not limited to, pRS series vectors, pFA6a series vectors, pYC2 series vectors, etc. In specific embodiments of the present invention, the backbone is pRS413. In some specific embodiments, the expression vector of the present invention comprises pRS413 and an expression cassette containing the YJL151C gene, denoted as pWWY001. The nucleic acid sequence of pWWY001 is shown in SEQ ID No. 14.

[0023] In a specific embodiment of the present invention, using Saccharomyces cerevisiae as an example, it was demonstrated that overexpressing the YJL151C gene in Saccharomyces cerevisiae can significantly improve Saccharomyces cerevisiae's resistance to nystatin. Based on this, the present invention also provides the use of the product in improving yeast resistance to nystatin.

[0024] The present invention also provides a nystatin-resistant yeast strain, which comprises the recombinant vector in the aforementioned product, or has the YJL151C gene integrated into its genome.

[0025] In a specific embodiment of the present invention, the yeast strain containing the YJL151C gene is yWWY001, which is transformed with an expression vector containing the YJL151C gene (ie, vector pWWY001).

[0026] The present invention also provides a method for constructing the yeast strain, comprising: transferring the expression cassette or expression vector in the product of the present invention into a base plate bacteria. The base plate bacteria are selected from the yeast types described above.

[0027] The present invention also provides a microbial agent, comprising the yeast strain of the present invention or the yeast strain obtained by the construction method of the present invention, and an acceptable auxiliary agent.

[0028] In the present invention, the microbial agent also includes one or more other antagonistic microorganisms, such as Trichoderma, Bacillus, etc.

[0029] The present invention also provides the use of the yeast strain, the yeast strain obtained by the construction method, or the microbial agent in any of the following aspects:

[0030] (1) Using the yeast strain as a probiotic or fermentation strain in food processing, food and / or fruit and vegetable preservation and antiseptic, or using the yeast strain to prepare food and / or fruit and vegetable preservatives and antiseptics;

[0031] (2) using the yeast strain for preventing and controlling plant fungal diseases, or using the yeast strain to prepare a biological control agent for preventing and controlling plant fungal diseases;

[0032] (3) The yeast strain is used as a feed additive to inhibit harmful fungi in feed, or the yeast strain is used to prepare a feed biological control agent to improve the storage stability of feed and reduce the risk of mildew.

[0033] In applications in preservation and antiseptic treatment, the yeast strain or microbial agent described in the present invention can be used alone to exert a natural antibacterial effect, thereby extending the shelf life; it can also be used in combination with other chemical preservatives and antistaling agents, which can significantly reduce the risk of chemical residues compared to simple chemical methods and improve the safety of food and agricultural products.

[0034] In applications related to biological control of plant fungal diseases, the yeast strains or microbial agents described herein can also be used in combination with other control methods, such as chemical control and physical control, to form an integrated control system. For example, when using chemical pesticides to control pests and diseases, the rational use of antagonistic microbial agents can significantly reduce the amount of chemical pesticides used, while improving control effectiveness and reducing environmental pollution. The yeast strains or microbial agents described herein can also be used in combination with other antagonistic microorganisms, such as Trichoderma, etc. In the present invention, the plants include crops, flowers, trees, etc.

[0035] In applications for inhibiting harmful fungi in feed, the yeast strains or microbial agents described herein can also be used in combination with other beneficial microorganisms, enabling functional complementarity between different species. For example, when used in combination with Bacillus, Bacillus can rapidly consume oxygen in the environment, creating a microenvironment conducive to yeast growth and enhancing its ability to inhibit harmful fungi. This functional complementarity between different species can improve overall feed mold prevention effectiveness.

[0036] Based on SCRaMbLE rearrangement, this study combined bioinformatics analysis with phenotypic analysis to conduct gene mining, identifying a series of tolerance-related genes. The study ultimately revealed that overexpression of the YJL151C gene can enhance the strain's resistance to nystatin, providing a precise, drug-resistant strain for the food fermentation industry. This strain can also be used in synergy with other antagonistic microorganisms for biocontrol of crops or feed. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The overexpression strain was diluted and plated at different nystatin concentrations.

[0038] Figure 2 Figure 4 shows the inhibition zone of the overexpressing strain to nystatin. Figure A shows the morphology of the inhibition zone, and Figure B shows the diameter of the inhibition zone. n = 5, p < 0.001. DETAILED DESCRIPTION

[0039] The present invention provides applications of the YJL151C protein or its gene. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications will be apparent to those skilled in the art and are considered to be encompassed by the present invention. The methods and applications of the present invention have been described through preferred embodiments, and it is apparent that those skilled in the art can modify or appropriately alter and combine the methods and applications herein to implement and apply the technology of the present invention without departing from the content, spirit, and scope of the present invention.

[0040] The sequence information involved in the present invention is as follows:

[0041] The nucleotide sequence of the YJL151C gene is shown in SEQ ID No. 1:

[0042] ATGGACAGAGACCATATTAATGACCATGACCATCGAATGAGCTATTCCATCAACAAGGACGACTTGTTGTTAATGGTTTTGGCGGTTTTCATTCCCCCAGTGGCCGTCTGGAAGCGTAAGGGTATGTTCAACAGGGATACACTATTGAACTTACTTCTCTTCCTACTGTTATTCTTCCCAGCAATCATTCACGCTTGCTACGTTGTATATGAAACGAGTAGTGAACGTTCGTACGATCTTTCACGCAGACATGCGACTGCGCCCGCCGTAGACCGTGACCTGGAAGCTCACCCTGCAGAGGAATCTCAAGCACAGCCTCCAGCATATGATGAAGACGATGAGGCCGGTGCCGATGTGCCCTTGATGGACAACAAACAACAGCTCTCTTCCGGCCGTACTTAG(SEQ ID No.1).

[0043] The sequence of primer oWWY006 is shown in SEQ ID No.2:

[0044] CTTGTCGTCATCGTCTTTGTAGTCCATTTTGTTTGTTTATGTGTGTTTA TTC(SEQ ID No.2).

[0045] The sequence of primer oWWY021 is shown in SEQ ID No.3:

[0046] TATCGATAAGCTTGATATCGACAGTTTATTCCTGGCAT(SEQ ID No.3).

[0047] The sequence of promoter TDH3p is shown in SEQ ID No.4:

[0048] ACAGTTTATTCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTAAGCTGGCATCCAGAAAAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTCACCAACCATCAGTTCATAGGTCCATTCTCTTAGCGCAACTACAGAGAACAGGGGCACAAACAGGCAAAAAACGGGCACAACCTCAATGGAGTGATGCAACCTGCCTGGAGTAAATGATGACACAAGGCAATTGACCCACGCATGTATCTAT CTCATTTTCTTACACCTTCTATTACCTTCTGCTCTCTGATTTGGAAAAAGCTGAAAAAAAAGGTTGAAACCAGTTCCCTGAAATTATTCCCCTACTTGACTAATAAGTATATAAAGACGGTAGGTATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTCTTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTAAAACACCAAGAACTTAGTTTCGAATAAACACACATAAACAAACAAA.

[0049] The sequence of primer oWWY007 is shown in SEQ ID No.5:

[0050] ATGGACTACAAAGACGATGACGACAAGGACAGAGACCATATTAATG ACCATG (SEQ ID No. 5).

[0051] The sequence of primer oWWY008 is shown in SEQ ID No.6:

[0052] SEQ ID No. 6: GTATTGTTATCTAAGTACGGCCGGAAGAG.

[0053] The sequence of primer oWWY009 is shown in SEQ ID No.7:

[0054] CTCTTCCGGCCGTACTTAGATAACAATACTGACAGTACTAAAT (SEQ ID No. 7).

[0055] The sequence of primer oWWY010 is shown in SEQ ID No.8:

[0056] GCGGCCGCTCTAGAACTAGTGGATCGAAGAATAACGCAAGGAAGA (SEQ ID No. 8).

[0057] The terminator MPE1t sequence is shown in SEQ ID No. 9:

[0058] ATAACAATACTGACAGTACTAAAATAATTGCCTACTTGGCTTCACATAC GTTGCATACGTCGATATAGATAATAATGATAATGACAGCAGGATTATCGTA ATACGTAATAGTTGAAAATCTCAAAAATGTG (SEQ ID No. 9).

[0059] The sequence of primer oWWY003 is shown in SEQ ID No.10:

[0060] SEQ ID No. 10: CGATATCAAGCTTATCGATACCGTCGACCTCGAG.

[0061] The sequence of primer oWWY004 is shown in SEQ ID No.11:

[0062] SEQ ID No. 11: CACCGCGGTGGAGCTCCAGC.

[0063] The sequence of primer M13F is shown in SEQ ID No.12:

[0064] SEQ ID No. 12: GTAAAACGACGGCCAGT.

[0065] The sequence of primer M13R is shown in SEQ ID No. 13;

[0066] SEQ ID No. 13: CAGGAAACAGCTATGAC.

[0067] The sequence of pWWY001 is shown in SEQ ID No. 14:

[0068]

[0069] The raw materials and reagents used in the present invention can be purchased from the market.

[0070] The SC-His culture medium of the present invention comprises: 20 g / L glucose, 6.7 g / L YNB, 2 g / L tetra-amino acid powder (-Ura, -His, -Trp, -Leu), 20 mg / L Ura, 20 mg / L Trp, 100 mg / L Leu, and the pH is adjusted to 6.0.

[0071] The SC-His + Nystatin culture medium of the present invention is prepared by adding a sterilized, filtered nystatin stock solution to the sterilized, cooled SC-His culture medium. The nystatin stock solution is dissolved in DMSO at a concentration of 10 mg / mL, sterilized by filtration using a syringe and an organic filter membrane, and then aliquoted into 1.5 mL centrifuge tubes and stored at -20°C until ready for use.

[0072] The DNA polymerase used in Example 1 of the present invention is Max Super-Fidelity DNAPolymerase.

[0073] In Example 1 of the present invention, the fragment size was checked by agarose gel electrophoresis, and the correct band was purified using an agarose gel recovery kit produced by Tiangen Biochemical Technology Co., Ltd.

[0074] For further understanding of the present invention, unless otherwise specified, the plasmids, vectors, etc. described in the present invention can be purchased through commercial channels.

[0075] In the following examples, gene overexpression is performed according to conventional techniques in the art.

[0076] The present invention will be further described below with reference to specific examples.

[0077] In the following examples, gene overexpression is performed according to conventional techniques in the art.

[0078] Example 1 Construction of Saccharomyces cerevisiae strains yWWY001 and yWWY002

[0079] 1. Construction of YJL151C overexpression plasmid pWWY001. The construction steps are as follows:

[0080] a) The Saccharomyces cerevisiae BY4741 genome was used as a template, and PCR was performed using primers oWWY006 (SEQ ID No. 2) and oWWY021 (SEQ ID No. 3) to obtain a high-fidelity DNA fragment of 547 bp in length containing TDH3p (SEQ ID No. 4). PCR was performed using primers oWWY007 (SEQ ID No. 5) and oWWY008 (SEQ ID No. 6) to obtain a high-fidelity DNA fragment containing YJL151C (436 bp in length). PCR was performed using primers oWWY009 (SEQ ID No. 7) and oWWY010 (SEQ ID No. 8) to obtain a high-fidelity DNA fragment containing MPE1t (SEQ ID No. 9) (619 bp in length). The fragments were verified to be of correct size by agarose gel electrophoresis and then purified.

[0081] b) linearizing the p-vector pRS413 plasmid using primers oWWY003 (SEQ ID No. 10) and oWWY004 (SEQ ID No. 11);

[0082] c) performing Gibson assembly of all DNA fragments and the linearized vector;

[0083] d) Transform the reaction system into DH5α competent E. coli cells, spread on LB+Amp plates, and culture at 37°C for 12 hours;

[0084] e) Single colonies were picked and streaked onto LB+Amp plates for purification. Colony PCR was performed using primers M13F (SEQ ID No. 12) and M13R (SEQ ID No. 13). A successful construct was 1712 bp in length.

[0085] f) Three correct single colonies were selected and inoculated into 5 mL of LB+Amp liquid medium. After overnight culture at 37°C, the plasmids were extracted and Sanger sequencing was performed.

[0086] g) The plasmid with correct sequencing results was named pWWY001 (SEQ ID No. 14).

[0087] 2. Saccharomyces cerevisiae transformation, the steps are as follows:

[0088] a) Pick a single colony of BY4741 and culture it in 5 mL of YPD liquid medium at 30°C overnight;

[0089] b) Measure the OD of the overnight culture of Saccharomyces cerevisiae 600 , inoculate overnight culture into 5mL YPD liquid medium (0.125OD 600 / mL), and cultured at 30°C and 220 rpm until OD 600 Reach 0.5 (about 3.5h-4.5h);

[0090] c) the Saccharomyces cerevisiae culture solution obtained in step b) was transferred to a 1.5 mL EP tube and centrifuged at 5000 rpm for 1 min to collect the cells; the cells were resuspended in 1 mL of sterile water and centrifuged as above to collect the cells; the cells were resuspended in 1 mL of 0.1 M LiOAc and centrifuged as above to collect the cells; 900 μL of the supernatant was removed with a pipette, and the cells were resuspended in the remaining 100 μL of LiOAc and placed on ice to obtain competent cells.

[0091] d) preparing a transformation system, wherein

[0092] Plasmid DNA was pWWY001 and pRS413, 200 ng;

[0093] Table 1 Volume of each component (μL)

[0094] Components Volume (μL) 50% PEG3350 620 10mg / mL ssDNA 40 1MLiOAc 90 DNA 50

[0095] e) Add 100 μL of competent cells to the transformation system, pipette evenly, and vortex at top speed for 10 seconds; incubate in a 30°C incubator for 30 minutes; add 90 μL of DMSO and vortex for 10 seconds; heat shock at 42°C for 18 minutes; centrifuge at 3600 rpm for 30 seconds to collect the cells; aspirate the supernatant, add 400 μL of 5 mM CaCl2, resuspend the cells, and let them stand for 10 minutes; centrifuge at 3600 rpm for 30 seconds, aspirate the supernatant, resuspend in sterile water, and apply to SC-His plates for screening.

[0096] f) After the yeast has grown on the screening plate for 2 days, single colonies are picked and streaked onto SC-His plates for purification.

[0097] g) The strain yWWY001 containing pWWY001 and the control strain yWWY002 containing pRS413 were obtained and stored.

[0098] Example 2 Characterization of Nystatin Resistance of Saccharomyces cerevisiae Strain yWWY001

[0099] 1. For the doubling dilution spot test, the test steps are as follows:

[0100] a) Pick a single colony of strain yWWY001 or yWWY002 and inoculate it into 5 mL of SC-His liquid medium. Cultivate overnight at 220 rpm and 30°C until the stationary phase.

[0101] b) Measure the OD of the culture medium using a UV spectrophotometer 600 ;

[0102] c) Transfer an appropriate amount of bacterial solution to a 1.5 mL EP tube and dilute with sterile water to the initial OD 600 =1;

[0103] d) Add sterile water and dilute in 10-fold gradient until the final OD 600 They are 0.1, 0.01, and 0.001 respectively;

[0104] e) Pipette 2 μL of bacterial solution onto SC-His solid plates containing different concentrations of nystatin in a concentration gradient;

[0105] f) Allow the solid culture medium to dry in a clean bench, then transfer to an incubator at 30°C and incubate for 2-4 days.

[0106] 2. Nystatin inhibition zone determination, the test steps are as follows:

[0107] a) Pick a single colony of strain yWWY001 or yWWY002 and inoculate it into 5 mL of SC-His liquid medium. Cultivate overnight at 220 rpm and 30°C until the stationary phase.

[0108] b) Measure the OD of the culture medium using a UV spectrophotometer 600 ;

[0109] c) Take an appropriate amount of bacterial solution and add it to the SC-His solid medium that has been sterilized and cooled to about 45°C. Adjust the initial OD value of the bacterial solution. 600 The concentration is 0.1, the bacterial solution and culture medium are fully mixed and poured into the plate;

[0110] d) After the culture medium has solidified, use a 200 μL sterile pipette tip to create a hole approximately 6 mm in diameter in the center of the plate.

[0111] e) Add 50 μL of nystatin stock solution into the well;

[0112] f) After the drug is completely absorbed in the clean bench, transfer the sample to an incubator at 30°C and incubate for 2 days to measure the diameter of the inhibition zone.

[0113] The results showed that compared with the yWWY002 strain transformed with the backbone plasmid, the strain yWWY001 carrying the YJL151C extra copy plasmid had significantly improved tolerance to nystatin. The doubling dilution plating experiment showed that yWWY001 could form dense and regular colonies under 0.5mg / L and 5mg / L nystatin stress, while the control group yWWY002 could not grow on the 5mg / L nystatin plate. Figure 1 The results of the inhibition zone assay showed that the edges of the inhibition zones formed by the two groups of strains were clear and regular, and no secondary colonies grew within the zones. Figure 2As shown in A. Quantitative analysis showed that the average diameter of the inhibition zone of yWWY001 was 29.56 mm, which was significantly smaller than the 34.00 mm of the control strain yWWY002. Figure 2 As shown in Figure B. Calculations show that yWWY001's tolerance to AmB is 13% higher than the control, confirming that overexpression of YJL151C significantly enhances the strain's nystatin resistance. Note: The 6 mm punch diameter is not subtracted from the inhibition zone above.

[0114] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of any of the following in improving yeast resistance to nystatin: (1) Overexpression of the YJL151C gene or an agent that overexpresses the YJL151C gene; (2) Increasing the activity and / or protein level of YJL151C protein, or an agent for increasing the activity and / or protein level of YJL151C protein.

2. The use according to claim 1, wherein the nucleic acid sequence of YJL151C is selected from any one of the following: (1) the nucleotide sequence shown in SEQ ID NO: 1; (2) A nucleotide sequence having the same or similar function as the nucleotide sequence shown in (1) obtained by substituting, deleting, adding or modifying one or more bases in the sequence shown in (1); (3) A nucleotide sequence having at least 80% identity with the sequence shown in (1) or (2).

3. The use according to claim 1, characterized in that The yeast includes Saccharomyces cerevisiae, Saccharomyces mikae or Saccharomyces cerevisiae.

4. A product for improving yeast resistance to nystatin, characterized in that: It includes a biological material that overexpresses the YJL151C gene; the biological material that overexpresses the YJL151C gene includes any one of the following: (1) an expression cassette containing the YJL151C gene; (2) a recombinant vector containing the expression cassette described in (1); (3) Transfect or transform the host with the recombinant vector (2), or the host with the expression cassette (1) integrated into its genome.

5. The product according to claim 4, characterized in that The backbone of the recombinant vector includes pRS series vectors.

6. Use of the product according to claim 4 or 5 in improving the resistance of yeast to nystatin.

7. A yeast strain resistant to nystatin, characterized in that: It comprises the recombinant vector in the product of claim 4 or 5, or the YJL151C gene is integrated into its genome.

8. The method for constructing a yeast strain according to claim 7, characterized in that: The expression cassette or expression vector in the product of claim 4 or 5 is transferred into the base bacteria.

9. A microbial agent, characterized in that: The method comprises the yeast strain according to claim 7 or the yeast strain obtained by the construction method according to claim 8, and an acceptable auxiliary agent.

10. Use of the yeast strain according to claim 7, the yeast strain obtained by the construction method according to claim 8, or the microbial agent according to claim 9 in any of the following aspects: (1) Preservation and antiseptic properties of food and / or fruits and vegetables, or preparation of preservatives and antiseptics for food and / or fruits and vegetables; (2) preventing and controlling plant fungal diseases, or preparing biological control agents for preventing and controlling plant fungal diseases; (3) Inhibit harmful fungi in feed or prepare feed biological control agents.

Images