New bradyrhizobium strain SBM1 as well as preparation and application thereof

Abstract

The invention discloses a novel bradyrhizobium strain SBM1 as well as a preparation and application thereof, and belongs to the technical field of microorganisms. The novel bradyrhizobium strain SBM1 disclosed by the invention is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.29121. The strain has good tolerance to herbicides, bactericides and insecticides, and is high in nodulation and nitrogen fixation capacity, wide in symbiotic spectrum and remarkable in nitrogen-saving and high-yield-promoting capacity. Under the field planting condition that the application amount of nitrogen fertilizer is reduced by 50%, the strain can remarkably improve the nitrogen fixation and growth performance of crops, so that a strain source is provided for obtaining a rhizobium inoculant suitable for planting various varieties of peanuts, the application amount of the nitrogen fertilizer is reduced, normal implementation of crop pesticides is guaranteed, and the economic benefit is increased. The important significance is realized on the increase of the crop yield.

Description

Technical Field

[0001] The present invention belongs to the technical field of microorganisms, and in particular relates to a new Bradyrhizobium species SBM1, a preparation thereof and an application thereof. Background Art

[0002] Currently, excessive nitrogen fertilizer application is common in peanut cultivation. This excessive use not only fails to promote high peanut yields but can even lead to more serious ecological and environmental problems, such as increased soil acidification and salinization, reduced crop resilience, imbalanced soil microbial communities, and increased greenhouse gas emissions. Bradyrhizobium is a Gram-negative bacterium widely distributed in soil that forms nodules and fixes nitrogen in a symbiotic relationship with peanuts, providing 60-65% of the nitrogen needed for growth and possessing significant nitrogen-saving potential. Therefore, leveraging the symbiotic relationship between Bradyrhizobium and peanuts and rationally applying nitrogen fertilizer can effectively alleviate environmental issues, save costs, and ultimately achieve sustainable, green agriculture.

[0003] Herbicides, fungicides, and insecticides are widely used in peanut cultivation, but these pesticides significantly inhibit or kill beneficial rhizosphere microorganisms, limiting the effectiveness of microbial fertilizers. Therefore, identifying peanut bradyrhizobia strains with drug resistance and formulating them into rhizobium inoculants, microbial fertilizers, or seed dressings containing bradyrhizobia and pesticides can not only avoid pesticides that are harmful to rhizobia or beneficial microorganisms but also inhibit weed growth, pathogen growth, and insecticides while promoting nodulation, nitrogen fixation, and high peanut yields. Furthermore, while peanut bradyrhizobia inoculants offer numerous advantages in agricultural production, their effectiveness is highly variable due to their regional and peanut variety preferences. Therefore, identifying peanut bradyrhizobia strains with broad pesticide resistance, a broad symbiotic spectrum, excellent nodulation and nitrogen fixation, and the ability to promote high peanut yields is of great significance and value to peanut production. Summary of the Invention

[0004] The present invention provides a new Bradyrhizobium sp. SBM1, which is deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No. 29121.

[0005] The new Bradyrhizobium species SBM1 can tolerate multiple pesticides, has strong nodulation and nitrogen fixation capabilities, a broad symbiotic spectrum, and significant nitrogen-saving and high-yield promoting capabilities. Based on this, the present invention provides the use of the new Bradyrhizobium species SBM1 in promoting plant nodulation, nitrogen fixation, and / or growth.

[0006] The present invention provides a rhizobium agent, which contains the new Bradyrhizobium species SBM1 and may also contain other conventional auxiliary materials.

[0007] The dosage form of the above-mentioned rhizobium agent can be selected from liquid agent, powder or granule.

[0008] In a specific embodiment, the bacterial agent is a liquid bacterial agent, which is obtained by culturing the new Bradyrhizobium species SBM1 in a TY liquid medium; the concentration of the new Bradyrhizobium species SBM1 in the liquid bacterial agent is 1×10 10 cfu / mL.

[0009] The present invention provides the use of the above-mentioned rhizobium agent in promoting plant nodulation, nitrogen fixation and / or growth.

[0010] The new Bradyrhizobium species SBM1 or rhizobium inoculant can replace part of nitrogen fertilizer and form microbial fertilizer with phosphorus fertilizer and potassium fertilizer. Based on this, the present invention provides the use of the new Bradyrhizobium species SBM1 or rhizobium inoculant in the preparation of microbial fertilizer.

[0011] The present invention provides a microbial fertilizer, which contains the new Bradyrhizobium species SBM1 or rhizobium agent, phosphate fertilizer and potash fertilizer.

[0012] The present invention provides a rhizobium seed coating agent, comprising the novel Bradyrhizobium species SBM1. The seed coating agent may further comprise trace elements, sodium carboxymethyl cellulose, and / or a pesticide. The pesticide may be selected from quizalofop-p-ethyl, haloxyfop-p-ethyl, carbendazim, metalaxyl-mexamfe, imidacloprid, or thiamethoxam.

[0013] Preferably, in the seed coating agent, the concentration of quizalofop-p-ethyl is ≤75ppm, the concentration of fluazifop-p-ethyl is ≤108ppm, the concentration of carbendazim is ≤1667ppm, the concentration of metalaxyl and benomyl is ≤143ppm, the concentration of imidacloprid is ≤93ppm, and the concentration of thiamethoxam is ≤60ppm.

[0014] The present invention provides a seed coating method, comprising the following steps:

[0015] Trace element mother liquor is added to the bacterial liquid of the new Bradyrhizobium strain SBM1, and mixed to form a mixed bacterial liquid; the mixed bacterial liquid is then evenly sprayed on the surface of seeds and dried in the shade; the shade-dried seeds are mixed again with sodium carboxymethyl cellulose solution, coated, and dried in the shade.

[0016] If the seeds need to be coated with pesticides, after the seeds have been mixed with the new strain of Bradyrhizobium SBM1 and sodium carboxymethyl cellulose solution, the seeds can be mixed with a pesticide diluent of corresponding concentration to achieve pesticide coating.

[0017] The seed coating process can also be carried out directly using the above-mentioned rhizobium seed coating agent.

[0018] The above-mentioned new species of Bradyrhizobium SBM1 bacterial solution is obtained by culturing the above-mentioned new species of Bradyrhizobium SBM1 in TY liquid medium; the concentration of the new species of Bradyrhizobium SBM1 in the bacterial solution is 1×10 10 cfu / mL.

[0019] The composition of the trace element mother solution is as follows: H3BO3 2.86g / L, MnSO4 1.81g / L, CuSO4·5H2O0.80g / L, ZnSO4 0.22g / L, H2MoO4 0.02g / L, and the balance is water; wherein the trace elements function to provide nutrients for plants.

[0020] The sodium carboxymethylcellulose solution is selected from an aqueous solution containing sodium carboxymethylcellulose with a final concentration of 10 g / L, that is, a concentration of 1%.

[0021] The volume ratio of the trace element mother solution to the Bradyrhizobium sp. SBM1 bacterial solution is selected from 1:1000. That is, the amount of the trace element mother solution added to the bacterial solution can be selected from: adding 1 mL of the trace element mother solution to every 1000 mL of the bacterial solution.

[0022] The usage of the above mixed bacterial solution is 150mL / 30kg seeds.

[0023] The sodium carboxymethylcellulose solution is used in an amount of 150 mL / 30 kg of seeds to maintain the attachment of the new Bradyrhizobium species SBM1 and the surface moisture of the seeds.

[0024] In the present invention, the plant is selected from leguminous plants; preferably peanut.

[0025] The beneficial effects of the present invention are:

[0026] The new Bradyrhizobium strain SBM1 provided by the present invention exhibits good tolerance to herbicides, fungicides, and insecticides, strong nodulation and nitrogen fixation abilities, a broad symbiotic spectrum, and remarkable nitrogen-saving and high-yield performance. Under field cultivation conditions with a 50% reduction in nitrogen fertilizer application, this strain can significantly improve crop nitrogen fixation and growth performance, thus providing a source of rhizobia suitable for a variety of peanut varieties. This not only reduces nitrogen fertilizer application but also ensures the proper application of crop pesticides, significantly contributing to increased crop yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The colony morphology of SBM1 on TY medium;

[0028] Figure 2 is the Gram staining image of SBM1 bacteria;

[0029] Figure 3 is the evolutionary tree of 16S rDNA and atpD genes of SBM1;

[0030] Figure 4 is the evolutionary tree of recA and nifH genes of SBM1;

[0031] Figure 5 To determine the pesticide tolerance of SBM1;

[0032] Figure 6 The symbiotic situation of peanut inoculated with SBM1 under greenhouse culture conditions;

[0033] Figure 7 This shows the growth of peanuts inoculated with SBM1 under field cultivation conditions in 2023. DETAILED DESCRIPTION

[0034] 1. Test materials

[0035] (1) The culture medium, reagents and other materials used in the present invention are as follows:

[0036] TY medium: 5 g of tryptone, 3 g of yeast powder, and 0.6 g of CaCl2, 1000 mL of deionized water, pH 6.8-7.2, 15-20 g of agar (solid medium), sterilized at 121°C for 30 min.

[0037] YMA medium: mannitol 10.0 g, K2HPO4 0.25 g, KH2PO4 0.25 g, MgSO4 0.1 g, NaCl 0.1 g, yeast extract 3.0 g, deionized water 1000 mL, pH 6.8-7.0, agar 15-20 g (solid medium), sterilized at 121°C for 20 min.

[0038] Blood agar medium: 18 g peptone, 1 g yeast powder, 5 g NaCl, 15-20 g agar (solid medium), 1000 mL deionized water, pH 6.8-7.2. Sterilize at 121°C for 20 min. After the medium cools to 50°C, add 5% (5 mL / 100 mL) defibrinated sheep blood, mix well, and pour onto plates.

[0039] 20× plant low-nitrogen nutrient solution: 0.075 g of ferric citrate, 0.03 g of Ca(NO3)2, 0.136 g of K2HPO4, 0.46 g of CaSO4, 0.075 g of KCl, 0.06 g of MgSO4·7H2O, 20 mL of trace element stock solution, and 1000 mL of deionized water.

[0040] Trace element mother solution: H3BO3 2.86g, H2MoO4 0.02g, ZnSO4 0.22g, CuSO4·5H2O 0.8g, MnSO4 1.81g, deionized water 1000mL.

[0041] Sterile saline: NaCl 0.8 g, deionized water 100 mL, sterilized at 121 °C for 30 min.

[0042] Water agar medium: 0.6 g agar powder, 100 mL deionized water, sterilize at 121°C for 30 min.

[0043] Sodium carboxymethyl cellulose solution (seed surface protectant): Dissolve 1 g of sodium carboxymethyl cellulose (800-1200 mPa·s) in 100 mL of 60°C deionized water and stir until a transparent paste is obtained.

[0044] Pesticide solid culture medium: Select herbicides, fungicides, and insecticides commonly used in peanut cultivation in Shandong Province. Set up four concentration gradients, descending from the highest concentration in the instructions. Calculate the dosage per 30 mL for each gradient (Table 1). After sterilization, cool the TY solid culture medium to approximately 50°C. Quickly add the pesticides in each of the four concentration gradients. Shake well and pour onto plates. Set up three replicates for each concentration gradient.

[0045] Table 1 Pesticide gradient settings and corresponding pesticide contents used in the experiment

[0046]

[0047]

[0048] The nitrogen, phosphorus and potassium fertilizers applied in the field are conventional urea, calcium magnesium phosphate and potassium sulfate.

[0049] (2) Primer information

[0050] The primers used in the present invention are shown in Table 2:

[0051] Table 2 Primer information

[0052]

[0053] The genome extraction kit, Taq Mix for PCR amplification, and ddH2O were all from Kangrun Biotechnology Co., Ltd.

[0054] 2. Isolation and identification of bacterial strains

[0055] Peanut root nodules were collected in Muping District, Yantai City, Shandong Province on June 28, 2020. The nodules were disinfected with 75% alcohol solution for 1 minute, sodium hypochlorite solution (sodium hypochlorite:water = 1:5) for 7 minutes, and rinsed eight times with sterile water to obtain surface-sterile nodules. Tissue fluid from the sterile nodules was streaked onto YMA solid medium and incubated at 28°C for 14 days. After colonies emerged, individual colonies were selected, purified three times on TY solid medium, and stored at -80°C. This strain was designated SBM1.

[0056] The strain SBM1 was identified according to the method described in the "Berger's Manual of Bacterial Identification" (8th edition). The specific results are as follows:

[0057] (1) Morphological and biological characteristics

[0058] The strain SBM1 was inoculated on TY solid medium and cultured at a constant temperature of 28°C. Its colony morphology included: the colonies were small, white, round, with a moist and smooth surface and opaque, such as Figure 1 Gram staining is red, indicating that the strain is a Gram-negative bacterium, such as Figure 2 shown.

[0059] (2) Genetic characteristics

[0060] 16S rDNA, atpD, recA, nifH sequence sequencing:

[0061] The genomic DNA of bacterial strain SBM1 was extracted and PCR amplified using universal primers for 16S rDNA, housekeeping gene atpD, housekeeping gene recA, and rhizobium symbiotic gene nifH.

[0062] The amplification system is (50 μL):

[0063] Taq Mix 25 μL, ddH2O 22 μL, forward primer P1 / F 1 μL (concentration 10 μmol / L), reverse primer P6 / R 1 μL (concentration 10 μmol / L), DNA template 1 μL.

[0064] Amplification reaction conditions are:

[0065] 95°C for 5 min; 94°C for 1 min; 60°C / 58°C for 30 s; 72°C for 90 s for 30 cycles; and a final extension at 72°C for 10 min. PCR primer synthesis and sequencing were performed by Qingke Sequencing.

[0066] Sequencing results:

[0067] The double-end sequencing sequences were spliced using DNAMAN software to obtain a total of 1357 bp of 16S rDNA sequence, the nucleotide sequence of which is shown in SEQ ID No: 1.

[0068] 16S rDNA sequence (SEQ ID No:1):

[0069]

[0070] A 537 bp housekeeping gene atp D sequence was obtained, and its nucleotide sequence is shown in SEQ ID No: 2.

[0071] atp D sequence (SEQ ID No: 2):

[0072] TGCAACGATGATGAGCCGGTCCCGTCAAGTCGGAAGGCCTGCGCCGATCCACCAGGAAGCGCCCACCTACACCGACCAGTCGACCGAAGCTGAAATTCTCGTCACCGGCATCAAGGTCGTCGACCTGCTCGCT CCGTATGCCAAGGGCGGCAAGATCGGCCTGTTCGGCGGCGCCGGCGTCGGCAAGACCGTGCTGATTCAGGAGCTGATCAACAACGTCGCGAAGGCGCACGGCGGTTACTCCGTGTTCGCCGGCGTCGGCGAGCG TACCCGCGAAGGCAACGACCTCTATCACGAGTTCATCGAGTCCAAGGTCAACGCCGATCCGAAGAATCCGGATCCGAGCGTGAAGTCGAAGTGCGCGCTGGTGTTCGGCCAGATGAACGAGCCGCCGGGCGCCC GCGCCCGCGTCGCGCTCACCGGTCTGACCATTGCGGAAGACTTCCGCGACAGGGGCCAGGACGTGCTGTTCTTCGTCGACAACATCTTCCGCTTCACCCAGGCAGGTCGGAAGGGGGGGCCGAAAAAAACACCTT

[0073] A 524 bp housekeeping gene rec A sequence was obtained, and its nucleotide sequence is shown in SEQ ID No: 3.

[0074] rec A sequence (SEQ ID No: 3):

[0075] CTGCGGACGACCGTTCGATGGAATCGAGGCGGTCTCGTCGGGCTCGCTGGGGCTGGACATCGCGCTCGGCATCGGCGGCCTGCCCAAGGGGCGTATCGTCGAGATCTACGGGCCGGAATCGTCGGGCAAGACCACCCTGGCGCTGCATACCGTGGCGGAAGCCCAGAAGAAGGGCGGCATTTGCGCCTTCATCGACGCCGAGCACGCGCTCGACCCGGTCTATGCCCGCAAGCTCGGGGTCAACATCGACGAGCTCTTGATCTCGCAACCCGACACCGGCGAGCAGGCGCTGGAAATCTGCGACACGCTGGTGCGCTCGGGTGCGGTGGATGTGCTGGTGGTCGATTCGGTCGCGGCGCTGGTGCCGAAGGCCGAGCTCGAAGGCGAGATGGGCGATGCACTGCCGGGTCTTCAAGCGCGGTTGATGAGCCAGGCGCTGCGCAAGCTGACCGCCTCGATCAACAAGTCCAACACCATGGTGATCTTCATCAACCAGATCCGCATGAAAGGGGGGGTCCTCTTGA

[0076] The symbiotic gene nif H sequence of 659 bp was obtained, and its nucleotide sequence is shown in SEQ ID No:4.

[0077] nif H sequence (SEQ ID No:4):

[0078] GGGTAATCGACGACTCGACTTGCGCGGCAAAACACAGATCAAGGAATTCGCGTCGTTCCCGACGCTCGAGCAGCTTCCGCTCTGGGGCTTCGATGGCTCCTCCACCCAGCAGGCCGAAGGCCACAGCTCCGATTGCGTGCTGAAGCCGGTCGCCGTGTTCCCGGACGCCGCGCGCACCAACGGCGTGCTCGTGATGTGCGAAGTCATGATGCCCGATGGCAAGACCCCGCACGCGTCCAACAAGCGCGCCACCATCCTCGATGACGCCGGCGCATGGTTCGGCTTCGAGCAGGAATACTTCTTCTACAAGGACGGCCGTCCGCTCGGCTTCCCGTCGTCCGGCTATCCGGCGCCGCAGGGCCCGTACTACACCGGCGTCGGCTTCTCCAACGTCGGCGACGTCGCCCGCAAGATCGTCGAAGAGCATCTCGACCTCTGCCTGGCTGCCGGCATCAACCATGAAGGCATCAACGCGGAAGTCGCGAAGGGCCAGTGGGAATTCCAGATCTTCGGCAAGGGCTCCAAGAAGGCCGCTGACGAAATGTGGATGGCCCGCTACCTGATGCTGCGCCTGACCGAGAAGTACGGCATCGACATCGAGTTCCACTGCAAGCCGCTCGGTGACACCGACTGGACGTCCCCCCCTTTTTTGGGGGGAA

[0079] BLAST alignment was performed on the NCBI website and the ML species tree was constructed. The results are as Figure 3 and Figure 4As shown, the 16S rDNA of strain SBM1 clustered with all Bradyrhizobium species, indicating that SBM1 belongs to the genus Bradyrhizobium. The atpD gene tree showed that the atpD gene of SBM1 shared a common ancestor with Bradyrhizobium sp. CCBAU 53338, but at different evolutionary distances. The recA gene tree showed that the recA gene of SBM1 was homologous to Bradyrhizobium sp. CCBAU 53338, but at different evolutionary distances. The nifH gene tree showed that the nifH gene of SBM1 was homologous to rhizobia of the genus Bradyrhizobium japonicum, but at different evolutionary distances, and did not cluster at all with Bradyrhizobium sp. CCBAU 53338. Therefore, the results of the housekeeping and symbiotic gene mapping revealed that SBM1 is not the same strain as Bradyrhizobium sp. CCBAU 53338, but rather a new, unnamed species. Combining its morphological and biological characteristics, the strain was identified as Bradyrhizobium mupingense SBM1.

[0080] The bacterium was deposited on November 23, 2023, at the China General Microbiology Culture Collection Center (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China), with the deposit number CGMCC No. 29121. The proposed taxonomic name is Bradyrhizobium sp.

[0081] 3. Safety testing

[0082] Strain SBM1 was inoculated into blood agar and cultured at 28°C for 14 days, observing for the presence of hemolytic zones. The presence of hemolytic zones indicates hemolytic activity, posing a potential threat to humans and animals, and therefore should not be used in microbial fertilizers. The absence of hemolytic zones indicates the strain is inactive and safe for use as a microbial fertilizer. The results showed that after 14 days of culture on blood agar, no hemolytic zones were observed, indicating negative hemolytic activity, indicating that the strain is safe for use in microbial fertilizers.

[0083] The other materials used in the present invention, unless otherwise stated, can be obtained through commercial channels. Unless otherwise specified, other terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art. The present invention will be further described in detail below with reference to specific examples and data. The following examples are merely for illustration of the present invention and are not intended to limit the scope of the present invention in any way.

[0084] Example 1

[0085] Pesticide resistance test:

[0086] The strain SBM1 was inoculated into TY liquid medium and cultured at 37°C and 180 rpm / min for 4 days. 600nm Adjust to 0.2. Spot 2 μL of bacterial solution onto pesticide solid culture medium, culture at 37°C for 7 days, and observe the growth of colonies.

[0087] The test results are shown in Table 3 and Figure 5 As shown, Figure 5 The growth status of the colony that tolerates the highest concentration of pesticide is shown:

[0088] Table 3 Drug resistance identification results of strain SBM1

[0089]

[0090]

[0091]

[0092] Note: + indicates that the strain grew normally; - indicates that the strain did not grow.

[0093] The above results show that strain SBM1 has a certain degree of drug resistance. Among them, the maximum tolerance concentrations for the herbicides quizalofop-p-ethyl and haloxyfop-p-ethyl were 75ppm and 108ppm, respectively; the maximum tolerance concentrations for the insecticides imidacloprid and thiamethoxam were 93ppm and 60ppm, respectively; and the maximum tolerance concentrations for the fungicides metalaxyl and hydroxyfop-butyl and carbendazim were 143ppm and 1667ppm, respectively. These results indicate that strain SBM1 can be used in peanut cultivation with appropriate concentrations of quizalofop-p-ethyl, haloxyfop-p-ethyl, imidacloprid, thiamethoxam, metalaxyl and hydroxyfop-butyl, or carbendazim in a seed dressing containing a mixture of bradyrhizobium and pesticides.

[0094] Example 2

[0095] Nodulation and growth-promoting ability test:

[0096] Prepare a low-nitrogen nutrient solution for plants by mixing 100 mL of low-nitrogen solution with 1 kg of vermiculite. Add an appropriate amount of deionized water to keep the vermiculite moist and sterilize at 121°C for 90 minutes. The peanut variety used in the experiment was BS1016. The seed disinfection process was as follows: disinfect with 75% alcohol solution for 1 minute, disinfect with sodium hypochlorite solution (sodium hypochlorite: water = 1:4) for 10 minutes, rinse with sterile water 8 times and soak for 10 minutes. The sterile seeds were germinated in the dark on water agar medium for 4 days. The strain SBM1 and the control strain Bradyrhizobium zhanjiangense CCBAU 51778 were used. T (Model strain with normal symbiotic effect) was inoculated into TY liquid medium and cultured at 28°C and 180 rpm / min for 5 days. 600nm Adjust to 0.2. Use the double-layer pot method to plant peanuts. The upper layer of the device contains the sterile vermiculite in the above step, and the lower layer contains sterile water. The upper vermiculite is absorbed by a sterile gauze. Plant the germinated peanut seeds in the vermiculite and inoculate 1mL SBM1 bacterial solution, 1mL CCBAU 51778 T The SBM1 treatment group, the 51778 positive control group, and the CK negative control group were treated with either sterile saline or sterile saline. Each treatment group had 10 replicates of peanut plants. Peanuts were cultured in a greenhouse at 28°C under 12 hours of daylight and 12 hours of darkness. Symbiotic phenotypes of peanuts were measured 40 days after inoculation, including nodule number, nodule fresh weight, chlorophyll content, and aboveground dry weight.

[0097] The test results are shown in Table 4 and Figure 6 As shown:

[0098] (1) The nodule number, nodule fresh weight and chlorophyll content of the 51778 positive control treatment and SBM1 treatment were significantly higher than those of the CK negative control treatment, indicating that rhizobia 51778 and SBM1 can provide nitrogen to peanuts through nodulation and nitrogen fixation, thereby significantly increasing the chlorophyll content of peanuts.

[0099] (2) The nodule number and fresh weight of SBM1-treated cells were significantly higher than those of the 51778 positive control, indicating that the nodulation ability of SBM1 was significantly higher than that of 51778.

[0100] (3) The aboveground dry weight of the SBM1 treatment was significantly higher than that of the CK negative control treatment, indicating that the rhizobium SBM1 has the ability to promote peanut growth and increase the dry matter weight of peanuts.

[0101] The above results indicate that SBM1 has strong nodulation and nitrogen fixation abilities, and also has the ability to promote dry matter accumulation in peanuts.

[0102] Table 4 Symbiotic phenotype of peanuts inoculated with SBM1 under greenhouse culture conditions (P<0.05)

[0103] deal with Nodule number Nodule fresh weight (g / plant) Chlorophyll content Dry weight above ground (g / plant) CK negative control 0c 0c 35.25±1.20b 1.42±0.12b 51778 positive control 67.33±8.33b 0.10±0.01b 44.73±0.55a 1.86±0.16ab SBM1 98.00±15.41a 0.21±0.03a 45.65±0.64a 2.06±0.26a

[0104] Example 3

[0105] Peanut symbiotic spectrum detection:

[0106] Soil from the experimental field of Shandong Peanut Research Institute in Laixi City, Shandong Province was divided into 5L pots with equal weight of soil in each pot and watered until soaked. Peanut varieties included Luhua 11, Yuhua 9326, Rihua 1, Huayu 36, Huayu 22, Zhonghua 24, Huayu 917, and Baisha 1016. Strain SBM1 and control rhizobium strain Bradyrhizobium zhanjiangense CCBAU 51778 were used. T Inoculate in TY liquid medium and culture at 28℃, 180rpm / min shaking for 5 days. 600nm Adjust to 0.2. Spray the bacterial solution evenly on the surface of the seeds and dry them in the dark. Evenly coat the surface of the dried seeds with sodium carboxymethyl cellulose solution and dry them in the dark. Plant the coated seeds in flower pots. For each peanut variety, 3 pots were treated with SBM1 and 3 pots were inoculated with CCBAU 51778. T A positive control treatment (51778) and a negative control treatment (CK) without rhizobium inoculation were used, with three seeds planted in each pot. Peanuts were placed in a greenhouse and watered every two days for 40 days. The number of nodules on the peanut plants was measured.

[0107] The results of the nodule number determination of peanut plants are shown in Table 5. Compared with CK, SBM1 increased the nodule number of Luhua 11, Yuhua 9326, Jihua 6, Rihua 1, Huayu 36, Huayu 22, Huayu 917 and Baisha 1016 by 214.86%, 3050%, 18.04%, 281.57%, 33.66%, 463.89%, 687.76% and 191.67% respectively. 51778 increased the nodule number of Luhua 11, Yuhua 9326, Jihua 6, Rihua 1, Huayu 36, Huayu 22, Huayu 917, and Baisha 1016 by 584.12%, 3822.22%, -31.25%, 1148.39%, -46.67%, -28.57%, -17.35%, and 329.17%, respectively. The above results indicate that SBM1 can increase the nodule number of the eight peanut varieties. The positive control rhizobium CCBAU 51778 T It only increased the number of nodules in four peanut varieties. In general, the nodulation symbiosis spectrum of strain SBM1 is broader than that of strain 51778, that is, SBM1 has a broad spectrum of promoting nodulation in multiple peanut varieties and can be used to promote the cultivation of multiple peanut varieties in multiple regions.

[0108] Table 5 Number of nodules symbiotically grown with SBM1 and different peanut varieties

[0109]

[0110]

[0111] 1. Field application

[0112] Before application in the field, make the following preparations:

[0113] Strain activation and expansion culture:

[0114] The SBM1 strain stored in a -80°C freezer was activated on YMA solid medium using a three-zone streak method and cultured in a 28°C constant temperature incubator for 14 days. A single colony was inoculated into TY liquid medium for expansion and cultured in a shaker at 28°C and 180 rpm / min until the bacterial concentration reached 1×10 10 cfu / mL. Before use, add trace element mother solution (1mL / 1000mL) to the inoculum and mix well.

[0115] Peanut seed coating:

[0116] Spray the inoculant evenly on the surface of the seeds until the surface is moistened, and place them in a cool place to dry. The dried seeds are mixed with 1% sodium carboxymethyl cellulose solution (150 mL / 30 kg of seeds) to maintain the adhesion of the inoculant and the moisture, and then dry them in the shade.

[0117] Watering before sowing:

[0118] Use manual or machine sowing, water 3 days before sowing to ensure the necessary moisture in the soil, which is conducive to the survival of the strain and seed germination.

[0119] Peanut field planting is as follows:

[0120] The experimental site was located at the Peanut Research Institute of Shandong Province in Laixi City, Shandong Province. The peanut variety selected was Huayu 917. The sowing dates were April 30, 2022 (the sowing site was on the north side of Xipodi Road) and May 13, 2023 (the sowing site was on the south side of Xipodi Road). Since the conventional pure nitrogen application rate was 120 kg / ha, the pure nitrogen application rate was 60 kg / ha when the nitrogen was reduced by 50% in the experimental field. Based on this, the urea application rate was deduced to be 135 kg / ha when the nitrogen was reduced by 50%. Phosphate fertilizer (calcium magnesium phosphate fertilizer) and potassium fertilizer (potassium sulfate) were applied at conventional rates of 750 kg / ha and 240 kg / ha, respectively. The conventional fertilization level can be found in the literature "Wang Chunxiao et al. Effects of different nitrogen fertilizer rates combined with organic fertilizer on peanut aging and nodulation. Journal of Peanut Science, 2023, 52(2):1-7." All fertilizers were mixed as base fertilizer and applied to the soil at one time.

[0121] The land was tilled and ridged according to conventional methods, with a ridge width of 0.85 m and a spacing of 0.4 m. One mu of land was divided into six equal plots. Two treatments were set up: an uninoculated control (CK) and one inoculated with the SBM1 strain, with three plots per treatment, all randomly distributed. The biological agent used was Bradyrhizobium SBM1.

[0122] For peanut planting, peanut seeds were sown in one ridge and two rows, with two seeds per hole and a hole spacing of 0.02m. Subsequent peanut cultivation was carried out according to conventional treatment. Samples were taken on July 31, 2023 (pod stage) and September 22, 2023 (maturity stage) to measure peanut growth indicators. The peanut yield of each plot was measured on September 27, 2022 and September 22, 2023. Specifically, a ridge with a length of 2m and uniform growth was measured, all peanut fruits in the ridge were collected, and the yield was measured after natural drying (the dry weight of peanuts in shell was measured). The peanut yield per hectare was converted using the following calculation formula:

[0123] Peanut yield per hectare = dry weight of peanuts / (0.85×2)×666.7×15

[0124] After testing, the growth indicators of peanuts inoculated with SBM1 in both years were higher than those of the control group. The following results mainly show the various indicators in 2023.

[0125] The test results are shown in Tables 6 to 8 and Figure 7 As shown:

[0126] Table 6 Peanut yield (kg / ha) after inoculation with SBM1 in 2022 and 2023

[0127]

[0128] Table 7 Growth parameters of peanut pods during the 2023 application of SBM1 inoculant

[0129] deal with CK SBM1 Increase compared to CK / % Nodule number 589.52±38.71 638.74±76.84 8.35 Number of side branches 8.83±0.26 9.00±0.38 1.89 Number of pods 20.94±2.07 25.56±1.86 16.47 Number of fruit needles 32.44±3.16 39.61±3.13 17.93 Side branch length (cm) 41.09±1.22 41.22±0.99 0.33 Dried fruit weight (g / 6 pieces) 34.65±3.28 39.03±6.46 12.64 Above-ground dry weight (g / tree) 24.08±1.47 26.19±1.74 8.78

[0130] Table 8 Growth parameters of peanuts at maturity after application of SBM1 inoculant in 2023

[0131] deal with CK SBM1 Increase compared to CK / % Nodule number 484.13±50.38 585.91±32.39 21.02 Effective (pieces / tree) 36.67±2.17 37.22±4.01 1.52 Number of fruit needles 37.41±2.44 39.83±3.09 6.47 Main stem height (cm) 41.69±0.68 42.03±0.70 0.79 Dried fruit weight (g / fruit) 73.80±4.08 74.91±7.53 1.51

[0132] Planting results showed that, while reducing nitrogen fertilizer application by 50%, Bradyrhizobium SBM1 increased peanut yield by 4.89-9.73% at maturity. It also increased the number of nodules, lateral branches, pods, spiky numbers, lateral branch length, fruit stem weight, and aboveground dry weight at the pod-setting stage, as well as the number of nodules, effective number of pods, spiky numbers, main stem height, and fruit stem weight at maturity. These results suggest that SBM1 has significant potential for field application in reducing nitrogen fertilizer application and promoting yield, and could be used as a stable and efficient microbial fertilizer strain resource.

[0133] It is worth noting that the number of peanut nodules in a given year is closely related to the residual nitrogen source in the previous year's plot. If there is a large amount of residual nitrogen source in the previous year's plot, then during the peanut planting process, excess nitrogen fertilizer will inhibit the growth and number of peanut nodules, resulting in large differences in the number of nodules when the same variety of peanuts is planted in different plots. However, this does not affect the experimental results of the present invention. The purpose of the present invention is to provide a strain that can improve the nitrogen fixation ability of peanuts. Obviously, as shown in the above experimental results, the SBM1 strain provided by the present invention can increase the number of peanut nodules when planted in the current year, affect its various growth indicators, and ultimately increase peanut yield.

[0134] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above-disclosed technical content to modify or modify the present invention into equivalent embodiments. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the present invention.

Claims

1. A new Bradyrhizobium species SBM1, characterized by: The strain is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number of CGMCC No.29121.

2. Use of the new Bradyrhizobium species SBM1 according to claim 1 in promoting plant nodulation, nitrogen fixation and / or growth.

3. A rhizobium agent, characterized in that The bacterial agent contains the new Bradyrhizobium species SBM1 according to claim 1.

4. The rhizobium agent according to claim 3, characterized in that The dosage form of the rhizobium agent is selected from liquid agent, powder or granule.

5. Use of the new Bradyrhizobium species SBM1 according to claim 1 or the Rhizobium agent according to claim 3 in the preparation of microbial fertilizers.

6. A microbial fertilizer, characterized in that: The fertilizer contains the new Bradyrhizobium species SBM1 according to claim 1 or the rhizobium agent according to claim 3, phosphate fertilizer and potash fertilizer.

7. A rhizobium seed coating agent, characterized in that The seed coating agent contains the new Bradyrhizobium species SBM1 according to claim 1.

8. The seed coating agent according to claim 7, characterized in that The seed coating agent further contains trace elements, sodium carboxymethyl cellulose and / or pesticides; the pesticides are selected from quizalofop-p-ethyl, haloxyfop-p-ethyl, carbendazim, metalaxyl-hydroxybenzoate, imidacloprid or thiamethoxam.

9. The seed coating agent according to claim 8, characterized in that The concentration of quizalofop-p-ethyl is ≤75ppm, the concentration of fluazifop-p-ethyl is ≤108ppm, the concentration of carbendazim is ≤1667ppm, the concentration of metalaxyl and benomyl is ≤143ppm, the concentration of imidacloprid is ≤93ppm, and the concentration of thiamethoxam is ≤60ppm.

10. A seed coating method, characterized in that: Here are the steps: Adding a trace element mother solution to the above-mentioned Bradyrhizobium new strain SBM1 bacterial solution and mixing well to form a mixed bacterial solution; then spraying the mixed bacterial solution evenly on the surface of seeds and drying in the shade; mixing the shade-dried seeds again with a sodium carboxymethyl cellulose solution, coating them, and drying them in the shade; The bacterial solution of the new species of Bradyrhizobium SBM1 is obtained by culturing the new species of Bradyrhizobium SBM1 in TY liquid medium; the concentration of the new species of Bradyrhizobium SBM1 in the bacterial solution is 1×10 10 cfu / mL; the trace element mother solution is composed of: H3BO3 2.86g / L, MnSO4 1.81g / L, CuSO4·5H2O 0.80g / L, ZnSO4 0.22g / L, H2MoO4 0.02g / L, and the balance is water; wherein the trace elements function to provide nutrients for plants; the sodium carboxymethyl cellulose solution is selected from an aqueous solution containing sodium carboxymethyl cellulose at a final concentration of 10g / L, i.e., a concentration of 1%.

Images