Golden-tiger-spot kidney cell as well as establishment method and application thereof

Abstract

The invention discloses a golden tiger-spot kidney cell as well as an establishment method and application thereof, and belongs to the technical field of cell culture. The golden tiger spot kidney cell disclosed by the invention is preserved in China General Microbiological Culture Collection Center (CGMCC) on April 3, 2025, and the preservation number is CGMCC No.46341. The golden-tiger-spot kidney cell can be stably proliferated for more than 70 generations, is high in proliferation speed, stable in form and sensitive to iridovirus and common pathogenic bacteria in aquaculture, can be used for establishing an iridovirus or bacterial infection cell model, and provides a foundation for researching iridovirus infection mechanisms and bacterial infection mechanisms. And a foundation is laid for preparing iridovirus vaccines or treatment medicines and bacterial infection treatment medicines.

Description

Technical Field

[0001] The present invention relates to the technical field of cell culture, in particular to golden tiger band kidney cells and an establishment method and application thereof. Background Art

[0002] Fish cell lines provide powerful tools for studying epidemiology, toxicology, pathology, and immunology, as well as for isolating and identifying fish viruses. They also serve as valuable tools for studying gene function in cell-derived tissues. The kidney, a crucial immune organ, is frequently attacked by pathogens, resulting in fish mortality and significant economic losses. Therefore, establishing healthy, sensitive cell lines is crucial for isolating, identifying, and characterizing fish infectious viruses and for studying fish immune mechanisms.

[0003] The Golden Tiger Grouper, a hybrid of the Brown-Dotted Grouper (Epinephelus fuscoguttatus♀) and the Blue-Dotted Grouper (Epinephelus tukula♂), is a new germplasm with excellent traits. The Brown-Dotted Grouper has a high market value and delicious meat, but it grows slowly and has a long feeding cycle. Due to its strong disease resistance, it is often used as the female parent of hybrid groupers. The Blue-Dotted Grouper is distributed in southern Chinese waters, and the primary breeding material is wild-caught. The Golden Tiger Grouper, created by artificially inseminating frozen Blue-Dotted Grouper sperm with Brown-Dotted Grouper eggs, is a new hybrid grouper with excellent traits such as fast growth, tolerance to low temperatures (16-32°C), tolerance to low oxygen levels (0.24 mg / L), and high nutritional value. It is suitable for aquaculture in both northern and southern China, in industrialized, pond, and deep-sea cages. The successful cultivation and widespread application of the Golden Tiger Grouper will significantly promote innovation in marine fishery seed production and the development of the fishery economy. However, in recent years, the emergence of iridovirus has caused serious economic losses to the grouper aquaculture industry.

[0004] The kidney is a primary organ for viral infection in fish, particularly grouper. Renal cells have been established and applied in various fields. For example, Xu Jin et al. established a channel catfish (Lctalurus puncatatus) kidney cell line (CCK) and used it for virus isolation and identification. Zhang Xiaoyu et al. established a Songjiang seabass (Trachidermus fasciatus) kidney cell line and used it in virus and cadmium ion sensitivity testing, finding that Songjiang seabass can serve as a biological indicator for cadmium ion detection. Currently, the establishment of a kidney cell line from golden tiger grouper has not been reported. Therefore, it is necessary to establish a kidney cell line from golden tiger grouper to provide excellent experimental material for studying grouper viral diseases and gene function. Summary of the Invention

[0005] The present invention aims to provide golden tiger banded kidney cells, their establishment method, and their use to address the aforementioned problems of the prior art. The cells can stably proliferate for more than 70 generations, exhibit rapid proliferation rates, and exhibit stable morphology. They are sensitive to iridoviruses and common aquaculture pathogens and can be used to establish cell models infected with iridoviruses or bacteria. This provides a foundation for studying the mechanisms of iridovirus and bacterial infection, as well as for developing vaccines or therapeutics for iridoviruses and bacterial infections.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a golden tiger band kidney cell, which was deposited in the General Microbiology Center of the China Culture Collection Administration on April 3, 2025, with a deposit number of CGMCC No.46341.

[0008] The present invention also provides a method for establishing the golden tiger banded kidney cells, comprising the following steps:

[0009] Kidney tissue of golden tiger grouper is obtained and digested to obtain single cells; the single cells are inoculated into L-15 complete culture medium for primary culture;

[0010] The primary culture is cultured until the cells are confluent, and then inoculated into L-15 complete culture medium for subculture to obtain the golden tiger band kidney cells;

[0011] The L-15 complete culture medium is: L-15 culture medium + 20% fetal bovine serum + 200 IU / ml penicillin + 200 IU / ml streptomycin;

[0012] During the subculture, after the fifth generation, the penicillin concentration in the L-15 complete culture medium is adjusted to 100 IU / ml, the streptomycin concentration is adjusted to 100 IU / ml, and the fetal bovine serum concentration is adjusted to 15%; after the tenth generation, the penicillin concentration in the L-15 complete culture medium is adjusted to 50 IU / ml, the streptomycin concentration is adjusted to 50 IU / ml, and the fetal bovine serum concentration is adjusted to 10-20%.

[0013] Optionally, the temperature of the primary culture is 27°C; the temperature of the subculture is 27-30°C.

[0014] The present invention also provides a proliferation culture medium for the golden tiger band kidney cells, which comprises: L-15 culture medium + 10%-20% fetal bovine serum + 100 IU / ml penicillin + 100 IU / ml streptomycin.

[0015] The present invention also provides the use of the proliferation culture medium in propagating the golden tiger banded kidney cells.

[0016] The present invention also provides the use of the golden tiger grouper kidney cells in constructing a golden tiger grouper iridovirus-infected cell model.

[0017] The present invention also provides the use of the golden tiger band kidney cells in culturing iridescent viruses.

[0018] The present invention also provides the use of the golden tiger grouper kidney cells in preparing golden tiger grouper iridovirus vaccines or screening therapeutic drugs for golden tiger grouper iridovirus.

[0019] The present invention also provides the use of the golden grouper kidney cells in constructing a golden grouper bacterial infection cell model, wherein the bacteria include one or more of Edwardsiella tarda, Vibrio vulnificus, Vibrio harveyi, Vibrio anguillarum and Vibrio alginolyticus.

[0020] The present invention also provides the use of the golden tiger grouper kidney cells in screening drugs for treating bacterial infection in golden tiger grouper.

[0021] The present invention discloses the following technical effects:

[0022] The present invention provides a cell line capable of stable proliferation, derived from golden tiger grouper kidney cells, which are obtained by selecting golden tiger grouper kidney cells with a low degree of differentiation and high mitotic potential, treating them with an enzymatic digestion method, and then culturing them in primary culture. A suitable cell culture medium with comprehensive nutritional components is then developed to allow the cells to grow and proliferate rapidly. The golden tiger grouper kidney cells constructed by the present invention can be continuously passaged for 70 generations or more, have a rapid growth rate, a high passaging frequency, and stable cell morphology, and can provide a large number of golden tiger grouper kidney cells, the main cell type being fibroblast-like cells. Furthermore, the cell line can be used for transfection of exogenous gene plasmids with high transfection efficiency, making it suitable for exogenous gene expression research. The cell line is also sensitive to iridoviruses and common pathogens in aquaculture, and can be used to establish cell models infected with iridoviruses or bacteria, laying the foundation for studying the infection mechanisms of iridoviruses and bacteria, and for preparing iridovirus vaccines or therapeutic drugs, as well as drugs for treating bacterial infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1This is the morphological observation picture of golden grouper kidney cells on the 7th day of primary culture;

[0025] Figure 2 The proliferation of golden tiger band kidney cells in different culture media;

[0026] Figure 3 The proliferation of golden tiger banded kidney cells at different culture temperatures;

[0027] Figure 4 The proliferation of golden tiger banded kidney cells under different serum concentrations;

[0028] Figure 5 This is the metaphase division of chromosomes in golden tiger-banded kidney cells;

[0029] Figure 6 This is the transfection status of pEGFP-N3 plasmid in golden tiger striated kidney cells;

[0030] Figure 7 Results of the iridovirus challenge experiment on golden tiger nephrocytes; A shows the morphology of uninfected golden tiger nephrocytes; B shows the morphology of golden tiger nephrocytes 7 days after RSIV challenge; C shows the morphology of golden tiger nephrocytes 10 days after blind transmission; scale bar = 200 μm;

[0031] Figure 8 The experimental results of golden tiger kidney cells infected with bacteria for 3 hours; A is the cell morphology of the control group; B is the cell morphology after Edwardsiella tarda infection; C is the cell morphology after Vibrio vulnificus infection; D is the cell morphology after Vibrio harveyi infection; E is the cell morphology after Vibrio anguillarum infection; F is the cell morphology after Vibrio alginolyticus infection; scale bar = 200 μm;

[0032] Figure 9 These are the experimental results of golden tiger kidney cells infected with bacteria for 6 hours; among them, A is the cell morphology of the control group; B is the cell morphology after Edwardsiella tarda infection; C is the cell morphology after Vibrio vulnificus infection; D is the cell morphology after Vibrio harveyi infection; E is the cell morphology after Vibrio anguillarum infection; F is the cell morphology after Vibrio alginolyticus infection; scale bar = 200 μm. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Unless otherwise specified, the experimental methods used in the examples of the present invention are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are all reagents and materials available from commercial channels.

[0039] Example 1

[0040] In this example, primary culture and subculture of golden tiger grouper kidney cells were performed to obtain a golden tiger grouper kidney cell line:

[0041] Take the golden tiger grouper, wipe the body surface with 70% alcohol, remove the kidney tissue, and wash it three times with L-15 cell culture medium containing high concentrations of antibiotics (400IU / ml penicillin and 400IU / ml streptomycin). After washing, use scissors to completely chop the tissue sample and transfer it to a 15mL centrifuge tube containing 5ml of 0.25% trypsin solution (Gibco) and place it in a 26°C water bath for 30 minutes. When the tissue suspension becomes turbid, filter it through a 100μm filter to obtain a single cell suspension. Add the filtered cell suspension to L-15 culture medium (hereinafter referred to as L-15 complete culture medium) containing 20% fetal bovine serum (FBS), 200IU / ml penicillin and 200IU / ml streptomycin, and then centrifuge it at 1000×g for 10 minutes. Resuspend the cell pellet in fresh L-15 complete culture medium and inoculate it on a 9.6cm 2 Cells were plated in six-well plates and incubated at 27°C. The culture medium was changed every two days.

[0042] In primary culture, cells adhere well and reach confluence after 7 days of culture at 27°C. Figure 1 ), digested with trypsin, and then passaged in the original well. Cells were passaged by one well to two wells. After 10 passages, cells were passaged by one well to one cell culture flask. After 15 passages, cells were passaged by one flask to two flasks.

[0043] During passaging, cells were trypsinized. Once the cells had rounded, any cells adhering to the bottom of the flask were flushed with 2 mL of complete L-15 medium. The mixed cells were then divided equally between two flasks, and each flask was filled with 4 mL of medium. The culture temperature was 27°C. After the fifth passage, the penicillin-streptomycin concentration in the L-15 complete medium was halved, and the fetal bovine serum concentration was reduced to 5%. After the tenth passage, the penicillin-streptomycin concentration in the L-15 complete medium was further halved, and the fetal bovine serum concentration was reduced to 10%. Morphological observation revealed that the cells were composed of fibroblast-like and epithelial-like cells in early passages. After the tenth passage, the cells became primarily composed of fibroblast-like cells, which proliferated stably in subsequent passages. To date, the golden tiger grouper kidney cells have been passaged over 70 times, establishing a golden tiger grouper kidney cell line. The cell line has been deposited in the General Microbiology Center of China Culture Collection Administration, named Golden Tiger Kidney Cell, with the deposit number CGMCC No.46341 and the deposit date of April 3, 2025.

[0044] Example 2

[0045] This example studies the effects of different culture media on cell growth:

[0046] The cell culture plate used in the experiment was a 12-well plate. The 20th generation golden tiger band kidney cells in Example 1 were cultured at 1.5×10 5 The cells were seeded at an initial density of 100 μg / well in each well of the culture plate. After the cells were stably attached to the wall, the original culture medium was aspirated, the cells were rinsed with PBS, and then cultured in L-15, MEM, and M199 culture medium respectively. 10% FBS, 100 IU / ml penicillin, and 100 IU / ml streptomycin were added to each culture medium. The culture temperature was 27°C. During the culture process, cells from different culture mediums on days 1, 3, 5, and 7 were taken and counted using a hemocytometer, and fresh culture medium was replaced every two days. The counting method was as follows: the culture medium was aspirated, the cells were washed with PBS, 1 mL of trypsin-EDTA digestion solution was added to each well for complete digestion, 20 μL of liquid was pipetted evenly, and dropped onto a hemocytometer, and counted under a microscope according to the counting plate instructions. The experiment was performed in triplicate.

[0047] The results are as follows Figure 2 As shown, the proliferation of golden tiger band kidney cells in L-15 culture medium was significantly higher than that in MEM and M199 culture medium, especially after 5 days of culture, the cell number in L-15 culture medium continued to increase, while the cell number in MEM and M199 culture medium showed a downward trend.

[0048] Example 3

[0049] This example studies the effects of different temperatures on cell growth:

[0050] The cell culture plate used in the experiment was a 12-well plate. The 20th generation golden tiger band kidney cells in Example 1 were cultured at 1.5×10 5 The cells were seeded at an initial density of 1 / well in each well of the culture plate. A total of three 12-well cell culture plates were cultured at 24°C, 27°C, and 30°C, respectively. The culture medium used was L-15 culture medium supplemented with 10% FBS, 100 IU / ml penicillin, and 100 IU / ml streptomycin. During the culture process, cells were taken at different temperatures on days 1, 3, 5, and 7, and counted using a hemocytometer. Fresh culture medium was replaced every two days. The counting method was the same as in Example 2. The experiment was performed in triplicate.

[0051] The results are as follows Figure 3 As shown, it can be seen that the cells grow faster at 27°C and 30°C, indicating that the cell line can proliferate faster at 27-30°C.

[0052] Example 4

[0053] This example studies the effects of different serum concentrations on cell growth:

[0054] The cell culture plate used in the experiment was a 12-well plate. The 20th generation golden tiger band kidney cells in Example 1 were cultured at 1.5×105 Cells were seeded at an initial density of 100 μl / well in a culture plate. After stable cell attachment, the original culture medium was aspirated, rinsed with PBS, and replaced with culture medium containing varying concentrations of FBS. The culture medium used was L-15 culture medium supplemented with 100 IU / ml penicillin and 100 IU / ml streptomycin, with FBS concentrations set at 0%, 5%, 10%, and 20%, respectively. During the culture process, cells were collected from different culture mediums on days 1, 3, 5, and 7 and counted using a hemocytometer. The counting method was the same as in Example 2. The experiment was performed in triplicate.

[0055] The results are as follows Figure 4 As shown in the figure, golden tiger band kidney cells grew faster and at similar rates in serum concentrations of 10% and 20%, but grew more slowly below 10%, and showed no significant cell proliferation in serum concentrations of 0% to 5%. Therefore, for golden tiger band kidney cell proliferation culture, a serum concentration range of 10-20% can be selected based on the actual culture environment and research costs.

[0056] Example 5

[0057] Proper freezing and preservation of cells during cell culture passage can facilitate subsequent experimental use. Timely cell freezing can also avoid the loss of previous work caused by bacterial contamination. When cells reach the fifth passage, the number of cells is generally large and can be preserved. This example provides a method for freezing and thawing golden tiger banded kidney cells:

[0058] Take cells of each generation for freezing. Similar to the digestion method for cell passage, first digest the cells and suspend them by blowing, then add the cells to a 15mL centrifuge tube, centrifuge and collect the cells. Suspend the cells with cell freezing solution (DMSO) to make the frozen cell density reach 3.0×10 6 Add the cells to the cryopreservation tube and place it in a freezing box. Freeze overnight in a -80°C ultra-low temperature freezer. Then, store the cryopreservation tube in liquid nitrogen and keep relevant records.

[0059] Remove the frozen cells from the liquid nitrogen tank and quickly thaw them in a constant-temperature water bath at 37°C. The water in the water bath should be replaced regularly and kept clean. During thawing, be careful not to immerse the ends of the cryovials in water. Seal the ends with parafilm to prevent contamination. After the ice in the cryovials has melted, add the cryopreservation solution to a centrifuge tube and centrifuge at 1200 rpm for 5 minutes to collect the cells. Resuspend the cells at the bottom of the tube with L-15 complete culture medium and inoculate them into new cell culture flasks. Place the flasks in a 27°C cell culture incubator for incubation.

[0060] Example 6

[0061] This example performed chromosome analysis on golden tiger-banded kidney cells:

[0062] The 30th generation golden tiger banded kidney cells in Example 1 were used for chromosome karyotype analysis. The cells were cultured to a confluence of 25 μm. 2 Add colchicine to the culture medium in the flask. After 4-6 hours of incubation, aspirate the original culture medium and add 2 mL of trypsin-EDTA digestion solution. After centrifugation, collect the cells and aspirate the supernatant. Add KCl solution dropwise to mix thoroughly, then add 5-10 mL to the volume. Incubate at 37°C for 20-30 minutes. Prepare fresh Carnoy's fixative (methanol:glacial acetic acid = 3:1) and pre-chill at -20°C. Pre-chill the slides in -80°C alcohol. After hypotonicity is complete, add 1 mL of Carnoy's fixative and pre-fix for 2 minutes. After centrifugation, discard the supernatant and slowly add 8-10 mL of fresh Carnoy's fixative along the tube wall for 15-20 minutes. Repeat this fixation twice. Resuspend the cells by air-drying and slide them using the cold drop method. Air-dry the slides in a well-ventilated area. Stain with 10% Giemsa stain for 10-20 minutes, rinse, and dry in a well-ventilated area. Observe the chromosomes under a microscope, and photograph them. Count the chromosome number of the cells.

[0063] The results are as follows Figure 5 As shown, chromosome karyotype analysis of golden tiger grouper kidney cells was performed. Observation of the metaphase of kidney cells showed that most cells had a normal diploid chromosome number [2N=48], which is consistent with the chromosome number characteristics of golden tiger grouper.

[0064] Example 7

[0065] This example analyzes the transfection of exogenous genes into golden tiger-banded kidney cells:

[0066] The 30th generation golden tiger band kidney cells in Example 1 were taken at 1.5×10 5 The cells were seeded into six-well plates at an initial density of 1:1 / well. The pEGFP-N3 plasmid was transfected into the cells using the Seven HighTransTM DNA non-liposomal transfection method. Gene expression was detected after culturing at 27°C for 48 hours without changing the culture medium.

[0067] The results are as follows Figure 6 As shown, gene expression was observed within 48 hours after transformation, and green fluorescence of EGFP-positive cells was visible under an inverted fluorescence microscope, indicating that the golden tiger band kidney cells of the present invention can be directly used in the study of exogenous gene functions.

[0068] Example 8

[0069] In this example, an iridovirus (RSIV) infection experiment was performed on golden tabby kidney cells to verify the sensitivity of golden tabby kidney cells to the virus:

[0070] Spleen tissue from iridovirus-infected grouper sea bream (preserved at the laboratory of the College of Marine Science and Engineering, Qingdao Agricultural University) stored at -80°C was added to L-15 culture medium containing a 5% penicillin-streptomycin mixture and thoroughly homogenized at low temperature. The homogenate was frozen and thawed three times at -80°C and 25°C, centrifuged at 8000 rpm for 15 minutes at 4°C, and the supernatant was collected and diluted 10-fold with L-15 culture medium containing a 5% penicillin-streptomycin mixture. The supernatant was then filtered through a 0.22 μm cell strainer to obtain the viral suspension. The viral suspension was inoculated into a culture flask containing 30-passage golden tiger banded kidney cells, ensuring a concentration of 0.2 g of viral tissue per flask. The inoculated cells were cultured at 27°C for 1 hour, after which the original culture medium was aspirated. Cells were then cultured in L-15 culture medium containing a 1% FBS and 1% penicillin-streptomycin mixture to maintain cell viability and control cell growth, preventing excessive proliferation and cell death. Cytopathological changes were observed daily. The cells showed CPE on the 7th day after infection ( Figure 7 B). and healthy golden tiger kidney cells ( Figure 7 Compared with A), CPE is characterized by local cell death and detachment, and the attached cells shrink and show irregular distribution of filamentous morphology. CPE appears on the 10th day after blind culture ( Figure 7 The CPE that appeared after blind transmission was identical to that after challenge, indicating that the CPE in the challenge experiment was caused by the presence of RSIV. The virus suspension was collected from the diseased cells and diluted 10-fold in a gradient and inoculated into 30-passage golden tiger kidney cells to determine the virus infectivity. 5 TCID 50 / mL.

[0071] Golden tiger banded kidney cells of passage 50 were cultured at 1.5×10 5 / well were inoculated into six-well plates at an initial density of 1:1. The experiment was divided into a control group (virus suspension treated at 100°C) and an experimental group (virus suspension). Three replicate wells were set up in each group. After 7 days of culture, nucleic acid was extracted and competitive quantitative PCR technology was used to perform real-time fluorescence quantitative PCR to detect viral proliferation. Using the SteadyPure Viral DNA / RNA Extraction Kit (Aikerui Bio), viral DNA was extracted from lesioned golden tiger-spotted kidney cells with reference to the kit instructions. The specific primers used to amplify the major capsid protein (MCP) gene of RSIV are shown in Table 1. The qPCR reaction system and amplification conditions are shown in Tables 2 and 3.

[0072] Table 1 Primers for Real-time PCR detection

[0073] Primers Sequence (5'-3') MCP-152F GGGTGGCGACTACCTCATTA(SEQ ID NO.1) MCP-152R TCTGTGCCACCAGGTCGTTA(SEQ ID NO.2)

[0074] Table 2 qPCR reaction system

[0075] Reagents Dosage 2×SYBR Green Premix 12.5 MCP-152F 1 μL MCP-152R 1 μL <![CDATA[ddH2O]]> 9.5 μL DNA 1 μL Total 25 μL

[0076] Table 3 qPCR amplification conditions

[0077] temperature Reaction time 95℃ 10s 95℃ 8s(40cycles) 60℃ 5s(40 cycles) 72℃ 10(40cycles)

[0078] The results showed that the CT value of the control group was 30, and the CT value of the experimental group was 16, indicating obvious viral proliferation.

[0079] The results show that the golden grouper kidney cells constructed by the present invention are sensitive to iridovirus and have a fast virus proliferation rate. They can be used to establish a golden grouper iridovirus cell model, to isolate and culture iridovirus, and to study iridovirus-related vaccines or therapeutic drugs.

[0080] Example 9

[0081] In this example, a bacterial infection experiment was conducted on golden tiger banded kidney cells to verify the sensitivity of golden tiger banded kidney cells to bacteria:

[0082] Edwardsiella tarda, Vibrio vulnificus, Vibrio harveyi, Vibrio anguillarum, and Vibrio alginolyticus were isolated from infected rockfish (Sphygmomania spp.) and maintained in the laboratory of the College of Marine Science and Engineering, Qingdao Agricultural University. The infected rockfish were obtained from Mingbo Aquatic Products Co., Ltd., Laizhou City, Shandong Province. The infected fish exhibited the following symptoms: a blackish coloration, abnormal swimming movements, and lethargy. External examination revealed no obvious external injuries; however, in severe cases, exophthalmos, gill filament congestion, or hemorrhage may be observed. Severe anemia was present, manifested by a pale liver and enlarged spleen and kidneys with hemorrhages.

[0083] 30-passage golden tiger-striped kidney cells were cultured at 1 × 10 5 / well were inoculated into six-well cell culture plates and cultured in a cell culture incubator at 27°C. When the cell coverage reached 80% to 90%, subsequent experimental operations were carried out. Vibrio harveyi, Edwardsiella tarda, Vibrio alginolyticus, Vibrio vulnificus and Vibrio anguillarum were inoculated into 5mL LB liquid culture medium respectively and cultured on a shaker at 27°C until all bacteria entered the logarithmic growth phase. The bacterial solution was transferred to a 1.5mL centrifuge tube, the supernatant was discarded after centrifugation, and the bacterial pellet was resuspended in a culture medium without antibiotics. The absorbance value (OD 600 ), and then the bacterial concentration was adjusted to 1×105 CFU / mL. The bacterial solution was inoculated into the corresponding cell culture wells at a concentration of 1×10 5 CFU / well. The experimental setup included a control group (uninfected with bacteria) and experimental groups (inoculated with each of the five bacterial strains). An inverted microscope was used to observe the morphological changes of P. leucopus cells infected with different bacteria. The observations were photographed for subsequent analysis and comparison.

[0084] Cell morphology changes 3 hours after bacterial infection Figure 8 As shown, the cell morphology changes at 6 h after bacterial infection are as follows Figure 9 As shown. It can be seen that the control group did not show significant pathological changes during the experiment. The five different bacteria had different degrees of influence on the morphology, distribution and aggregation of cells after infection. The cells showed high sensitivity to Vibrio vulnificus and Vibrio harveyi, with obvious cell atrophy and massive apoptosis 3 hours after infection; 6 hours after infection, cells infected with Vibrio vulnificus and Vibrio harveyi were almost completely apoptotic. In contrast, the degree of apoptosis caused by Edwardsiella tarda and Vibrio anguillarum was slightly lower than that of Vibrio anguillarum and Vibrio vulnificus, but they still had strong pathogenicity. Vibrio alginolyticus had relatively little effect on golden tiger band kidney cells, and its pathogenicity was significantly lower than that of other bacteria.

[0085] The above results demonstrate that the golden tiger grouper kidney cells developed in this invention exhibit sensitivity to five common pathogens. Specifically, the cells exhibited higher sensitivity to Vibrio vulnificus and Vibrio harveyi. This suggests that the golden tiger grouper kidney cells of this invention have significant potential in bacteriological research, particularly in antimicrobial drug screening and the analysis of bacterial pathogenic mechanisms. The golden tiger grouper kidney cells of this invention can be used to establish a bacterial infection cell model for golden tiger grouper, and to isolate and culture common pathogenic bacteria in aquaculture, providing theoretical support and practical guidance for aquaculture disease prevention and control.

[0086] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A golden tiger banded kidney cell, characterized in that It was deposited in the General Microbiology Center of China Culture Collection Administration on April 3, 2025, with the deposit number CGMCC No.46341.

2. The method for establishing golden tiger banded kidney cells according to claim 1, characterized in that: The steps include: Kidney tissue of golden tiger grouper is obtained and digested to obtain single cells; the single cells are inoculated into L-15 complete culture medium for primary culture; The primary culture is cultured until the cells are confluent, and then inoculated into L-15 complete culture medium for subculture to obtain the golden tiger band kidney cells; The L-15 complete culture medium is: L-15 culture medium + 20% fetal bovine serum + 200 IU / ml penicillin + 200 IU / ml streptomycin; During the subculture, after the fifth generation, the penicillin concentration in the L-15 complete culture medium is adjusted to 100 IU / ml, the streptomycin concentration is adjusted to 100 IU / ml, and the fetal bovine serum concentration is adjusted to 15%; after the tenth generation, the penicillin concentration in the L-15 complete culture medium is adjusted to 50 IU / ml, the streptomycin concentration is adjusted to 50 IU / ml, and the fetal bovine serum concentration is adjusted to 10-20%.

3. The establishment method according to claim 2, characterized in that: The temperature of the primary culture is 27°C; the temperature of the subculture is 27-30°C.

4. A proliferation culture medium for golden tiger banded kidney cells according to claim 1, characterized in that: The proliferation culture medium is: L-15 culture medium + 10%-20% fetal bovine serum + 100 IU / ml penicillin + 100 IU / ml streptomycin.

5. Use of the proliferation culture medium according to claim 4 in propagating the golden tiger banded kidney cells according to claim 1.

6. Use of the golden tiger grouper kidney cells according to claim 1 in constructing a golden tiger grouper iridovirus-infected cell model.

7. Use of the golden tiger band kidney cells according to claim 1 in culturing iridescent viruses.

8. Use of the golden tiger grouper kidney cells according to claim 1 in preparing golden tiger grouper iridovirus vaccines or screening for therapeutic drugs against golden tiger grouper iridovirus.

9. Use of the golden tiger grouper kidney cells according to claim 1 in constructing a golden tiger grouper bacterial infection cell model, characterized in that: The bacteria include one or more of Edwardsiella tarda, Vibrio vulnificus, Vibrio harveyi, Vibrio anguillarum and Vibrio alginolyticus.

10. Use of the golden grouper kidney cells according to claim 1 in screening drugs for treating bacterial infection in golden grouper.

Images