Hybridoma cell strain secreting anti-FAdV-4 Hexon protein monoclonal antibody, monoclonal antibody and application of monoclonal antibody

By preparing hybridoma cell line 6F11 and identifying the FAdV-4 Hexon protein 161TSTSKDT167 antigen epitope, especially the key amino acids of S162 and D166, the cross-reaction problem of monoclonal antibodies in the prior art is solved, and the specific recognition and accurate diagnosis of FAdV-4 is achieved, supporting epidemiological investigations and pathogenic studies.

CN120442555APending Publication Date: 2025-08-08YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510590568.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

In the prior art, it is difficult to prepare monoclonal antibodies that can specifically recognize highly pathogenic and non-pathogenic FAdV-4 Hexon proteins, and cross-react with other serotype avian adenoviruses, resulting in inaccuracies of diagnostic and detection methods.

Method used

By screening and preparing hybridoma cell line 6F11, the specific monoclonal antibody 6F11 was secreted to identify the 161TSTSKDT167 antigen epitope of the FAdV-4 Hexon protein, especially the key amino acids S162 and D166, to avoid cross-reacting with other serotype avian adenoviruses.

Benefits of technology

It realizes specific identification of FAdV-4, provides efficient diagnostic tools, can distinguish between highly pathogenic and non-pathogenic FAdV-4, supports epidemiological investigations and pathogenic research, and improves the accuracy of detection and wide application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442555A_ABST
    Figure CN120442555A_ABST
Patent Text Reader

Abstract

The invention discloses a hybridoma cell strain capable of secreting anti-FAdV-4Hexon protein, a monoclonal antibody and application of the hybridoma cell strain. The preservation number of the cell strain 6F11 is CGMCC NO.45830, and the cell strain 6F11 secretes the monoclonal antibody 6F11 which can be specifically combined with an antigen of the FAdV-4Hexon protein and does not have antigen-antibody reaction with other serotype FAdV-4Hexon protein. Through identification, the heavy chain subtype of the monoclonal antibody 6F11 is IgG1, the amino acid sequence of the antigen epitope identified by the monoclonal antibody 6F11 is 161TSTSKDT167, S162 and D166 are key amino acids identified by the monoclonal antibody 6F11, and the monoclonal antibody 6F11 can be used as a diagnostic reagent for distinguishing FAdV-4 and FAdV of other serotypes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to a hybridoma cell line secreting an anti-FAdV-4 Hexon protein monoclonal antibody, the monoclonal antibody and applications thereof. Background Art

[0002] Avian adenovirus (FAdV) belongs to the genus Avianadenovirus in the family Adenoviridae. Based on restriction enzyme digestion patterns and serum cross-neutralization tests, FAdV is currently classified into five species (FAdV-A, B, C, D, and E) and 12 serotypes (FAdV-1-7, 8a, 8b, 9-11). Furthermore, FAdV-4 is divided into highly pathogenic FAdV-4 and non-pathogenic FAdV-4 based on pathogenicity. In recent years, hepatitis-pericardial effusion syndrome (HHS) has been reported in chickens due to infection with highly pathogenic serotype 4 FAdV (FAdV-4), resulting in mortality rates as high as 80%, causing significant economic losses to the poultry industry. The FAdV-4 genome is approximately 45 kb in size and encodes three major surface structural proteins: hexon, penton, and fiber. Hexon protein is the main component protein of the adenovirus capsid, accounting for approximately 60% of the protein mass of the virus particle. In addition, hexon protein has important genus, species, and serotype-specific antigenic epitopes and is closely related to viral pathogenicity. Therefore, it is very necessary to prepare specific monoclonal antibodies against the FAdV-4 hexon protein and develop effective, reliable, and accurate detection methods for FAdV-4 diagnosis and control. However, the hexon protein is highly conserved among FAdVs, with the amino acid homology between FAdV-4 and FAdV-10 hexon reaching 97%, which has hindered the research on FAdV-4 hexon protein-specific monoclonal antibodies.

[0003] In the prior art, the applicant previously disclosed a monoclonal antibody 2C5 that only recognizes the highly pathogenic FAdV-4 Hexon protein and its hybridoma cell line. Although the monoclonal antibody 2C5 can accurately recognize the highly pathogenic FAdV-4, it cannot recognize the non-pathogenic FAdV-4. Summary of the Invention

[0004] Purpose of the invention: To address the deficiencies in the prior art, the present invention provides a hybridoma cell line and monoclonal antibody secreting an anti-FAdV-4 Hexon protein. The monoclonal antibody 6F11 prepared by the present invention has good specificity and reactivity, can specifically recognize FAdV-4, and has no cross-reaction with other serotypes of FAdV. It can be used in the laboratory and clinical detection of serotype 4 avian adenovirus, thereby solving the problem that the prior art cannot effectively recognize all FAdV-4 Hexon proteins.

[0005] The present invention also provides the antigenic epitope and key amino acids recognized by the monoclonal antibody.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention discloses a hybridoma cell line 6F11 that secretes anti-FAdV-4 Hexon protein monoclonal antibodies. The hybridoma cell line has a deposit number of CGMCC NO.45830, a deposit date of March 21, 2024, and is classified as mouse hybridoma cell. It is deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC), address: Beijing, China.

[0007] The anti-FAdV-4 Hexon protein monoclonal antibody 6F11 of the present invention is characterized in that it is secreted by the hybridoma cell line 6F11.

[0008] The monoclonal antibody 6F11 specifically binds to all FAdV-4 Hexon protein antigens, but does not react with other serotype FAdV Hexon proteins.

[0009] Wherein, the heavy chain subtype of the monoclonal antibody 6F11 is IgG1.

[0010] Furthermore, the present invention also provides a method for preparing the monoclonal antibody 6F11, which utilizes the hybridoma cell line to secrete and produce the anti-FAdV-4 monoclonal antibody 6F11.

[0011] Furthermore, the hybridoma cell line is used to secrete and proliferate in the peritoneal cavity of mice, and the ascites is separated and purified to produce the anti-FAdV-4 monoclonal antibody 6F11.

[0012] The antigenic epitope recognized by the monoclonal antibody 6F11 of the present invention is located at amino acids 161-167 of the FAdV-4 Hexon protein of the highly pathogenic serotype 4 fowl adenovirus SD2015 strain, and the amino acid sequence of the antigenic epitope is TSTSKDT.

[0013] The key amino acid sites of the antigenic epitope recognized by the monoclonal antibody 6F11 of the present invention are amino acids S162 and D166 at positions 162 and 166 of the FAdV-4 Hexon protein.

[0014] Among them, the amino acids S162 and D166 at positions 162 and 166 of the FAdV-4 Hexon protein are characteristic amino acids of serotype 4 avian adenovirus.

[0015] The invention relates to the use of the monoclonal antibody 6F11 in the preparation of a product for detecting and identifying serotype 4 avian adenovirus.

[0016] Furthermore, the monoclonal antibody 6F11 is prepared to detect and identify serotype 4 highly pathogenic strains and serotype 4 non-pathogenic strains. Representative strains of serotype 4 highly pathogenic strains are SD2015, AHFY15, JH13, JSCZ15, etc., and representative strains of serotype 4 non-pathogenic strains are ON1, B1-7, etc.

[0017] The kit for detecting and identifying highly pathogenic serotype 4 avian adenovirus of the present invention comprises the monoclonal antibody 6F11 and auxiliary materials constituting the kit.

[0018] The present invention screened a monoclonal antibody hybridoma cell line that can secrete the Hexon protein against FAdV-4, named as hybridoma cell line 6F11. At the same time, a monoclonal antibody 6F11 against the Hexon protein of avian adenovirus type 4 (FAdV-4) was provided. Characteristic detection found that the secreted monoclonal antibody 6F11 only reacts with the FAdV-4 strain, and does not react with other serotypes of avian adenovirus. Epitope identification further found that the epitope recognized by monoclonal antibody 6F11 is located at 161TSTSKDT167, and it was found that the 162nd and 166th amino acids S162 and D166 in the Hexon protein are the key amino acids recognized by monoclonal antibody 6F11. The development of the monoclonal antibody 6F11 that only reacts with FAdV-4 of the present invention provides molecular targets and biological materials for establishing differential diagnosis technology for FAdV-4 and conducting research on the molecular epidemiology and pathogenic mechanism of FAdV-4.

[0019] The present invention prepares monoclonal antibodies that can specifically recognize all FAdV-4 Hexon proteins, including highly pathogenic FAdV-4 and non-pathogenic FAdV-4, but do not recognize other serotypes of FAdV, including FAdV-10. The precise epitope of the Hexon protein targeted and the key amino acids for recognition are clarified, thus filling the gap of monoclonal antibody 2C5 that cannot recognize non-pathogenic FAdV-4. In subsequent epidemiological surveys, monoclonal antibodies 6F11 and 2C5 can not only identify FAdV-4, but also further classify FAdV-4 as highly pathogenic or non-pathogenic, laying the foundation for subsequent in-depth research on the function of Hexon proteins, pathogenicity research, and the establishment of detection and diagnostic methods.

[0020] The present invention predicts the dominant epitopes of the FAdV-4 Hexon protein and compares them with the protein sequence to screen out the FAdV-4 Hexon-type specific dominant protein epitopes. By prokaryotically expressing the Hexon truncated protein containing the Hexon protein-type specific dominant protein epitopes, a strain that can specifically recognize FAdV-4 (including highly pathogenic FAdV-4 and non-pathogenic FAdV-4) and does not cross-react with other serotypes of FAdV, including FAdV-10, is successfully prepared through monoclonal antibody technologies such as mouse immunization and cell fusion. This can lay the foundation for subsequent in-depth research on the function of the Hexon protein, virus typing, pathogenicity research, and the establishment of detection and diagnosis methods.

[0021] Due to the high conservation of Hexon proteins among FAdVs, the amino acid homology between FAdV-4 and FAdV-10 Hexon is as high as 97%. Therefore, among the published Hexon monoclonal antibodies, most are FAdV broad-spectrum monoclonal antibodies and FAdV-4 / 10-specific monoclonal antibodies, making it difficult to distinguish between FAdV-4 and FAdV-10. There are no reports of type-specific monoclonal antibodies targeting only the FAdV-4 Hexon protein. The applicant previously disclosed a monoclonal antibody 2C5 that only recognizes the highly pathogenic FAdV-4 Hexon protein and its hybridoma cell line. Although monoclonal antibody 2C5 can accurately recognize highly pathogenic FAdV-4, it cannot recognize non-pathogenic FAdV-4. Therefore, the present invention prepared monoclonal antibodies that can specifically recognize all FAdV-4 Hexon proteins, including highly pathogenic FAdV-4 and non-pathogenic FAdV-4, but not recognize other serotypes of FAdV, including FAdV-10, and clarified the precise epitope of the Hexon protein and the key amino acids recognized by it, making up for the shortcoming of monoclonal antibody 2C5 that cannot recognize non-pathogenic FAdV-4. In subsequent epidemiological surveys, relying on monoclonal antibodies 6F11 and 2C5, not only FAdV-4 can be identified, but also FAdV-4 can be further classified as highly pathogenic or non-pathogenic, which can lay the foundation for subsequent in-depth research on the function of Hexon protein, pathogenicity research, and the establishment of detection and diagnostic methods.

[0022] The present invention discloses a hybridoma cell line, monoclonal antibody, and applications thereof that secrete anti-FAdV-4 Hexon protein. The cell line 6F11, deposited with CGMCC No. 45830, secretes monoclonal antibody 6F11 that specifically binds to the FAdV-4 Hexon protein antigen but does not react with FAdV Hexon proteins of other serotypes. The heavy chain subtype of monoclonal antibody 6F11 was identified as IgG1, and the amino acid sequence of the antigenic epitope it recognizes is 161TSTSKDT167, with S162 and D166 being the key amino acids for its recognition. The antibody can be used as a diagnostic reagent to distinguish FAdV-4 from other serotypes of FAdV-4.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0024] 1) The monoclonal antibody of the present invention is produced by a single cell line, the deposit number of which is CGMCC NO.45830. The antibody has characteristics such as high specificity and homogeneity. The monoclonal antibody has high purity, strong specificity, and a continuous and unlimited supply. It has broader research application value and commercial use value in immunoassays.

[0025] 2) The monoclonal antibody of the present invention has strong reactivity and good reactivity with the Hexon protein of FAdV-4 in IFA, Western blot and ELISA, and can be used for the detection of FAdV-4.

[0026] 3) The monoclonal antibody 6F11 prepared in the present invention is specific for FAdV-4 and can specifically recognize FAdV-4 without cross-reactivity with other FAdV serotypes. It can be used as a diagnostic reagent to distinguish FAdV-4 from other FAdV serotypes.

[0027] 4) The monoclonal antibody of this invention recognizes the epitope of Hexon protein 161TSTSKDT167, with FAdV-4 Hexon S162 and D166 as key amino acids. Further three-dimensional structural prediction revealed that the epitope and key amino acids recognized by monoclonal antibody 6F11 protrude from the tower region of the Hexon protein trimer, demonstrating enhanced antibody accessibility. These findings provide valuable new tools for further investigation of the biological functions and pathogenic mechanisms of Hexon proteins.

[0028] In summary, the present invention not only provides specific monoclonal antibodies for establishing a FAdV-4 detection method, but also provides molecular targets and biological materials for conducting research on the molecular epidemiology and pathogenic mechanism of the prevalent FAdV-4. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Figures verifying the expression of Hexon truncated proteins. A, B: SDS-PAGE and Western blot analysis of Hexon truncated protein expression and purification. Lane M: Protein marker; Lane 1: Lysis precipitate from pET-28a empty vector bacteria; Lane 2: Lysis precipitate from recombinant bacteria; Lane 3: Protein purified from inclusion bodies.

[0030] Figure 2 Western blot reactivity of monoclonal antibody 6F11 with avian adenovirus.

[0031] Figure 3 The IFA reactivity of mAb 6F11 with avian adenovirus.

[0032] Figure 4 Figure 3 shows the localization of the amino terminus of the Hexon antigen epitope recognized by 6F11. A and C are flowcharts of the two rounds of localization of the amino terminus of the antigen epitope; B is the Western blot result of the first round of preliminary localization; and D is the Western blot result of the precise localization of the epitope.

[0033] Figure 5 Figure 3 is a conservation analysis of the epitope recognized by monoclonal antibody 6F11. A is the amino acid sequence alignment of the epitope region of Hexon protein of FAdVs of different serotypes; B is the IFA reactivity of monoclonal antibody 6F11 with Hexon mutant proteins.

[0034] Figure 6 Figure 3 is the spatial localization analysis of the epitope on the Hexon protein, where A is the position of the epitope recognized by mAb 6F11 on the Hexon monomer; B is the space-filling diagram of the trimeric Hexon crystal structure, yellow: epitope sequence recognized by mAb 6F11; red: key antigenic site recognized by mAb 6F11. DETAILED DESCRIPTION

[0035] The present invention will be further described below with reference to the accompanying drawings and examples.

[0036] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0037] Highly pathogenic FAdV-4 strains, FAdV-11(380), SD2015(HP-FAdV-4), FAdV-8a(JSSQ15), and FAdV-8b were provided by Yangzhou University. Literature: Outbreaks of serotype 4fowl adenovirus with novel genotype, China. Literature source: Emerging Microbes and Infections (2016) 5, e50; doi: 10.1038 / emi.2016.50; published online 25 May 2016.

[0038] Monoclonal antibody 3G8 was provided by Yangzhou University. Liu, JY, N. Mei, YL Wang, XJ Shi, and H. J. Chen. 2021. Identification of a novel immunological epitope on Hexon of fowl adenovirus serotype 4. Amb Express 11:153.

[0039] Monoclonal antibody subclass identification kit, Beijing Biolong Biotechnology Co., Ltd., catalog number: KLB4015524.

[0040] Mouse myeloma cells (SP2 / 0), chicken hepatoma cells (LMH), FAdV-1 ( VR-432 TM ),FAdV-4B1-7(non-pathogenic FAdV-4,LP-FAdV-4)( VR-829 TM ),FAdV-6( VR-831 TM ),FAdV-7( VR-832 TM ),FAdV-9( VR-833 TM )andFAdV-10C2B( VR-834 TM ) was purchased from the American Type Culture Collection (ATCC);

[0041] Preparation of LMH cells infected with the SD2015 strain: LMH cells were plated into 96-well plates. After approximately 9 days of growth, when the cell colony density reached approximately 60% to 80% of the well bottom area, FAdV4 (SD2015) was used to infect LMH cells at an MOI of 0.01. Cytopathic effects were observed daily. When the cytopathic effect reached approximately 70%, cells were fixed with pre-cooled acetone-ethanol (3:2 acetone:anhydrous ethanol) at room temperature for 5-10 minutes. The fixative was discarded, and the plates were washed once with PBS. The plates were then placed in a fume hood for 3 hours to completely evaporate any residual acetone-ethanol.

[0042] Example 1

[0043] Preparation of hybridoma cell lines and identification of monoclonal antibodies

[0044] 1. Prediction of dominant antigenic epitopes of avian adenovirus serotype 4 Hexon protein and preparation of immunogens

[0045] Based on the full amino acid sequence of the Hexon protein of the highly pathogenic FAdV-4 strain SD2015 (SEQ ID NO.1), the applicant's preliminary analysis obtained a 104-291 amino acid fragment of the Hexon protein where the FAdV-4 type-specific dominant antigenic epitope is located (Hexon truncated protein, SEQ ID NO.2). Using the PCR primers with pET28a(+)15bp as shown in Table 1 and the FAdV4 strain SD2015 genome as a template, the hexon (309-873bp) PCR product (SEQ ID NO.3) was cloned and obtained. After gel purification, it was ligated to pET28a(+) under the action of the homologous recombinase. After sequencing verification, the successfully recombined recombinant plasmid pET28a(+)-FAdV-Hexon (104-291aa) expression vector was transformed into Escherichia coli BL21(DE3) for expression. The His-tagged Hexon recombinant protein (His-Ht) was purified by inclusion body purification, and its purification effect was verified by SDS-PAGE, and its expression was verified by Western blot. Figure 1 As shown in Figures 1A and 1B, a specific band of the His-Ht recombinant protein with a molecular weight of approximately 30 kDa was observed in the DE3 lysate containing pET28a-Hexon104-291aa and the purified His-Ht protein, but not in the DE3 lysate containing the pET-28a vector. The efficient expression and purification of the His-Ht protein in E. coli provided an immunogen for the generation of monoclonal antibodies against the FAdV-4 Hexon.

[0046] Table 1 PCR primers used to construct immunogens

[0047]

[0048] 2. Preparation of monoclonal antibodies

[0049] Purified recombinant Hexon truncated protein expressed in prokaryotic cells was mixed with equal amounts of Freund's adjuvant to form an emulsified mixture. 50 μg of recombinant Hexon protein was injected subcutaneously into 5-week-old female BALB / c mice at multiple sites. Booster immunizations were performed 21 and 35 days after immunization using recombinant Hexon protein emulsified in incomplete Freund's adjuvant. Blood was collected 49 days after the initial immunization to measure antibody titers. BALB / c mice with the highest antibody titers were selected and given a pulse immunization with 50 μg of recombinant Hexon protein intraperitoneally 3 days prior to cell fusion.

[0050] Aseptically remove the spleen from the immunized mouse and place it in a sterile container. Grind the spleen with an instrument to prepare a splenocyte suspension. The splenocytes were then fused with SP2 / 0 myeloma cells at a ratio of 5:1 using a PEG fusion agent. The cells were resuspended in HAT medium, aliquoted into 96-well cell culture plates, and cultured in a 37°C, 5% CO2 cell culture incubator. The cell culture supernatant was collected 12 days after fusion for later use. During this time, LMH cells were plated into 96-well plates. Approximately 9 days after growth, when the cell colony density reached approximately 60%–80% of the well bottom area, the LMH cells were infected with FAdV4 (SD2015) and monitored daily for cytopathic effects. When the cytopathic effect reached approximately 70%, the cells were fixed with pre-cooled acetone-ethanol (3:2 acetone-ethanol) at room temperature for 5–10 minutes. The fixative was discarded, the plates were washed once with PBS, and the plates were then ventilated in a fume hood for 3 hours. After the residual acetone and ethanol in the cell plate evaporated, the hybridoma supernatant was added to the cell plate as the primary antibody at 50 μl / well. The cell plate was then incubated in a 37°C water bath for 45 minutes. The primary antibody was discarded and the plate was washed three times with PBS. FITC-labeled goat anti-mouse immunoglobulin was diluted 1:150 and added to the cell plate (protected from light) at 50 μl / well. The cell plate was incubated in a 37°C water bath for 45 minutes. The secondary antibody was discarded and the plate was washed three times with PBS (protected from light). PBS was added and the results were analyzed using an inverted fluorescence microscope. A cell line that tested positive for IFA was obtained. The positive hybridoma cells screened were subcloned to establish a hybridoma cell line that stably secretes anti-FAdV-4, designated hybridoma cell line 6F11. The hybridoma cell strain 6F11 was deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC) on March 21, 2024, located in Beijing, China, with the accession number CGMCCNO.45830 and the classification name as mouse hybridoma cell.

[0051] 3. Preparation of monoclonal antibodies against hybridomas

[0052] The monoclonal antibody 6F11 was isolated and plated in 25 cm 2After culturing in T25 cell culture flasks, 6 mL of HT medium containing 10% serum was added. After culturing the cells in vitro for 2 days, the hybridoma cells formed a dense monolayer and the culture medium turned yellow. The culture supernatant was collected and centrifuged at 4°C, 12000 rpm for 10 min to remove cells and debris, and the 6F11 hybridoma monoclonal antibody was obtained.

[0053] 4. Preparation of Ascites

[0054] After the hybridoma cells were screened and cultured, 1×10 7 / 200μl was injected into BLAB / C mice with 200μl. After 7 days, when the abdominal circumference of the mice increased, the ascites was collected with a syringe needle, centrifuged at 4000r / min for 10min, and the supernatant was filtered through 0.45μm to obtain the ascites mAb product.

[0055] 5. Identification of monoclonal antibody antigen subclasses

[0056] The subclass of monoclonal antibody 6F11 was identified according to the instructions of the monoclonal antibody subclass identification kit (Beijing Biolong Biotechnology Co., Ltd., catalog number: KLB4015524). The result showed that the heavy chain subclass of monoclonal antibody 6F11 was IgG1.

[0057] 6. Determination of the titer of monoclonal antibodies in hybridoma cell supernatant and ascites

[0058] The specific steps for ELISA titer determination of supernatant and ascites are as follows: Hexon truncated protein was coated on the ELISA plate at 1 μg / well and incubated at 37°C for 1 hour and 4°C overnight. The next day, the liquid in the wells was discarded and washed three times, each time for 2 minutes; 200 μl of 5% skim milk blocking solution was added to each well and incubated at 37°C for 1 hour; and 1:10 diluted PBS was added to each well. 1 ~10 9 The diluted 6F11 hybridoma supernatant and ascites were incubated at 37°C for 1 hour; washed three times and patted dry; HRP-labeled goat anti-mouse IgG (1:10000 dilution) was added and incubated at 37°C for 1 hour; washed three times and patted dry; 100 μl / well of color development solution was added and color was developed at room temperature in the dark for 15 minutes; the reaction was terminated, 50 μl of 2 mol / L sulfuric acid was added to each well, the mixture was shaken and the OD450nm value was measured by microplate reader. The titer of the monoclonal antibody secreted by the 6F11 hybridoma cells was 1:3200, and the titer of the prepared ascites antibody was 1:10 6 Furthermore, using the IFA assay, LMH cells infected with FAdV-4 (SD2015 strain) were fixed, and the ascites and supernatant were diluted 10 times, respectively, and the titer was determined by indirect immunofluorescence. The IFA titer of the 6F11 hybridoma cell supernatant was 1:800, and the titer of the ascites was 1:25,000.

[0059] 7. Stability experiment of monoclonal antibodies secreted by hybridoma cell lines

[0060] After 12 months of cryopreservation, the hybridoma cells were removed from liquid nitrogen and revived. Indirect immunofluorescence assays were then performed to assess the secretion of monoclonal antibodies (MAbs). The results showed that the titer of the supernatant secreted by the hybridoma cell line 6F11 was consistent with that before cryopreservation, indicating stable antibody secretion. Testing of MAbs secreted by hybridomas after 30 passages also demonstrated the stability of MAb secretion by the hybridoma cell line.

[0061] Example 2

[0062] Western blot reactivity of monoclonal antibody 6F11 with different serotypes of avian adenovirus

[0063] FAdV-1, highly pathogenic FAdV-4SD2015 (HP-FAdV-4), non-pathogenic FAdV-4B1-7

[0064] LMH cells were infected with (LP-FAdV-4), FAdV-7, FAdV-8a, FAdV-8b, FAdV-10, and FAdV-11. Three days after infection, LMH cells were lysed with lysis buffer (CST, MA, USA) containing PMSF (Beyotime, Shanghai, China), and the supernatant was collected and added to protein loading buffer. The samples were boiled at 98°C for 10 min, separated by SDS-PAGE gel electrophoresis, and transferred to NC membranes. The NC membranes were blocked with skim milk, and the ascites monoclonal antibody 6F11 prepared in Example 1 was diluted 1:1000 with PBST as the primary antibody and incubated with the NC membranes at room temperature for 2 h. The cells were washed three times with PBST and stained with HRP-labeled goat anti-mouse IgG.

[0065] The secondary antibody was incubated with the NC membrane at room temperature for 1 hour; after washing 3 times with PBST, 500 μl of ECL colorimetric solution was added and the membrane was detected using a chemiluminescence instrument. First, the monoclonal antibody 3G8 that reacts with all serotypes of avian adenovirus was used to detect the infection of different serotypes of the virus. The results are as follows: Figure 2 As shown in the figure, there are Hexon protein specific bands in the lanes where different serotypes of adenovirus are located, proving that the infection is successful. Figure 2 As shown, a distinct specific band with a molecular weight of approximately 105 kDa was observed in the lanes of cells infected with HP-FAdV-4 (SD2015) and LP-FAdV-4, whereas no such band was observed in the lanes of other genotypes. This result indicates that monoclonal antibody 6F11 can detect FAdV-4 by Western blot and does not cross-react with other serotypes.

[0066] Example 3

[0067] IFA reactivity of monoclonal antibody 6F11 with avian adenovirus

[0068] LMH cells infected with FAdV-1, HP-FAdV-4, LP-FAdV-4, FAdV-6, FAdV-7, FAdV-8a, FAdV-8b, FAdV-10 and FAdV-11 were used as antigens, fixed with ice-cold acetone and ethanol (3:2) for 5 minutes, washed once with PBS, added with the ascites monoclonal antibody 6F11 prepared in Example 1 and diluted with PBST 1:1000 at 100 μl / well, and LMH cells not infected with the virus were set as negative controls, incubated at 37°C for 45 minutes; washed three times with PBS, added with FITC-labeled goat anti-mouse IgG secondary antibody, and acted at 37°C for 45 minutes; washed three times with PBS, and observed under a fluorescence microscope. The results are as follows Figure 3 As shown: In the wells incubated with mouse polyclonal antibodies against all genotypes, FAdVs of all genotypes have fluorescence. In the wells incubated with monoclonal antibody 6F11, cells infected with HP-FAdV-4 and LP-FAdV-4 showed obvious bright green specific fluorescence ( Figure 3 ), while no specific green fluorescence was observed in wells infected with other serotypes of FAdV and LMH cells. This result indicates that monoclonal antibody 6F11 can detect FAdV-4 by IFA technology and does not cross-react with other serotypes of FAdV.

[0069] Example 4

[0070] Analysis of the epitope and key amino acids recognized by monoclonal antibody 6F11

[0071] 1. Analysis of monoclonal antibody recognition epitopes

[0072] In order to determine the hexon protein epitope recognized by mAb 6F11, two rounds of overlapping peptides fused to GST-Tag were designed using the primers shown in Table 2 ( Figure 4 A, 4C) and expressed in E. coli BL21 (DE3) competent cells. First, the 104-291 amino acid fragment of the immunogen Hexon was divided into three overlapping segments: H2 (104-178aa), H3 (170-231aa), H4 (223-291aa), and the FAdV-4 type specific antigen dominant region F5 (150-178aa). The results are shown in Figure 2. Figure 4As shown in B, the monoclonal antibody 6F11 can react with H2 (104-178aa) and F5 (150-178aa), that is, the epitope targeted by the monoclonal antibody 6F11 is located between Hexon F5 (150-178aa). In the second round, the F5 (150-178aa) peptide was sequentially reduced from both ends. Finally, 161TSTSKDT167 was identified as the B cell epitope recognized by the monoclonal antibody 6F11 ( Figure 4 D).

[0073] Table 2 PCR primers used to identify epitopes recognized by monoclonal antibodies

[0074]

[0075]

[0076] 2. Analysis of key amino acids recognized by monoclonal antibody 6F11

[0077] Further, by searching for the sequences of FAdV strains published outside, DNAstar was used to perform sequence comparison, such as Figure 5As shown in Figure A, the sequence of 161TSTSKDT167 contains an S164T mutation in the FAdV-4 Hexon protein sequence, while the FAdV-10 Hexon carries both S162N and D166A mutations. To further explore the effects of these amino acid mutations on the reactivity of monoclonal antibody 6F11, the FAdV-10-C2B Hexon gene containing a partial PCDNA3.1 sequence was amplified using the primers PCDNA3.1-Hexon C2B-F and PCDNA3.1-Hexon C2B-R in Table 3 using the FAdV-10-C2B genome as a template. This gene was then ligated into a linearized PCDNA3.1 vector using homologous recombinases, transformed into Escherichia coli DH5α, amplified, and sequenced to confirm its correctness, resulting in the PCDNA3.1-Hexon C2B plasmid. Similarly, the primers PCDNA3.1-HexonSD2015-F and PCDNA3.1-HexonSD2015-R in Table 3 were used to construct the PCDNA3.1-HexonSD2015 plasmid using the FAdV-4-SD2015 genome as a template. Then, using the primers in Table 3 and plasmids pcDNA-Hexon SD2015 and pcDNA-Hexon C2B as templates, PCR amplified 9 mutant Hexon genes, and the ClonExpress II one-step cloning kit was used to construct mutant plasmids for self-homologous recombination. The correct clones were verified by sequencing and named HP-FAdV-4S162N, HP-FAdV-4S164T, HP-FAdV-4D166A, FAdV-10N162S, FAdV-10A166D and FAdV-10N162S, A166D. As shown in the figure Figure 5As shown in Figure 5B, mAb 6F11 does not react with HP-FAdV-4 hexons harboring either the S162N or D166A mutations or with FAdV-10 hexons harboring only the 162N and 166A mutations. However, it reacts with FAdV-10 hexons harboring both the N162S and A166D mutations. This indicates that 162S and 166D are key amino acids in the epitope 161TSTSKDT167 recognized by mAb 6F11. Furthermore, mAb 6F11 exhibits good IFA reactivity with the HP-FAdV-4 S164T mutation, and the FAdV-4 S164T mutation does not affect 6F11's epitope recognition. Therefore, mAb 6F11 is specifically targeted against FAdV-4, and the epitope 161TSTSKDT167 targeted by 6F11 is unique to FAdV-4. Both the reactivity test of monoclonal antibody 6F11 with different FAdVs and the analysis of its recognized epitopes and key amino acid conservation demonstrated that monoclonal antibody 6F11 recognized all FAdV-4 serotypes, including HP-FAdV-4 and LPFAdV-4, and did not recognize avian adenovirus serotypes other than FAdV-4. The identification of novel antigenic determinants and key antigenic sites recognized by monoclonal antibody 6F11 highlights its utility in distinguishing FAdV-4 from other FAdV serotypes.

[0078] Table 3 PCR primers used to identify key amino acids of monoclonal antibody 6F11

[0079] Primer name Primer sequence 5'-3' PCDNA3.1-HexonC2B-F AGCTTGGTACCGAATGGCGGCCCTCAC PCDNA3.1-HexonC2B-R ATATTCTGCAGAATTTACACGGCGTTGCCTG PCDNA3.1-HexonSD2015-F AGCTTGGTACCGAATGGCGGCCCTCACG PCDNA3.1-HexonSD2015-R ATATCTGCAGAATCACGGCGTTGCCTGT StoN-162aa-F CAACACGAACACCTCCAAAGACACGACGGCGG StoN-162aa-R TGGAGGTGTTCGTGTTGGTATAGACGTTGGACA StoT-164aa-F CACGAGCACCACCAAAGACACGACGGCGGCGCAGG StoT-164aa-R CGTGTCTTTGGTGGTGCTCGTGTTGGTATAGACG DtoA-166aa-F ACCTCCAAAGCCACGACGGCGGCGCAGGTGAC DtoA-166aa-R GTCGTGGCTTTGGAGGTGCTCGTGTTGGTATA NtoS-162aa-F AACACGAGCACCTCCAAAGCCACGAC NtoS-162aa-R GGAGGTGCTCGTGTTGGTATAGACATTG AtoD-166aa-F TCCAAAGACACGACGGCGGCGCAGGTGA AtoD-166aa-R CGTCGTGTCTTTGGAGGTGTTCGTGTTG NtoSandAtoD-F AGCACCTCCAAAGACACGACGGCGGCGCAG NtoSandAtoD-R GTCTTTGGAGGTGCTCGTGTTGGTATAGACATTG

[0080] 3. Localization of epitopes in the 3D structure of Hexon protein

[0081] To further explore the spatial structure of the epitope recognized by the generated monoclonal antibodies, the three-dimensional structure of the FAdV-4 strain SD2015 Hexon was predicted using the SWISS-MODEL website (https: / / swissmodel.expasy.org / ), and then the antigen epitope and key amino acids were displayed on the Hexon protein structure using the software ChimeraX 1.8 (https: / / www.cgl.ucsf.edu / chimerax / ). Figure 6As shown in Figures 6A and 6B, epitope 161TSTSKDT167 is located on the lateral surface of the Hexon protein LOOP ring and in the three tower regions at the top of the Hexon protein homotrimer. The key sites 162S and 166D (red) protrude symmetrically at both ends of the epitope. The three tower regions of the Hexon protein form the outer surface of the virus particle, indicating that the antigen epitope is exposed on the surface of the virus particle. B cell epitopes exposed on the surface of the virus and key antigenic sites within the corresponding epitopes are likely to have higher antibody accessibility, making them easier to be captured and recognized by antibodies.

[0082] In summary, in order to obtain FAdV-4 type-specific monoclonal antibodies, the present invention started with analyzing the FAdV-4 type-specific antigen epitope, used the FAdV-4 Hexon (104-291aa) truncated protein as the immunogen, and successfully prepared a monoclonal antibody that can recognize the FAdV-4 Hexon protein through monoclonal antibody technologies such as mouse immunization and cell fusion, named monoclonal antibody 6F11. Subsequently, IFA and WB tests proved that monoclonal antibody 6F11 only reacted with FAdV-4 and did not react with FAdV of its serotype. To understand the mechanism by which 6F11 exclusively recognizes FAdV-4, a series of GST-fused Hexon truncated peptides were used to localize the minimal epitope 161TSTSKDT167 of the FAdV-4 Hexon protein recognized by 6F11 through Western blotting. Sequence alignment revealed that the sequence of 161TSTSKDT167 harbors the S164T mutation in the FAdV-4 Hexon protein sequence, while the FAdV-10 Hexon protein also carries the S162N and D166A mutations. To further investigate the impact of these amino acid mutations on the reactivity of the monoclonal antibody 6F11, point mutation plasmids were constructed for the relevant sites. IFA assays demonstrated that the S162N and D166A mutations affect the recognition of the Hexon protein by the monoclonal antibody 6F11, indicating that S162 and D166 are key amino acid sites recognized by the monoclonal antibody 6F11. SWISS-MODEL was further used to perform three-dimensional homology modeling of the Hexon protein and annotate the antigenic amino acids recognized by the monoclonal antibody 6F11. The study found that the antigenic epitope recognized by 6F11 was exposed on the surface of the virus particle and had higher antibody accessibility, making it easier to be captured and recognized by antibodies.

[0083] With the widespread outbreak of highly pathogenic serotype 4 avian adenovirus (FADV) across the country, a simple, rapid, and large-scale method for monitoring and epidemiological investigation of FADV-4 has yet to be established. The monoclonal antibody 6F11 prepared by the present invention and its recognized epitope and key amino acid sites can be used to develop serological and viral detection methods for FAdV-4, facilitating the control of serotype 4 avian adenovirus transmission in China. Therefore, this monoclonal antibody and the identified epitope are expected to become potential tools for the detection and diagnosis of serotype 4 avian adenovirus and for conducting basic research.

Claims

1. A hybridoma cell line 6F11 secreting anti-FAdV-4 Hexon protein monoclonal antibody, characterized in that: The deposit number of the hybridoma cell line is CGMCC NO.45830, and the deposit date is March 21, 2024.

2. An anti-FAdV-4 Hexon protein monoclonal antibody 6F11, characterized in that: Preferably, it is secreted by the hybridoma cell line 6F11 according to claim 1.

3. The monoclonal antibody 6F11 according to claim 2, characterized in that The monoclonal antibody 6F11 specifically binds to the FAdV-4 Hexon protein antigen, but does not react with other serotype FAdV Hexon proteins.

4. The monoclonal antibody 6F11 according to claim 2, characterized in that The heavy chain subtype of the monoclonal antibody 6F11 is IgG1.

5. An antigenic epitope recognized by the monoclonal antibody 6F11 according to claim 2, characterized in that: The antigen epitope is located at amino acids 161-167 of the FAdV-4 Hexon protein of the highly pathogenic serotype 4 fowl adenovirus SD2015 strain, and the amino acid sequence of the antigen epitope is TSTSKDT.

6. A key amino acid site of the antigen epitope recognized by the monoclonal antibody 6F11 according to claim 2, characterized in that: The key amino acid sites of the antigen epitope are amino acids S162 and D166 at positions 162 and 166 of the FAdV-4 Hexon protein.

7. The key amino acid site of the antigen epitope recognized by the monoclonal antibody 6F11 according to claim 6, characterized in that: The amino acids S162 and D166 at positions 162 and 166 of the FAdV-4 Hexon protein are characteristic amino acids of serotype 4 avian adenovirus.

8. Use of the monoclonal antibody 6F11 according to claim 2 in preparing a product for detecting and identifying serotype 4 avian adenovirus.

9. The use according to claim 8, characterized in that The serotype 4 avian adenovirus comprises highly pathogenic serotype 4 avian adenovirus and non-pathogenic serotype 4 avian adenovirus, wherein the isolated strains of highly pathogenic serotype 4 avian adenovirus preferably include SD2015, AHFY15, JH13, and JSCZ15; and the non-pathogenic serotype 4 avian adenovirus preferably include ON-1 and B1-7.

10. A kit for detecting and identifying serotype 4 avian adenovirus, characterized in that: The kit comprises the monoclonal antibody 6F11 according to claim 2 and auxiliary materials constituting the kit.