4-hydroxybutyraldehyde dehydrogenase mutant and application thereof
By mutation and gene optimization of 4-hydroxybutyraldehyde dehydrogenase, the activity bottleneck in the 1,4-butylene glycol biosynthesis pathway was solved, significantly improving the yield of 1,4-butylene glycol, and the mutant M227V achieved a 10-fold increase in yield.
Patent Information
- Application Number
- CN202510640979.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-08
AI Technical Summary
In the prior art, AdhE2 has a low activity, resulting in the final step of the 1,4-butanediol biosynthesis pathway becoming a bottleneck, making it difficult to effectively convert non-natural substrates into 1,4-butanediol.
The production process of 1,4-butanediol is optimized by performing single-point or multi-point mutations of 4-hydroxybutyraldehyde dehydrogenase derived from Clostridium Byerella, especially M227V and M227R mutants, and improving its activity, and gene knockout and vector expression in E. coli.
The 4-hydroxybutyraldehyde dehydrogenase activity of the mutant was significantly improved, especially the M227V mutant, which increased the 1,4-butylene glycol yield to more than 10 times that of the wild type.
Smart Images
Figure CN120442575A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, in particular to a 4-hydroxybutyraldehyde dehydrogenase mutant and application thereof. Background Art
[0002] 1,4-Butanediol (1,4-BDO) is an important chemical raw material that can be converted into various chemicals, including tetrahydrofuran, γ-butyrolactone, polybutylene terephthalate, and polybutylene succinate. It is widely used in the medical, food, light industry, chemicals, and materials sectors. The cell factory-based method for producing 1,4-butanediol is a green synthetic approach, and overcoming the difficulties in its production is a goal that researchers are dedicated to achieving.
[0003] Hydroxybutyraldehyde dehydrogenase (HBD) is a CoA-dependent aldehyde dehydrogenase that catalyzes the key reactions in acetone / butanol-producing Clostridia: acetyl-CoA and butyl-CoA are reduced to the corresponding aldehydes, which are then reduced to ethanol and 1-butanol by alcohol dehydrogenase (ADH). Some Clostridia, such as Clostridium acetobutylicum, possess the enzyme aldehyde / alcohol dehydrogenase (AdhE2), which catalyzes the final two reactions in the biosynthesis of 1,4-butanediol: the conversion of 4-hydroxybutyryl-CoA to 4-hydroxybutyraldehyde and the conversion of 4-hydroxybutyraldehyde to 1,4-butanediol. However, due to its low activity, the bifunctional AdhE2 remains inefficient in converting non-natural substrates to 1,4-butanediol. The final step catalyzed by AdhE2 is the bottleneck of the 1,4-butanediol biosynthesis pathway.
[0004] Therefore, improving the activity of 4-hydroxybutyraldehyde dehydrogenase is a difficult problem that needs to be solved urgently in the biosynthesis of 1,4-butanediol. Summary of the Invention
[0005] In order to improve the yield of 1,4-butanediol biosynthesis, more specifically, to improve the activity of 4-hydroxybutyraldehyde dehydrogenase, the present invention provides a 4-hydroxybutyraldehyde dehydrogenase mutant and application thereof.
[0006] The specific technical solutions of the present invention are: In a first aspect, the present invention provides a 4-hydroxybutyraldehyde dehydrogenase mutant, which is obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to single-point mutation or multi-point combined mutation at the following sites: Methionine 227 was mutated to valine; Methionine at position 227 was mutated to alanine; Methionine 227 mutated to arginine; Methionine 227 was mutated to serine; Glutamine at position 394 was mutated to arginine; Glutamine at position 394 was mutated to valine; Glutamine at position 394 was mutated to glutamic acid; Glutamine at position 394 was mutated to asparagine; Arginine at position 396 was mutated to valine; Arginine at position 396 was mutated to aspartic acid; Arginine at position 396 was mutated to threonine; The residues were truncated from leucine 316 to isoleucine 327.
[0007] The present invention uses wild-type 4-hydroxybutyraldehyde dehydrogenase (CoA-dependent aldehyde dehydrogenase) from Clostridium beijerinckii as the target for modification. Through the aforementioned single-point mutation or multi-point combination mutation, 4-hydroxybutyraldehyde dehydrogenase mutants are obtained. These mutants effectively improve the yield of 1,4-butanediol compared to the wild-type. In particular, the M227V and M227R mutants can increase the yield of 1,4-butanediol by more than 10 times. The amino acid sequence of the wild-type 4-hydroxybutyraldehyde dehydrogenase is shown in SEQ ID NO. 1.
[0008] In a second aspect, the present invention provides a gene encoding the above-mentioned 4-hydroxybutyraldehyde dehydrogenase mutant.
[0009] In a third aspect, the present invention provides an expression vector for the above-mentioned encoding gene.
[0010] Preferably, the expression vector is a plasmid, phage or viral vector.
[0011] In a fourth aspect, the present invention provides a cloning vector of the above-mentioned encoding gene.
[0012] In a fifth aspect, the present invention provides the above-mentioned 4-hydroxybutyraldehyde dehydrogenase mutant or the host cell encoding the above-mentioned gene.
[0013] Preferably, the host cell is Escherichia coli, wherein the gene encoding D-lactate dehydrogenase is deleted. ldhA Gene encoding alcohol dehydrogenase adhE Gene.
[0014] In a sixth aspect, the present invention provides the use of the above-mentioned 4-hydroxybutyraldehyde dehydrogenase mutant in the production of 1,4-butanediol.
[0015] In a seventh aspect, the present invention provides use of the above host cell in the production of 1,4-butanediol.
[0016] Preferably, the application method is: inoculating and culturing the host cells, and adding 4-hydroxybutyric acid during the culturing process.
[0017] Compared with the prior art, the present invention has the following technical effects: The present invention uses the wild-type 4-hydroxybutyraldehyde dehydrogenase (CoA-dependent aldehyde dehydrogenase) from Clostridium beijerinckii as the modification object, and obtains 4-hydroxybutyraldehyde dehydrogenase mutants through the above-mentioned single-point mutation or multi-point combination mutation. These mutants have effectively improved the yield of 1,4-butanediol compared with the wild-type, especially the M227V and M227R mutants, which can increase the yield of 1,4-butanediol by more than 10 times. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 is the map of the recombinant plasmid pTrc99a-ACY; Figure 2 This is a comparison chart of the effects of 4-hydroxybutyraldehyde dehydrogenase and its mutants in producing 1,4-butanediol. DETAILED DESCRIPTION
[0019] The present invention will be further described below with reference to the following embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only a portion of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0020] In the embodiment of the present invention, the sequences involved are: the amino acid sequence encoding 4-hydroxybutyraldehyde dehydrogenase is shown in SEQ ID NO.1; the nucleotide sequence of the cat2 gene encoding 4-hydroxybutyryl-CoA transferase is shown in SEQ ID NO.2; the nucleotide sequence of the yqhD gene encoding alcohol dehydrogenase is shown in SEQ ID NO.3; the nucleotide sequence of the Ptrc promoter is shown in SEQ ID NO.4; the nucleotide sequence encoding lactate dehydrogenase (LDH) is shown in SEQ ID NO. ldhA The nucleotide sequence of the gene is shown in SEQ ID NO.5; encoding alcohol dehydrogenase adhE The nucleotide sequence of the gene is shown in SEQ ID NO.6.
[0021] In this embodiment of the present invention, the final concentration composition of the fermentation medium is: 20 g / L glucose, 3 g / L potassium dihydrogen phosphate, 6.78 g / L sodium hydrogen phosphate, 1 g / L ammonium chloride, 0.5 g / L sodium chloride, 0.011 g / L calcium chloride, 0.12 g / L magnesium sulfate, 5 g / L yeast powder, 5 g / L 4-hydroxybutyric acid was added, the solvent was deionized water, and the pH value was natural.
[0022] In the embodiment of the present invention, the LB liquid culture medium is composed of: 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, the solvent is deionized water, and the pH value is natural.
[0023] In the embodiment of the present invention, the composition of the LB plate culture medium is to add agar to the LB liquid culture medium at a final concentration of 2 g / L.
[0024] In the embodiment of the present invention, the detection method of the product 1,4-butanediol is as follows: the chromatographic column is Aminex HPX-87H, the column temperature is 60°C, the mobile phase is 5 mM / LH2SO4, the flow rate is 0.6 mL / min; the detector is a 1260 Infinity II differential refractive index detector; and the injection volume is 10 uL.
[0025] In the embodiment of the present invention, the sequence information of the primers is shown in Table 1.
[0026] Table 1 Primers sequence Primer 1 CCGTATTCACCGCGCGTATCGTTTTAGAGCTAGAAATAGC Primer 2 GATACGCGCGGTGAATACGGACTAGTATTATACCTAGGAC Primer 3 CTATTACCCTGTTATCCCTACGAGCGGCTGGCGATTGCTCC Primer 4 AATGCAGGGGAGCGGCAAGAAAGACTTTCTCCAGTGATGTTGAAT Primer 5 GGAGAAAGTCTTTCTTGCCGCTCCCCTGCATT Primer 6 GGAGCTGCACATGAACTCGACTTATAAGTTAATGTCTGTT Primer 7 GGTTTAAAAGCGTCGATGTCC Primer 8 GATAACGCAGTTGCTGGATATC Primer 9 GGATCAGGTTGATGTCTGGGGTTTTAGAGCTAGAAATAGC Primer 10 CCCAGACATCAACCTGATCCACTAGTATTATACCTAGGAC Primer 11 CTATTACCCTGTTATCCCTACGAAGTAAACGGGAAAATCAAAAAAG Primer 12 GCGCTACTGAAATGCTCTCCTGATAATGTT Primer 13 CAGGAGAGCATTTCAGTAGCGCTGTCTGGCAAC Primer 14 GGAGCTGCACATGAACTCGATGGCAAAAAGTTGCAGGCCG Primer 15 TGACTTCCCAGGTTCATTAAGG Primer 16 CGATACGGAACGAATCAATTGAT Primer 17 TTTCACACAGGAAACAGACCATGAACAACTTTAATCTGCACACCC Primer 18 GTATCAGGCTGAAAATCTTCTCTCTTAGCGGGCGGCTTCGTATAT Primer 19 TTTCACACAGGAAACAGACCATGAACAAAGACACTCTGATTCC Primer 20 GGTCTGTTTCCTGTGTGAAATTAACCTGCCAGAACGCAAC Primer 21 TTTCACACAGGAAACAGACCATGAAAGACGTTCTGGCGGAAT Primer 22 CACCTGGCTAAACGTTTCGGTTAATTTCACACAGGAAACAGACC Primer 23 GGTCTGTTTCCTGTGTGAAATTG Primer 24 GAGAGAAGATTTTCAGCCTGATAC Primer 25 TAATCGGCGCTGCTACTCCGTCTACTAATCCAAC Primer 26 TAGACGGAGTAGCAGCGCCGATTACGCCGTACG Primer 27 TGGTCCGGGTGTTGTTAAGACTCTGCTGAACTC Primer 28 GAGTCTTAACAACACCCGGACCACCAGTACCGC Primer 29 TGGTCCGGGTGCTGTTAAGACTCTGCTGAACTC Primer 30 GAGTCTTAACAGCACCCGGACCACCAGTACCGC Primer 31 TGGTCCGGGTAGAGTTAAGACTCTGCTGAACTC Primer 32 GAGTCTTAACTCTACCCGGACCACCAGTACCGC Primer 33 TGGTCCGGGTTCTGTTAAGACTCTGCTGAACTC Primer 34 GAGTCTTAACAGAACCCGGACCACCAGTACCGC Primer 35 GATCGCAGAAAGAAACCGTAAACACTCTGCGTAC Primer 36 GTTTACGGTTTCTTTCTGCGATCTTCGCGTATT Primer 37 GATCGCAGAAGTTAACCGTAAACACTCTGCGTAC Primer 38 GTTTACGTTAACTTCTGCGATCTTCGCGTATT Primer 39 GATCGCAGAAGAAAACCGTAAACACTCTGCGTAC Primer 40 GTTTACGGTTTTCTTCTGCGATCTTCGCGTATT Primer 41 GATCGCAGAAAATAACCGTAAACACTCTGCGTAC Primer 42 GTTTACGGTTATTTTCTGCGATCTCTCCGGTATT Primer 43 CAGAACAGAACGTTAAACACTCTGCGTACATCTAC Primer 44 CAGAGTGTTTAACGTTCTGTTCTGCGATCTTCG Primer 45 CAGAACAGAACGATAAACACTCTGCGTACATCTAC Primer 46 CAGAGTGTTATCGTTCTGTTCTGCGATCTTCG Primer 47 CAGAACAGAACACTAAACACTCTGCGTACATCTAC Primer 48 CAGAGTGTTAGTGTTCTGTTCTGCGATCTTCG Primer 49 TGATACCTTTTTGGAGTGAGCACCAGGTCGATCAGTT Primer 50 GCTCACTCCAAAAGGTATCAACAAGAAATGGGTTGG In the examples of the present invention, unless otherwise specified, the PCR reaction conditions are as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, repeated for 30 cycles; and further extension at 72°C for 10 min.
[0027] Example 1 Construction of wild-type 4-hydroxybutyraldehyde dehydrogenase gene expression vector In this example, the recombinant plasmid pTrc-ACY (pTrc99a- ald - cat2 - yqhd ), used as an expression vector for the wild-type 4-hydroxybutyraldehyde dehydrogenase encoding gene. Follow the steps below: (1) Based on the source Clostridium beijerinckii The gene encoding 4-hydroxybutyraldehyde dehydrogenase ald The gene was used as a template and primers 19 and 20 were used to amplify the ald Gene fragments. Among them, ald The gene template is synthesized by whole gene synthesis technology based on the amino acid sequence of SEQ ID NO.1.
[0028] (2) Using primers 17 and 18 and the E. coli genome as template, PCR amplification was performed to obtain yqhD fragment.
[0029] (3) Using primers 21 and 22, cat2 The gene was used as a template and PCR amplified cta2 fragment. cat2 The gene encodes 4-hydroxybutyryl-CoA transferase, cat2The gene template is synthesized using the nucleotide sequence of SEQ ID NO. 2 through whole gene synthesis technology.
[0030] (4) Using primers 23 and 24 and the pTrc-99a plasmid as a template, PCR amplification was performed to obtain the pTrc-99a fragment.
[0031] (5) Combine the plasmid fragment obtained in step 4 with the gene fragment obtained in steps (1), (2), and (3) ald 、 yqhD and cat2 Connect and obtain the recombinant plasmid pTrc99a- ald - cat2 - yqhd , recorded as recombinant plasmid pTrc-ACY. The plasmid map is as follows Figure 1 shown.
[0032] Example 2 Construction of mutant 4-hydroxybutyraldehyde dehydrogenase gene expression vector This example constructs a gene expression vector for a 4-hydroxybutyraldehyde dehydrogenase mutant, which is used as an expression vector for the gene encoding the 4-hydroxybutyraldehyde dehydrogenase mutant. The following steps are performed: Using primers 25 and 26 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-1. The 4-hydroxybutyraldehyde dehydrogenase mutant (I139A) expressed in pTrc-ACY-1 was a mutation of isoleucine at position 139 to alanine.
[0033] Using primers 27 and 28 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-2. The 4-hydroxybutyraldehyde dehydrogenase mutant (M227V) expressed in pTrc-ACY-2 was mutated from methionine at position 227 to valine.
[0034] Using primers 29 and 30 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-3. The 4-hydroxybutyraldehyde dehydrogenase mutant (M227A) expressed in pTrc-ACY-3 was mutated from methionine at position 227 to alanine.
[0035] Using primers 31 and 32 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-4. The 4-hydroxybutyraldehyde dehydrogenase mutant (M227R) expressed in pTrc-ACY-4 was mutated from methionine at position 227 to arginine.
[0036] Using primers 33 and 34 and pTrc-ACY as templates, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-5. The 4-hydroxybutyraldehyde dehydrogenase mutant (M227S) expressed in pTrc-ACY-5 was mutated from methionine at position 227 to serine.
[0037] Using primers 35 and 36 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-6. The 4-hydroxybutyraldehyde dehydrogenase mutant (Q394R) expressed in pTrc-ACY-6 was a mutation of glutamine at position 394 to arginine.
[0038] Using primers 37 and 38 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-7. The 4-hydroxybutyraldehyde dehydrogenase mutant (Q394V) expressed in pTrc-ACY-7 was a mutation of glutamine at position 394 to valine.
[0039] Using primers 39 and 40 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-8. The 4-hydroxybutyraldehyde dehydrogenase mutant (Q 394E) expressed in pTrc-ACY-8 was a mutation of glutamine at position 394 to glutamate.
[0040] Using primers 41 and 42 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-9. The 4-hydroxybutyraldehyde dehydrogenase mutant (Q394N) expressed in pTrc-ACY-9 was a mutation of glutamine at position 394 to asparagine.
[0041] Using primers 43 and 44 and pTrc-ACY as templates, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-10. The 4-hydroxybutyraldehyde dehydrogenase mutant (R396V) expressed in pTrc-ACY-10 had arginine at position 396 mutated to valine.
[0042] Using primers 45 and 46 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-11. The 4-hydroxybutyraldehyde dehydrogenase mutant (R396N) expressed in pTrc-ACY-11 was mutated from arginine at position 396 to aspartic acid.
[0043] Using primers 47 and 48 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-12. The 4-hydroxybutyraldehyde dehydrogenase mutant (R396T) expressed in pTrc-ACY-12 had arginine at position 396 mutated to threonine.
[0044] Using primers 49 and 50 and pTrc-ACY as template, PCR amplification was performed to obtain the site-directed mutagenesis recombinant plasmid pTrc-ACY-13. The 4-hydroxybutyraldehyde dehydrogenase mutant (L316-I327) expressed in pTrc-ACY-13 was truncated from leucine 316 to isoleucine 327.
[0045] Example 3 Metabolic transformation of chassis bacteria This example is to test the bottom plate bacteria Escherichia coli ( Escherichia coli )W3110 (purchased from The Coli Genetic Stock Center) ldhA Gene, adhE Gene knockout can reduce NADH consumption in other pathways. Follow these steps: (1) ldhA Gene knockout In order to block the NADH consumption in the cell lactate pathway, ldhA The gene (nucleotide sequence shown in SEQ ID NO.5) was knocked out. The knockout technology is described in Jiang Y, Chen B, Duan C, et al. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System [J]. Applied & Environmental Microbiology, 2015, 81 (7): 2506. Specifically, by PCR technology, primers 1 and 2 were used, and the pTarget vector was used as a template to construct a vector capable of expressing the target gene. ldhA sgRNA pTarget-Δ ldhA The PCR product was treated with Dpn I at 37°C for 3 h, inactivated, and then transformed into E.coli BL21 (DE3) recipient bacteria were plated on LB solid plates containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance and cultured at 37°C for 12 hours. Single colonies were randomly picked and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance and cultured at 37°C for 12 hours. The bacteria were collected and the plasmid was extracted to obtain pTarget-Δ ldhA carrier.
[0046] By PCR technology, primers 3 and 4 were used to generate the Escherichia coli The W3110 genome was used as a template for amplification. ldhAGene upstream homologous fragment. According to the same method, primers 5 and 6 were used to amplify the downstream homologous fragment of the ldhA gene. The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover the purified fragment. The two recovered DNA fragments were subjected to fusion PCR using primers 3 and 6. The PCR reaction conditions were as follows: 95℃ 5min; 95℃ 30s, 55℃ 30s, 72℃ 1min, repeated 30 cycles; 72℃ continued extension for 10min. The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover and purify. pTarget-Δ ldhA The vector and the recovered purified DNA fragment were electroporated into the pCas9 vector. Escherichia coli Strain W3110.
[0047] The pCas9 vector Escherichia coli The W3110 strain was cultured in LB medium containing 50 mg / L kanamycin and 10 mM L-arabinose at 30°C until the OD 600 When the p-value reached 0.6, the bacterial suspension was centrifuged to obtain the cells. The cells were washed twice with sterile distilled water and once with 10% glycerol solution (v / v), and then electroporated at 2.5 kV.
[0048] The electroporated bacterial suspension was spread onto an LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride and cultured overnight at 30°C. A single colony was picked as a template and PCR was performed using primers 7 and 8. The presence of a 1000 bp DNA band was confirmed on a 1.0% agarose gel. ldhA The strain confirmed by this method was cultured overnight in LB medium containing 50 mg / L kanamycin and 5 mM IPTG at 30°C to remove pTarget-Δ ldhA Then remove the pTarget-Δ ldhA The vector-carrying strain was cultured in LB medium at 37°C overnight to remove the pCas vector, and the strain Escherichia coli W3110Δ was constructed. ldhA .
[0049] (2) adhE Gene knockout To reduce NADH consumption and acetyl-CoA consumption in the ethanol pathway, the CRISPR-Cas9 system was used to modify Escherichia coli W3110Δ ldhA in adhE The gene (nucleotide sequence shown in SEQ ID NO.6) was knocked out. The specific steps are as follows: By PCR technology, using primers 9 and 10, and using the pTarget vector as a template, pTarget-Δ was constructed to express sgRNA targeting the target gene adhE. adhE The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 55°C for 15 s, 72°C for 2 min, repeated 30 cycles; and 72°C for 10 min. The PCR product was treated with DpnI at 37°C for 3 h, inactivated, and then transformed into E.coli BL21 (DE3) recipient bacteria were plated on LB solid plates containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance and cultured at 37°C for 12 hours. Single colonies were randomly picked and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance and cultured at 37°C for 12 hours. The bacteria were collected and the plasmid was extracted to obtain pTarget-Δ adhE carrier.
[0050] By PCR technology, primers 11 and 12 were used to generate the Escherichia coli The W3110 genome was used as a template for amplification. adhE The PCR reaction conditions for the upstream homologous fragment of the gene were as follows: 95℃ for 5min; 95℃ for 30s, 55℃ for 30s, 72℃ for 30s, repeated for 30 cycles; and 72℃ for 10min. The same method was used to amplify the fragment using primers 13 and 14. adhE The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover the purified fragment. The two recovered DNA fragments were subjected to fusion PCR using primers 11 and 14. The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover the purified fragment. adhE The vector and the recovered purified DNA fragment were electroporated into W3110Δ containing the pCas9 vector. ldhA strains.
[0051] The pCas9 vector carrying the pCas9 vector Escherichia coli The W3110 strain was cultured in LB medium containing 50 mg / L kanamycin and 10 mM L-arabinose at 30°C until the OD 600 When the p-value reached 0.6, the bacterial suspension was centrifuged to obtain the cells. The cells were washed twice with sterile distilled water and once with 10% glycerol solution (v / v), and then electroporated at 2.5 kV.
[0052] The electroporated bacterial suspension was plated onto an LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride and incubated overnight at 30°C. A single colony was selected as a template for PCR with primers 15 and 16, and the presence of a 2600 bp DNA band was confirmed on a 1.0% agarose gel. adhE The deletion of the gene will be adhE The strain with confirmed gene deletion was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔadhE vector. adhE The vector-carrying strain was cultured in LB medium at 37°C overnight to remove the pCas vector, and the strain W3110Δ was constructed. ldhA Δ adhE .
[0053] Example 4 Shake flask fermentation test The recombinant plasmid pTrc-ACY constructed in Example 1 and the recombinant plasmids pTrc-ACY-1 to pTrc-ACY-13 of different mutants constructed in Example 2 were respectively transformed into strain W3110Δ ldhA Δ adhE The shake flask fermentation test was carried out in Figure 2 , wherein Ald represents the fermentation result of the strain producing the wild-type 4-hydroxybutyraldehyde dehydrogenase, I139A represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant I139A, M227V represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant M227V, M227A represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant M227A, M227R represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant M227R, M227S represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant M227S, Q394R represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant Q394R, Q394V represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant Q394V, Q394E represents the fermentation result of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant Q The fermentation results of the strain 394E are shown in Figure 2, Q394N represents the fermentation results of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant Q394N, R396V represents the fermentation results of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant R396V, R396N represents the fermentation results of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant R396N, R396T represents the fermentation results of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant R396T, and L316-I327 represents the fermentation results of the strain producing the 4-hydroxybutyraldehyde dehydrogenase mutant L316-I327.
[0054] Among them, the fermentation test method is: Each strain was streaked onto an LB plate and cultured in a 37°C incubator overnight (12 hours). A single colony was picked and inoculated into 5 mL of LB medium. 50 mg / L kanamycin and 0.2 mM IPTG were added to induce protein expression. The culture was incubated at 200 rpm in a 37°C incubator for 12 hours to obtain seed solution.
[0055] One mL of seed liquid from each strain was inoculated into the fermentation medium. After incubation at 200 rpm in a 30°C incubator for 48 hours, 1 mL of the liquid was sampled from the shake flask, filtered through a membrane, and analyzed for 1,4-butanediol using a differential refractive index detector.
[0056] Depend on Figure 2 The fermentation results showed that the wild type Ald produced 0.18 g / L of 1,4-butanediol, the mutant I139A produced 0.18 g / L of 1,4-butanediol, the mutant M227A produced 0.65 g / L of 1,4-butanediol, the mutant M227S produced 0.96 g / L of 1,4-butanediol, the mutant M227R produced 1.89 g / L of 1,4-butanediol, the mutant M227V produced 2.05 g / L of 1,4-butanediol, the mutant Q394V produced 0.46 g / L of 1,4-butanediol, the mutant Q394E produced 0.42 g / L of 1,4-butanediol, the mutant Q394N produced 0.52 g / L of 1,4-butanediol, and the mutant Q394R produced 0.55 g / L of 1,4-butanediol, mutant R396V produced 0.74 g / L of 1,4-butanediol by fermentation, mutant R396T produced 0.41 g / L of 1,4-butanediol by fermentation, mutant R396D produced 0.38 g / L of 1,4-butanediol by fermentation, and mutant L316-I327 produced 0.24 g / L of 1,4-butanediol by fermentation.
[0057] Compared with the wild-type 4-hydroxybutyraldehyde dehydrogenase, except for mutant I139A, other mutants can promote the fermentation production of 1,4-butanediol to varying degrees, especially the M227V and M227R mutants, which can increase the yield of 1,4-butanediol by more than 10 times.
[0058] Among them, 4-hydroxybutyraldehyde dehydrogenase mutants I139A, M227V, M227A, M227R, M227S, Q394R, Q394V, Q 394E, Q394N, R396V, R396N, R396T, L316-I327 are SEQ ID The wild-type 4-hydroxybutyraldehyde dehydrogenase shown in NO.1 is mutated from isoleucine at position 139 to alanine, methionine at position 227 to valine, methionine at position 227 to alanine, methionine at position 227 to arginine, methionine at position 227 to serine, glutamine at position 394 to arginine, glutamine at position 394 to valine, glutamine at position 394 to glutamic acid, glutamine at position 394 to asparagine, arginine at position 396 to valine, arginine at position 396 to aspartic acid, arginine at position 396 to threonine, and a mutant in which leucine at position 316 to isoleucine at position 327 are truncated.
[0059] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.
[0060] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.
Claims
1. A 4-hydroxybutyraldehyde dehydrogenase mutant, characterized in that: The amino acid sequence shown in SEQ ID NO. 1 is subjected to single point mutation or multi-point combined mutation at the following sites: Methionine 227 was mutated to valine; Methionine at position 227 was mutated to alanine; Methionine 227 mutated to arginine; Methionine 227 was mutated to serine; Glutamine at position 394 was mutated to arginine; Glutamine at position 394 was mutated to valine; Glutamine at position 394 was mutated to glutamic acid; Glutamine at position 394 was mutated to asparagine; Arginine at position 396 was mutated to valine; Arginine at position 396 was mutated to aspartic acid; Arginine at position 396 was mutated to threonine; The residues were truncated from leucine 316 to isoleucine 327.
2. The gene encoding the 4-hydroxybutyraldehyde dehydrogenase mutant according to claim 1.
3. An expression vector comprising the encoding gene according to claim 2.
4. The expression vector according to claim 3, wherein: The expression vector is a plasmid, phage or virus vector. A cloning vector comprising the encoding gene according to claim 2 . A host cell comprising the 4-hydroxybutyraldehyde dehydrogenase mutant according to claim 1 or the encoding gene according to claim 2.
7. The host cell according to claim 6, wherein: The cell is Escherichia coli, wherein the gene encoding D-lactate dehydrogenase is knocked out. ldhA Gene encoding alcohol dehydrogenase adhE Gene.
8. Use of the 4-hydroxybutyraldehyde dehydrogenase mutant according to claim 1 in producing 1,4-butanediol.
9. Use of the host cell according to claim 6 in producing 1,4-butanediol.
10. The use according to claim 9, characterized in that: The application method comprises: inoculating and culturing the host cells, and adding 4-hydroxybutyric acid during the culturing process.