Premature senility mouse and application thereof
By introducing two-site mutations into the mouse Lmna gene, HGPSplus mice were prepared, which solved the problem of short lifespan of existing models, achieving a longer study window and better drug evaluation effect.
Patent Information
- Application Number
- CN202510940468.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-08
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-07-08
AI Technical Summary
The existing Hutchinson-Gilford mouse model has an aging phenotype around one month after birth, with a lifespan of only 3 months. The study window is short, making it difficult to observe the effect and reproduction of drugs in a short time, limiting the practicality of aging research.
The mouse Lmna gene was introduced into the mouse, including base mutations at positions 1811 and 1827, and HGPSplus mice were prepared, so that they had an aging phenotype about 3 months after birth, with a lifespan of 5-12 months, extending the study window.
The prolonged lifespan and study window of premature aging mice, provided longer time to observe the aging process and evaluate the effectiveness of anti-aging drugs, and increased the practicality of the model.
Smart Images

Figure CN120442640A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a progeria mouse and an application thereof. Background Art
[0002] Aging is a universal and irreversible biological process, the gradual deterioration of an organism's structure and function over time, ultimately leading to death. The aging process involves the accumulation of cellular damage, the decline of organ function, and a weakened immune system. It is a major risk factor for many common diseases, including cardiovascular disease, neurodegenerative diseases, osteoporosis, metabolic disorders, and cancer.
[0003] The mechanism of aging is particularly complex and is influenced by many factors such as genetics, environment, and lifestyle. Currently, there are many theories about the causes of aging, such as the genetic theory at the individual level, the telomere shortening, heterochromatin loss, and mitochondrial damage theory at the cellular level, and the DNA damage and free radical oxidative stress theory at the molecular level. However, the fundamental mechanism causing aging is still unclear, and the ways and methods to delay aging still need further exploration. Compared with in vitro cell culture, the biological processes such as the interaction of multiple organs and multiple cell types in tissues, organs, and living organisms, the exchange of substances, and the response to external signals are more complex. Therefore, studying the mechanism of aging at the individual level, exploring the changing patterns of the aging process, and developing anti-aging drugs are of great significance for a comprehensive understanding and effective intervention in aging.
[0004] Hutchinson-Gilford progeria syndrome (HGPS) is a rare genetic disorder with clinical phenotypes including small stature, weight loss, and a short lifespan, remarkably resembling natural aging. In normal individuals, A-type lamins (laminA / C) are produced by alternative splicing of the Lmna gene and are present in the nuclear lamina and throughout the nucleus, with high expression in multiple tissues. The C.1824C>T point mutation in exon 11 of the Lmna gene activates a cryptic splice site, ultimately resulting in the translation of an abnormal protein, progerin. Lacking a cleavage site for the endogenous protease Zmpste24, its farnesylation modification cannot be removed, resulting in its permanent anchoring to the nuclear membrane. In mouse models, the corresponding mutation occurs at position 1827, affecting amino acid 609 (G609G). Because HGPS progeria exhibits rapid and pronounced aging symptoms, it provides researchers with a unique window into the cellular and molecular changes that occur during aging over a relatively short period of time, making it an ideal model for aging research. In recent years, numerous studies have used HGPS progeria cell, tissue, and mouse models to simulate the natural aging process, achieving significant results. However, HGPS progeria mice begin to show aging phenotypes around one month after birth and have a lifespan of only three months, limiting their research window. Summary of the Invention
[0005] In response to the shortcomings of the existing technology, the present invention provides a progeria mouse with a double-site mutation, which develops an aging phenotype about 2 months after birth and has a lifespan of about 5-12 months. The window period available for research is extended, further increasing the practicality of the progeria mouse.
[0006] According to one aspect of the present invention, a nucleic acid molecule encoding Lmna is provided, wherein the 1811th and 1827th bases of the nucleic acid molecule are T, and the numbering of the bases corresponds to the numbering of the nucleotide sequence shown in SEQ ID NO: 1.
[0007] In some embodiments, the nucleic acid molecule comprises the following nucleotide sequence: gTgggagcccaggtgggT (SEQ ID NO: 5).
[0008] In some embodiments, the nucleic acid molecule comprises the following nucleotide sequence: agcctgctgacaaggctgccggtggaGTGGGAGCCCAGGTGGGTggatccatctcctctg (SEQ ID NO: 8).
[0009] In some embodiments, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO:9.
[0010] According to one aspect of the present invention, there is provided an Lmna mutant, wherein, relative to wild-type Lmna, the alanine A at position 604 of the mutant is mutated to valine V.
[0011] In some embodiments, the wild-type Lmna has the amino acid sequence shown in SEQ ID NO: 2.
[0012] According to another aspect of the present invention, a tissue, body fluid, cell or its fragment or extract of a progeria mouse is provided, wherein the tissue, body fluid, cell or its fragment or extract comprises the nucleic acid molecule of the present invention.
[0013] In some embodiments, the cell or tissue is incapable of developing into an animal, and the cell does not include a germ cell.
[0014] In some embodiments, the lifespan of the progeria mouse is greater than 3 months, preferably greater than 4 months, and more preferably 5-12 months.
[0015] In some embodiments, the Lmna of the progeria mouse has A604V and G609G mutations compared to wild-type mice.
[0016] In some embodiments, the Lmna of the wild-type mouse has the amino acid sequence shown in SEQ ID NO: 2.
[0017] According to another aspect of the present invention, there is provided the use of the nucleic acid molecule, the mutant, the premature aging mouse prepared by the method, the tissue, the body fluid, the cell or its lysate or its extract of the present invention in the construction of a premature aging mouse model, the study of the aging mechanism, and the screening and / or evaluation of drugs for aging diseases.
[0018] In some embodiments, the aging diseases include one or more of progeria, arteriosclerosis, myocardial infarction, stroke, lipodystrophy, hair loss, osteoporosis, chronic inflammation, cardiac fibrosis, liver fibrosis, pulmonary fibrosis, renal fibrosis or spleen fibrosis.
[0019] The premature aging mouse of the present invention shows aging phenotypes at about 3 months after birth, and its lifespan can reach about 5 - 12 months, which extends the window period for research and increases the practicality of the premature aging mouse. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Shows the position information of the identification primers of the present invention.
[0021] Figure 2 Shows the gel images of the PCR identification results of the tails of different mice of the present invention.
[0022] Figure 3 Shows the sequencing results of the double-site mutant heterozygous mice of the present invention, in which the base C<T at position 1827 is homozygous mutant and the base C<T at position 1811 is heterozygous mutant.
[0023] Figure 4 Shows the sequencing results of the double-site mutant homozygous mice of the present invention, in which the base C<T at position 1827 is homozygous mutant and the base C<T at position 1811 is homozygous mutant.
[0024] Figure 5 Shows the double-site mutant heterozygous mice (HGPS
[0027] , Figure 7 , , Figure 8 , ,
[0026] ), double-site mutant homozygous mice (HGPS plus / plus ), and the survival curves of the single-site mutant homozygous mice.
[0025] Figure 6 Shows the photo of the 3-month-old premature aging mouse of the present invention.
[0026] Figure 7 Shows the body size difference of the 3-month-old premature aging mouse of the present invention.
[0027] Figure 8 Shows the HGPS of the present inventionplus Transcriptome sequencing results of the heart tissue of premature aging mice.
[0028] Figure 9 Shows the HGPS of the present invention plus Transcriptome sequencing results of the brain tissue of premature aging mice.
[0029] Figure 10 Shows the HGPS of the present invention plus Change in the ratio of normal splicing to abnormal splicing of exon 11 of premature aging mice.
[0030] Figure 11 Shows the HGPS of the present invention plus / plus SA-βgal staining results of senescence markers in premature aging mice. Detailed implementation manners
[0031] An animal aging model refers to an animal model that can simulate aging phenotypes similar to those of humans and whose underlying mechanisms are somewhat conserved with humans. It is a commonly used method for studying aging. Among them, mice have the advantages of a short lifespan, being easy to raise and breed, and having 99% of their genes homologous to humans, making them a commonly used animal model in aging research.
[0032] Aging models mainly include natural aging and induced premature aging. Although the natural aging model is closest to the human aging process, its relatively long animal feeding cycle, poor health status, and large individual differences limit its wide application in aging research. Progeria syndrome is a rare genetic disease in which patients show accelerated aging, premature death, etc. For example, Hutchinson-Gilford progeria syndrome (HGPS) is an autosomal dominant disease that can cause accelerated aging and simultaneously develop aging-related diseases such as heart disease, atherosclerosis, osteoporosis, and diabetes. HGPS patients will show clinical manifestations such as short stature, low weight, graying and falling hair, and thin and wrinkled skin in adolescence, which is very similar to physiological aging. HGPS has been widely studied in the field of aging and is recognized as one of the best disease models for studying human physiological aging.
[0033] Classic HGPS is caused by a Lmna C>T mutation at the 1824th base of the Lmna gene, which is located in exon 11 of the Lmna150 bases after the mRNA deletion mutation site. This abnormal mRNA will then be translated into a truncated lamin A protein with a deletion of nearly 50 amino acids at the C-terminus, called progerin. Progerin cannot be cleaved by the protease ZMPSTE24 and cannot form a mature Lamin A protein, which in turn leads to various phenotypes such as abnormal nuclear lamina structure, loss of heterochromatin, and DNA damage.
[0034] So far, the treatment of HGPS patients has been limited to the alleviation of phenotypes and the prevention of secondary complications, and there is no truly definitive cure. HGPS itself is a rare genetic disease, and the sources of clinical samples are very limited, increasing the difficulty of its research work. In 2011, Osorio et al. obtained the first HGPS mouse model by introducing a C>T mutation at position 1827 (corresponding to position 1824 of the human gene). Homozygous mutant mice showed phenotypes such as a short lifespan (about 12 weeks), dwarfism, and weight loss, which are very similar to the clinical phenotypes of HGPS patients and are ideal models for the study of HGPS diseases. However, the mice of this model age rapidly after puberty, the research window period is short, the effects of some drugs cannot be exerted or produce phenotypes in a short time, and it is difficult to breed due to rapid aging, which imposes certain limitations on the study of aging or premature aging diseases. Lmna Position 1827 (corresponding to Lmna position 1824 of the human gene) introduced a C>T mutation, and the first HGPS mouse model was obtained. Homozygous mutant mice showed phenotypes such as a short lifespan (about 12 weeks), dwarfism, and weight loss, which are very similar to the clinical phenotypes of HGPS patients and are ideal models for the study of HGPS diseases. However, the mice of this model age rapidly after puberty, the research window period is short, the effects of some drugs cannot be exerted or produce phenotypes in a short time, and it is difficult to breed due to rapid aging, which imposes certain limitations on the study of aging or premature aging diseases.
[0035] During the research process, the inventors screened mice with double-site mutations in the Lmna gene. In addition to the C>T mutation at position 182 seven, these mice also have a C>T mutation at position 1811. The Lmna double-site mutant mice of the present invention (named HGPS plus mice) showed aging phenotypes around 3 months after birth, and their lifespan could reach about 5 - 12 months, extending the research window period available.
[0036] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with the drawings and embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present invention. Such structures and technologies have also been described in many publications.
[0037] definition Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.
[0038] Unless the context clearly dictates otherwise, as used herein, the expressions "a" and "an" include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.
[0039] In the present invention, the term "about" means a range of ±20% of the value thereafter. In some embodiments, the term "about" means a range of ±10% of the value thereafter. In some embodiments, the term "about" means a range of ±5% of the value thereafter.
[0040] Progeria syndromes are rare genetic diseases that cause patients to experience accelerated aging and premature death. For example, Hutchinson-Gilford progeria syndrome (HGPS) is an autosomal dominant disease that leads to accelerated aging and the development of age-related diseases such as heart disease, atherosclerosis, osteoporosis, and diabetes.
[0041] The LMNA gene encodes lamin A / C, a major component of the nuclear lamina and a nuclear envelope protein involved in controlling nuclear elasticity and deformability, cell cycle regulation, DNA transcription and expression, connecting the nuclear pore complex, nuclear stability, and signal transduction. In humans, mutations in this gene may lead to the following diseases: Emery-Dreifuss muscular dystrophy, familial focal lipodystrophy, limb-girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria.
[0042] "Percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical, matched positions shared by the sequences over the comparison window, taking into account any additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matched position is any position where the same nucleotide or amino acid is present in both the target and reference sequences. Since gaps are not nucleotides or amino acids, gaps present in the target sequence are not counted. Similarly, since target sequence nucleotides or amino acids are counted and nucleotides or amino acids from the reference sequence are not counted, gaps present in the reference sequence are not counted.
[0043] Percent sequence identity can be calculated by determining the number of positions at which the identical amino acid residue or nucleic acid base occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percent sequence identity. Comparison of sequences and determination of percent sequence identity between two sequences can be accomplished using software that is readily available for online use and download. Suitable software programs are available from various sources for alignment of protein and nucleotide sequences. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST suite of programs available on the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm to compare two sequences. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.
[0044] In the present invention, the term "nucleic acid", "gene" or "nucleotide" sequence refers to any form of RNA or DNA molecule having more than one nucleotide, including single-stranded, double-stranded, oligonucleotide or polynucleotide.
[0045] In the present invention, the term "exon" refers to both the DNA sequence within a gene and the corresponding sequence in the RNA transcript.
[0046] The following examples and accompanying drawings are provided to facilitate understanding of the present invention. However, it should be understood that these examples and accompanying drawings are intended to illustrate the present invention only and are not intended to limit the present invention in any way. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and variations may be made without departing from the spirit of the present invention.
[0047] The reagents and / or kits used in the following examples are commercially available or can be synthesized by known methods.
[0048] Example
[0049] Example 1 Screening and identification of progeria mice
[0050] The inventors studied the effect of different strains of HGPS mice (C57B / 6J-Lamin A Tm1 During the breeding process of / MC, Mingxun Biotechnology, it was found that a group of mice did not die around 100 days old, but died around six months to one year. These mice with extended age were identified and bred, and named HGPS plusMouse.
[0051] 1.1 Mouse genotype identification: When the offspring mice bred reached two weeks of age, about 0.5 cm of mouse toe was cut and placed at the bottom of a 200 μL PCR tube. 100 μL of lysis buffer (VIAGEN DirectPCR cat#102-T) containing 1% proteinase K (V900887 Sigma-Aldrich) was added, and lysed at 55 °C for 8 h, then treated at 85 °C for 45 min, and then centrifuged at 500 g for 5 min, and the obtained supernatant was identified.
[0052] Using PCR technology, the lysed mouse toe was used as a template to perform PCR on the Lmna gene of the mouse (SEQ ID NO: 1, and the encoded amino acid sequence is shown as SEQ ID NO: 2). PCR was carried out using Phanta Max Super-Fidelity DNA Polymerase (Novoprotein) according to the manufacturer's instructions. <0000 / 159> The sequences of the PCR identification primers are as follows: LMNA-seqF: agtcagtcccaaactcgctg (SEQ ID NO: 3) LMNA-seqR: caagagggactgcaaggagg (SEQ ID NO: 4) The positions of the PCR identification primers are as Figure 1 shown by the green arrows.
[0054] Different HGPS plus The results of mouse tail PCR identification are shown in [[ID=?]]<00?0166> After PCR, the correct bands were sequenced.
[0055] Exemplary results are as Figure 3 and Figure 4 shown. In HGPS plus mice, the Lmna gene has a two-site mutation. In heterozygous mice with two-site mutations (HGPS plus / - ) and homozygous mice with two-site mutations (HGPS plus / plus ), in addition to having a C<T mutation at the 1827th base, there is also a C<T mutation at the 1811th base, that is, having the following nucleotide sequence: gTgggagcccaggtgggT (SEQ ID NO: 5), and the corresponding amino acid sequence is mutated from AGAQVG (SEQ ID NO: 6) to VGAQVG (SEQ ID NO: 7); or having the following nucleotide sequence: agcctgctgacaaggctgccggtggaGTGGGAGCCCAGGTGGGTggatccatctcctctg (SEQ ID NO: 8).
[0056] The nucleotide sequence of the Lmna gene of wild-type mice is shown in SEQ ID NO: 1 as follows:
[0057] The amino acid sequence encoded by the Lmna gene of wild-type mice is shown in SEQ ID NO: 2: .
[0058] Among them, HGPS plus Mouse Lmna The nucleotide sequence of the gene is shown in SEQ ID NO: 9:
[0059] Among them, HGPS plus Mouse Lmna The amino acid sequence encoded by the gene is shown in SEQ ID NO: 10, with the bold parts indicating mutation points: .
[0060] Example 2 Death curves of mice with double-site mutations and mice homozygous for single-site mutations The double-site mutant mice (HGPS) obtained in Example 1 were observed weekly. plus The offspring of mice bred with single-site mutation mice (HGPS) showed symptoms such as white hair, rickets, and small body size, indicating that the corresponding mice began to show aging phenotypes.
[0061] In addition, the double-site mutation heterozygous mice (HGPS) obtained in Example 1 were recorded. plus / -), homozygous double-site mutant mice (HGPS plus / plus ), and the death times of homozygous single-site mutant mice (HGPS) are shown in Tables 1 - 3 below. The death curves plotted based on Tables 1 - 3 are as shown in Figure 5 .
[0062] The results show that homozygous single-site mutant mice began to show senescence phenotypes around 1 month after birth and had a lifespan of only 3 months. The heterozygous double-site mutant mice prepared in the present invention showed senescence phenotypes around 3 months after birth and had a lifespan of about 6 months. The homozygous double-site mutant mice showed senescence phenotypes around 3 months after birth and had a lifespan of about 10 months.
[0063] Table 1: HGPS plus Death time of heterozygous double-site mutant mice Mouse number Date of birth Time of death Lifespan (days) 1 24.04.20 24.10.28 192 2 24.04.20 24.10.15 179 3 24.04.20 24.10.16 180 4 24.04.29 24.10.14 179 5 24.04.29 24.10.29 194 6 24.04.15 24.10.29 199 7 24.04.15 24.10.05 185 8 24.04.15 24.10.15 195 9 24.04.15 24.10.14 194 10 24.04.15 24.10.15 195 11 24.04.15 24.10.05 185 12 24.04.15 24.10.15 195 13 24.04.15 24.10.14 194 14 24.04.15 24.10.29 159 15 24.05.30 24.10.30 158 16 24.05.24 24.10.22 158 17 24.05.30 24.10.22 150 18 24.05.30 24.10.15 133 19 24.05.30 24.10.15 133 Table 2: HGPS plus Death time of homozygous double-site mutant mice Mouse number Date of birth Time of death Lifespan (days) 1 24.05.27 25.03.11 288 2 24.04.15 25.02.14 305 3 24.05.24 25.03.07 287 4 24.05.24 25.03.11 288 5 24.04.2 25.03.01 333 6 24.04.20 25.02.11 300 7 24.04.20 25.02.03 290 8 24.04.20 25.02.03 290 9 24.05.24 25.02.05 257 10 24.05.18 25.02.21 279 Table 3: Death time of homozygous single-site mutant mice of HGPS Mouse number Date of birth Time of death Lifespan (days) 1 24.05.05 24.08.08 95 2 24.05.18 24.07.04 47 3 24.05.18 24.08.24 98 4 24.06.15 24.09.06 83 5 24.10.30 24.02.17 110 6 24.03.03 24.05.20 78 7 24.03.03 24.05.28 86 8 24.03.03 24.06.05 94 9 24.05.17 24.07.17 61 10 24.05.20 24.08.24 96 11 24.05.20 24.08.15 87 12 24.05.20 24.09.23 126 13 24.10.30 24.02.23 116 14 24.11.03 24.02.16 105 Example 3 Identification of senescence phenotypes in mice The prematurely senescent mice with double-site mutations obtained in Example 1 at 3 months old had a grayish-white coat color (HGPS plus / - , Figure 6 ), and their body size was significantly smaller than that of wild-type mice (HGPS plus / plus , Figure 7 ), indicating that the present application successfully obtained prematurely senescent mice with senescence phenotypes.
[0064] Based on the results of body size and death time, it can be seen that the prematurely senescent mice with double-site mutations prepared in the present invention have a slower senescence process and a longer lifespan than the prematurely senescent mice with single-site mutations. This indicates that the new mutation site c.1811 C<T discovered in the present invention has the effect of saving or improving the prematurely senescent phenotypes caused by 1827 C<T.
[0065] Example 4 Transcriptome sequencing Using the RNA-seq method, quantitative analysis was performed on the normal splicing and alternative splicing of the Lmna gene. Different isoforms were identified by comparing the differences in reads counts on the exons of the Lmna gene.
[0066] Select WT (C57BL / 6J), HGPS, HGPS at 3 months old plus / plusThree mice of each type were dissected and heart and brain tissues were obtained for RNA-seq library construction and sequencing. The transcriptome was constructed using the NR605 kit from Novozymes, and the constructed library was then subjected to high-throughput sequencing using the Illumina NovaSeq platform.
[0067] The reads obtained by sequencing were aligned to the Lmna genome, and the splicing pattern at exon 11 was observed. Since the abnormal splicing caused by the HGPS mutation occurs in exons 11-12 of Lmna, the total reads (including normal splicing and mutant splicing, exAll), normal splicing reads (exWT), and mutant splicing reads (exHGPS) spanning Lmna exons 11-12 in the RNA-seq data were quantified, and then the ratios of normal splicing to mutant splicing (exWT / exAll, exHGPS / exAll) were calculated.
[0068] The results showed that HGPS plus Compared with HGPS mice, the normal splicing to abnormal splicing ratio (CS / AS) of exon 11 increased in HGPS mice, from 1.18 to 4.3 in the heart ( Figure 8 ), and in the brain from 0.64 to 0.88 ( Figure 9 ). Compared with brain tissue, Lmna has a higher expression level in the heart; HGPS plus Compared with HGPS samples, the samples all have obvious normal shearing and filling characteristics ( Figure 10 ).
[0069] Example 5 Staining of the aging marker SA-βgal 12-week-old WT (C57BL / 6J), HGPS, and HGPS plus / plus Three types of mice were dissected and brain tissues were obtained for staining of the aging marker SA-βgal; Experimental steps: Obtain a biopsy specimen and briefly rinse with PBS to remove blood. Place the specimen in OCT compound and flash-freeze with isopentane and liquid nitrogen. Cut the frozen specimen into 4-μm sections. Fix the sections with 1% formaldehyde in PBS for 1 minute at room temperature. Wash the sections three times with PBS. Soak the sections in SA-β-gal staining solution overnight and counterstain with eosin. Observe the blue precipitate using bright-field microscopy.
[0070] The SA-β-gal staining solution contained 1 mg / mL X-gal, 1× citric acid / sodium phosphate buffer (pH 6.0), 5 mM potassium ferricyanide chloride, 5 mM potassium ferrocyanide chloride, 150 mM NaCl, and 2 mM MgCl2.
[0071] The staining results are as follows Figure 11 As shown, the results show that at the same age, HGPS plus The SA-βgal expression of the mice was significantly lower than that of HGPS mice of the same age, and close to that of WT mice of the same age.
[0072] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.
Claims
1. A nucleic acid molecule encoding Lmna, characterized in that The 1811th and 1827th bases of the nucleic acid molecule are T, The base numbers correspond to the nucleotide sequence numbers shown in SEQ ID NO:
1.
2. The nucleic acid molecule according to claim 1, characterized in that The nucleic acid molecule comprises the following nucleotide sequence: gTggggagcccaggtgggT (SEQ ID NO: 5).
3. The nucleic acid molecule according to claim 1, characterized in that The nucleic acid molecule comprises the following nucleotide sequence: agcctgctgacaaggctgccggtggaGTGGGAGCCCAGGTGGGTggatccatctcctctg (SEQ ID NO: 8); and / or The nucleic acid molecule includes the nucleotide sequence shown in SEQ ID NO:
9.
4. A LMNA mutant, characterized in that Compared with wild-type LMNA, the alanine A at position 604 of the mutant is mutated to valine V.
5. The LMNA mutant according to claim 4, characterized in that The wild-type LMNA has the amino acid sequence shown in SEQ ID NO:
2.
6. A tissue, body fluid, cell or fragment thereof or extract thereof of a progeria mouse, characterized in that: The tissue, body fluid, cell, or fragment thereof or extract thereof comprises the nucleic acid molecule according to any one of claims 1 to 3.
7. The tissue, body fluid, cell, or fragment thereof or extract thereof according to claim 6, characterized in that: The cells or tissues are incapable of developing into an animal individual, and the cells do not include reproductive cells.
8. The tissue, body fluid, cell, or fragment thereof or extract thereof according to claim 6, characterized in that: The lifespan of the progeria mice is greater than 3 months.
9. The tissue, body fluid, cell, or fragment thereof or extract thereof according to claim 6, characterized in that: The lifespan of the progeria mice is 5-12 months.
10. The tissue, body fluid, cell, or fragment thereof or extract thereof according to claim 6, characterized in that: Compared with wild-type mice, the Lmna of the progeria mice has mutations A604V and G609G; The LMNA of the wild-type mouse has the amino acid sequence shown in SEQ ID NO:
2.
11. Use of the nucleic acid molecule according to any one of claims 1 to 3, the mutant according to claim 4 or 5, or the tissue, body fluid, cell, or fragment thereof, or extract thereof according to any one of claims 6 to 10 in constructing a progeria mouse model, studying aging mechanisms, or screening and / or evaluating drugs for aging diseases.
12. The use according to claim 11, characterized in that The aging diseases include one or more of progeria, vascular sclerosis, myocardial infarction, stroke, lipodystrophy, alopecia, osteoporosis, chronic inflammation, cardiac fibrosis, liver fibrosis, pulmonary fibrosis, renal fibrosis or spleen fibrosis.
Citation Information
Patent Citations
Construction method and application of senescence mouse model
CN115181755A
Method for gene knockout of mouse and constructed LMNA gene knockout mouse model
CN116497029A
Mouse LMNA gene point mutation targeting composition and mouse model construction method
CN118109519A
LMNA gene and its involvement in hutchinson-gilford progeria syndrome (HGPS) and arteriosclerosis
US20050059071A1
Methods of treating and diagnosing laminopathy
US20090137479A1