Application of banana MaSCL8 gene in regulation and control of fruit ripening

By overexpressing the banana MaSCL8 gene and activating starch and cell wall degradation genes, the problem of rapid softening during banana fruit ripening is solved, and the fruit is matured early and the hardness is reduced, the shelf life is extended, and post-harvest losses are reduced.

CN120442647APending Publication Date: 2025-08-08POMOLOGY RES INST GUANGDONG ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510582013.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

During the ripening process of banana fruits, ethylene treatment leads to rapid yellowing and softening, short shelf life, and high post-harvest loss rate. The existing technology fails to effectively analyze the transcriptional regulation mechanism of cell wall and starch degradation genes, affecting the fruit quality and shelf life.

Method used

Overexpressing the banana MaSCL8 gene promotes fruit maturation. By activating starch and cell wall degradation genes, including SlAMY2, SlBAM1 and SlEXP1, improves starch degradation and cell wall modification, resulting in early ripening of fruits.

Benefits of technology

The fruit ripens early, the peak of ethylene release occurs early, the hardness decreases, prolongs the fruit storage and transportation period, reduces post-harvest losses, and improves the quality of banana fruit.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442647A_ABST
    Figure CN120442647A_ABST
Patent Text Reader

Abstract

The invention discloses application of a banana MaSCL8 gene in regulation and control of fruit ripening. The nucleotide sequence of the banana MaSCL8 gene is as shown in SEQ ID NO. 1. According to the invention, a MaSCL8 transcription factor is identified from banana fruits, and the gene is dominantly expressed in the fruits. Through overexpression of MaSCL8 in tomatoes and observation of tomato fruits, it is found that compared with a wild type, the tomato fruits of the overexpressed MaSCL8 strain are mature ahead of time, the color value and hardness of the fruits are rapidly reduced, and the ethylene yield has a peak value ahead of time. Meanwhile, the expression levels of starch degradation genes SlAMY2 and SlBAM1 and a cell wall modification gene SlEXP1 in fruits of the overexpressed MaSCL8 strain are obviously improved compared with those of wild fruits. The research results reveal that the MaSCL8 promotes fruit ripening by activating starch and cell wall degradation genes, the action mechanism of the MaSCL8 participating in regulation and control of fruit ripening is defined, and the gene can be used as a candidate gene for improving banana fruit quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and particularly relates to application of banana MaSCL8 gene in regulating fruit ripening. Background Art

[0002] Bananas are one of the most traded and consumed fruits in the world and are widely grown in tropical and subtropical regions. Bananas are popular among consumers for their aromatic flavor and rich nutritional value. As a typical respiratory climacteric fruit, the initiation of fruit ripening depends on the action of ethylene. However, after ethylene treatment, bananas usually turn yellow and soften rapidly, resulting in a shortened shelf life and adversely affecting the quality and commercial value of banana fruits. At the same time, fruit softening and ripening during transportation and sales can lead to post-harvest banana losses of up to 25% to 50% (Al-Dairi et al., 2023). Therefore, studying the molecular mechanisms of fruit ripening and softening is of great significance for improving banana fruit quality and extending its shelf life.

[0003] Fruit ripening is a complex and finely coordinated process involving a series of physiological and metabolic changes, including ethylene synthesis, fruit softening, aroma formation, and pigment metabolism (Tucker et al., 2017). Generally, cell wall and starch degradation are closely associated with fruit softening and ripening (Song et al., 2023). During fruit ripening, the integrity of the cell wall structure is disrupted, resulting in reduced cell wall adhesion, enlarged intercellular spaces, and decreased cell wall thickness and strength (Peng et al., 2022). Changes in cell wall structure are regulated by the coordinated actions of multiple cell wall-modifying enzymes, including pectate lyase (PL), polygalacturonase (PG), pectin methylesterase (PME), β-galactosidase (β-Gal), xyloglucan endotransglucosylase / hydrolase (XET / XTH), and expansin (EXP) (Peng et al., 2022; Shi et al., 2022). Among them, EXPs can non-enzymatically weaken the chemical bonds between cell wall polysaccharides, thereby promoting cell expansion and reducing cell wall strength (Cosgrove, 2015; Shi et al., 2022). Furthermore, EXP members play a key role in common fruit softening mechanisms. For example, silencing the LeEXP1 gene increases tomato fruit firmness and delays ripening, while simultaneous silencing of both LePG and LeEXP1 further increases fruit firmness and inhibits fruit softening (Brummell et al., 2002; Powell et al., 2003). Similarly, simultaneous knockout of the SlExp1 and SlCel2 genes increases tomato fruit firmness, while simultaneous overexpression of these two genes promotes fruit softening (Su et al., 2024). Furthermore, starch degradation contributes to fruit ripening and softening, particularly in starch-rich fruits such as bananas (Miao et al., 2024). During fruit ripening, starch undergoes a complex series of regulatory mechanisms before being converted into soluble sugars, which influence the fruit's sweetness and taste. Starch-degrading enzymes primarily include phosphohydrolases and hydrolases. During starch degradation, glucan water dikinase (GWD) and phosphoglucan water dikinase (PWD) phosphorylate starch granules, followed by dephosphorylation by phosphoglucan phosphatase, thereby disrupting the starch granule structure and increasing starch solubility, facilitating starch recognition by starch hydrolases (Cordenunsi-Lysenko et al., 2019; Miao et al., 2024; Li et al., 2025). Finally, starch hydrolases, such as α-amylase (AMY), β-amylase (BAM), isoamylase (ISA), and limit dextrinase (LDA), work synergistically to break down starch into glucose or maltose (Li et al., 2025).Regulating the expression of these cell wall and starch degradation genes influences the ripening and softening process of bananas. While the link between cell wall and starch degradation genes and fruit ripening and softening is widely recognized, the transcriptional regulation mechanisms of these genes remain unclear. Therefore, elucidating the regulatory mechanisms of cell wall and starch degradation genes in banana fruit could provide new theoretical basis for improving banana fruit quality and extending its shelf life. Summary of the Invention

[0004] In view of the above-mentioned prior art, the object of the present invention is to provide an application of the banana MaSCL8 gene in regulating fruit ripening.

[0005] Preferably, the banana MaSCL8 gene is overexpressed for use in promoting fruit ripening, and the nucleotide sequence of the banana MaSCL8 gene is shown in SEQ ID NO.1.

[0006] The fruit can be various fruits, such as banana or tomato.

[0007] Preferably, overexpression of the banana MaSCL8 gene promotes the fruit to exhibit an earlier ripening phenotype, or mutation of the MaSCL8 gene in the fruit delays fruit ripening, prolongs the post-harvest storage and transportation period of the fruit, and reduces post-harvest losses.

[0008] Preferably, overexpression of the banana MaSCL8 gene promotes tomato fruit to turn from green to red earlier, decrease firmness earlier, and have an earlier peak in ethylene release.

[0009] The present invention also provides a method for promoting fruit ripening, which comprises overexpressing the banana MaSCL8 gene in a plant to promote fruit ripening. The nucleotide sequence of the banana MaSCL8 gene is shown in SEQ ID NO.1.

[0010] Preferably, the plant is banana or tomato.

[0011] The present invention also provides a banana MaSCL8 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] The present invention also provides a banana MaSCL8 protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0013] At the same time, because the MaSCL8 gene is dominantly expressed in bananas, mutating the MaSCL8 gene in bananas may delay fruit ripening, extend the post-harvest storage and transportation period of the fruit, and reduce post-harvest losses.

[0014] The present invention identified a MaSCL8 transcription factor from banana fruit, which is dominantly expressed in the fruit ( Figure 1MaSCL8 is upregulated during banana ripening and is induced by ethylene, but its expression is inhibited by 1-MCP ( Figure 1 As a transcription factor, MaSCL8 should be localized in the cell nucleus. MaSCL8 was then fused with GFP and expressed in tobacco leaves. It was found that the MaSCL8-GFP signal only appeared in the cell nucleus, consistent with the position of the nuclear marker, indicating that MaSCL8 is localized in the cell nucleus ( Figure 2 In addition, the transcriptional activity of MaSCL8 was detected in rice protoplasts. The results showed that MaSCL8 could increase the expression of LUC reporter gene, which is similar to the strong activator VP16. This shows that MaSCL8 can act as a transcriptional activator to regulate the expression of target genes ( Figure 2 At the same time, the dual-luciferase assay also found that MaSCL8 can activate the expression of MaAMY3, MaBAM9b, MaEXPA15, and MaEXP21 genes ( Figure 3 Finally, MaSCL8 was overexpressed in tomatoes, and observation of tomato fruits revealed that compared with the wild type, the tomato fruits of the MaSCL8-overexpressing strain matured earlier, the fruit color and firmness decreased rapidly, and ethylene production peaked earlier ( Figure 4 and 6 At the same time, the expression levels of starch degradation genes SlAMY2 and SlBAM1 and cell wall modification gene SlEXP1 in the fruits of the overexpressing MaSCL8 strain were significantly higher than those in the wild-type fruits ( Figure 5 The above research results reveal that MaSCL8 promotes fruit ripening by activating starch and cell wall degradation genes, clarifying the mechanism by which MaSCL8 participates in regulating fruit ripening. This gene can be used as a candidate gene for improving banana fruit quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the identification of expression levels in different tissues (Figure a) and different treatments (Figure b);

[0016] Figure 2 is the subcellular localization (Figure a) and transcriptional activation (Figure b);

[0017] Figure 3 It is a dual luciferase assay to regulate target genes;

[0018] Figure 4 It is to identify and promote tomato ripening phenotype;

[0019] Figure 5 It is the detection of gene expression in tomatoes;

[0020] Figure 6 It is the measurement of tomato physiological indicators. DETAILED DESCRIPTION

[0021] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0022] Example 1:

[0023] 1. Obtaining the MaSCL8 gene

[0024] The present invention cloned the MaSCL8 gene using bioinformatics combined with PCR amplification. Specifically, the gene ID for MaSCL8, Ma05_g16130, was searched in the banana genome database (http: / / banana-genome-hub.southgreen.fr / ). Using banana fruit cDNA as a template, primers (F: ATGGCGTCTGGGTTTCCCGTG; R: CTAACGCCCACGCGGAGGCGACTG) were designed based on the nucleotide sequence of MaSCL8. PCR amplification was performed to obtain the MaSCL8 cDNA sequence. The gene is 1758 base pairs long and encodes 585 amino acids.

[0025] The nucleotide sequence of MaSCL8 (SEQ ID NO. 1):

[0026]

[0027] MaSCL8 amino acid sequence (SEQ ID NO.2):

[0028] MASGFPVRELGFGVQIPMPTRAEAGSGGLLKRSLTEMERQQQQQQMQMQHAHFLRSVRQRTLLAPHASSHLSPPLLPVVLSSGSSSSVSANLTASGLAQPQEHSSVPQAAGTGVERMRDRLQELERRLLLDEEEEEEEGEVSASSSAVTTAEWSDAMHKIITPQAPVPTPLSSSPTSSSSSTVSSSVSCSPPSTSTATVAAASSSRQMLLDTAAAIADGNLETATANLAVLNRVANSRGDAEQRLTAMMVGALLSRLNPAQAGSTSLPIAALCSGEHFAAAQMLYELSPCFKLGLVAANLAILEATKDQSMIHILDFSLGQGGQYAALLHVLAERHRFQPAVCPPALRITVVADPSFPFTNPNTSGNLRAVGDRIEKLAERAGLEVRFSVVHRRAAELDASTLGCQPGEALAVNLAFALSRVPDESVSPANPRDELLRRVRALRPRVVALVEQDINTSTAAFAGRFAEACAHYGALLESLDATVNRDSAERARVEAGLARRAVNSVAREGMDRVERCEVFGKWRARMRMAGFESVPLGRDVIEPVKARLASVAPDHGFTIREETGGHGLGFGWKGRAITVASAWR*

[0029] 2. Expression of MaSCL8 in different tissues and during banana fruit ripening

[0030] Banana (Musa acuminata AAA, Cavendish) fruits at the green-ripe stage (75-80% maturity) were divided into three treatment groups. 1: Untreated, naturally ripened group; 2: Ethylene-ripened group soaked in an 800 ppm ethephon solution for 1 minute; and 3: 1-MCP-treated group treated with 1 mg / L 1-MCP for 22 hours. The fruits were stored in a dark incubator at 22°C until fully ripe. Banana pulp was sampled at different time points. In addition, roots, corms, pseudostems, leaves, and immature fruit were collected. RNA was extracted from banana pulp and various tissues, and the expression of the MaSCL8 gene was detected using fluorescent quantitative PCR. The quantitative primers for MaSCL8 are as follows: MaSCL8-qF: AGGTCTTCGGCAAGTGGC; MaSCL8-qR: TGACCGCCGGTTTCTTCC.

[0031] Experimental results:

[0032] The results are as follows Figure 1 Figure 2 shows that the expression level of MaSCL8 in fruit is significantly higher than that in leaves, pseudostems, corms, and roots, indicating that MaSCL8 is predominantly expressed in fruit. Figure 2 shows the expression of MaSCL8 under ethylene ripening, natural ripening, and 1-MCP delayed ripening treatments. The results show that the expression level of MaSCL8 gradually increases as banana fruit ripens, and MaSCL8 expression is induced by ethylene.

[0033] 3. Subcellular Localization of MaSCL8

[0034] Primers were designed to amplify the sequence of MaSCL8 without the stop codon, and the sequence was ligated into the middle of the Age I site of the pEAQ-GFP vector by homologous recombination to obtain the pEAQ-MaSCL8-GFP recombinant vector.

[0035] Amplification primers are as follows:

[0036] pEAQ-MaSCL8-GFP-F:

[0037] ATTCTGCCCAAATTCGCGACCGGTATGGCGTCTGGGTTTCCCGTG;

[0038] pEAQ-MaSCL8-GFP-R:

[0039] CTTCTCCTTTGCTAGTCATACGCCACGCGGAGGCGACTG.

[0040] pEAQ-MaSCL8-GFP recombinant vector sequence:

[0041]

[0042] After sequencing was correct, the plasmids were extracted and pEAQ-GFP and pEAQ-MaSCL8-GFP were transformed into Agrobacterium competent cells GV3101. Agrobacterium monoclonal clones containing pEAQ-GFP and pEAQ-MaSCL8-GFP were picked and placed in 5 mL of LB liquid medium containing 50 mg / L kanamycin and cultured overnight at 28°C. The cells were collected and resuspended in infection solution (10 mM MES, 10 mM MgCl2, 150 μM AS) to an OD of 0. 600 The cells were incubated at room temperature for 2-3 hours and injected into the underside of Nicotiana benthamiana leaves. After 48 hours of incubation in the dark, the cells were observed and photographed using a Zeiss confocal microscope.

[0043] Experimental results:

[0044] The results are as follows Figure 2 As shown in a, the GFP signal of the Empty-GFP control group (transfected with pEAQ-GFP) filled the entire tobacco cell, while the GFP signal of the MaSCL8-GFP group coincided with the NLS-mcherry nuclear localization marker, indicating that MaSCL8 was localized in the cell nucleus.

[0045] 4. MaSCL8 transcriptional activity

[0046] The MaSCL8 gene was cloned and recombinantly ligated into the Not I and Pst I sites of the pBD-62SK vector (Puint Bio; ZT5637) to obtain the pBD-62SK-MaSCL8 recombinant effector vector.

[0047] The amplification primers for the MaSCL8 gene are:

[0048] pBD-62SK-MaSCL8-F:

[0049] CAGTTGACTGTATCGACGCGGCCGCTCATGGCGTCTGGGTTTCCCCGTG;

[0050] pBD-62SK-MaSCL8-R:

[0051] ATAAGCTTGATATCGAATTCCTGCAGCCTAACGCCACGCGGAGGCGAC.

[0052] After sequencing was confirmed, plasmids were extracted. The effector vectors pBD-62SK, pBD-62SK-MaSCL8, and pBD-62SK-VP16 (Puinte Biotechnology; ZT5695) were co-transfected with the reporter vector pGreenII 0800-5xGAL4-TATA-LUC (Puinte Biotechnology; ZT5615) into rice protoplasts for transient expression. After 16 hours of dark culture, the activities of LUC and REN were detected using a Dual-luciferase reporter assay kit (Promega).

[0053] Experimental results:

[0054] The results are as follows Figure 2 As shown in (b), the LUC / REN value of the pBD-62SK-MaSCL8 group was significantly increased compared with the pBD-62SK negative control group, which was similar to the result of the pBD-62SK-VP16 positive control, indicating that MaSCL8 has transcriptional activation activity in plants.

[0055] 5. Regulation of target genes by MaSCL8

[0056] The cloned MaSCL8 gene was ligated into the Sma I site of the effector vector pGreenII 0029 (Puint Bio; ZT5606) to obtain the 35S-MaSCL8 recombinant effector vector.

[0057] The primers for amplification of the MaSCL8 gene are:

[0058] 35S-MaSCL8-F: CTAGAACTAGTGGATCCCCCATGGCGTCTGGGTTTCCCCGTG;

[0059] 35S-MaSCL8-R:ATATCGAATTCCTGCAGCCCCTAACGCCACGCGGAGGCGAC.

[0060] Primers were designed to amplify the promoter sequences (approximately 2 Kb) of MaAMY3 (Ma08_g04100), MaBAM9b (Ma05_g07800), MaEXPA15 (Ma06_g12190), and MaEXP21 (Ma05_g07240) genes from banana fruit DNA and ligated into the Nco I site of the pGreenII 0800-LUC reporter vector by homologous recombination to obtain the pGreenII 0800-MaAMY3-LUC, pGreenII 0800-MaBAM9b-LUC, pGreenII 0800-MaEXPA15-LUC, and pGreenII0800-MaEXP21-LUC recombinant reporter vectors.

[0061] The pGreenII 0800-LUC vector sequence is available in GenBank: EU048863.1.

[0062] The amplification primers for MaAMY3, MaBAM9b, MaEXPA15, and MaEXP21 are:

[0063] MaAMY3-0800-F: CGCGGTGGAGATCGAATTCCTCCCATCCGCTTGTCGTTGTAGA;

[0064] MaAMY3-0800-R:GTTTTTGGCGTCTTCCATCGGCGAACGGTGGGGGAGAATCGA;

[0065] MaBAM9b-0800-F: CGCGGTGGAGATCGAATTCCTCCAAATTGGCCTTTGTATCATCGG;

[0066] MaBAM9b-0800-R:GTTTTTGGCGTCTTCCATCCTCTCAAATTATAGAAGATGT;

[0067] MaEXPA15-0800-F: CGCGGTGGAGATCGAATTCCAGACCTCGAAATTTGGCAGCACACCA;

[0068] MaEXPA15-0800-R:GTTTTTGGCGTCTTCCATTGGGACAATGAGTGTTGGCCAGGGGA;

[0069] MaEXP21-0800-F: CGCGGTGGAGATCGAATTCCTGGGGTGCTCCAAGGACTAAACCTTTC;

[0070] MaEXP21-0800-R:GTTTTTGGCGTCTCTCCATCGGAGCCGTGGGTGAGCAAGCA.

[0071] After sequencing was correct, the plasmids were extracted. The 35S-empty (pGreenII 0029) and 35S-MaSCL8 effector vectors were co-transfected with the recombinant reporter vector into rice protoplasts for transient expression. After 16 hours of dark culture, the activities of LUC and REN were detected using a Dual-luciferase reporter assay kit (Promega).

[0072] Experimental results:

[0073] The results are as follows Figure 3 As shown, compared with the 35S-empty negative control, the LUC / REN values of MaSCL8 co-expressed with the MaAMY3, MaBAM9b, MaEXPA15, and MaEXP21 promoters increased by 3.09-fold, 1.82-fold, 5.06-fold, and 3.33-fold, respectively, indicating that MaSCL8 can activate the transcription of these genes.

[0074] 6. Overexpression of MaSCL8 in Tomato

[0075] Primers were designed to amplify the MaSCL8 gene and ligated into the pBWA(V)HS-Flag vector to obtain the pBWA(V)HS-MaSCL8-Flag recombinant vector.

[0076] The pBWA(V)HS-MaSCL8-Flag vector sequence is as follows:

[0077]

[0078] Amplification primers for MaSCL8:

[0079] MaSCL8-OE-F: AACACGGGGGACTTTGCAACATGGCGTCTGGGTTTCCCGTG;

[0080] MaSCL8-OE-R: TGAAGACAGAGCTAGTTACATCATTTATCATCATCATCTTTATAATCAATGTCGTGGTCTT.

[0081] After sequencing is correct, the plasmid is extracted and transformed into Agrobacterium competent GV3101. Positive clones are picked and cultured in LB liquid culture until the bacterial liquid OD 600 The bacteria were collected by centrifugation and resuspended in infection solution (10 mM MES, 10 mM MgCl2, 150 μM AS) to make the OD 600 It is 0.6 and can be used for infection after standing in the dark for 2-3 hours.

[0082] Tomato seeds (Micro Tom) were surface sterilized with 75% alcohol for 1 minute, followed by 1% sodium hypochlorite for 15 minutes, rinsed 5-6 times with sterile water, and inoculated onto 1 / 2 MS solid medium. Once the seeds germinated and developed two cotyledons but no true leaves, they were ready for transformation. The cotyledons were removed from the ends, and the center portion was soaked in bacterial solution for 5 minutes. The cotyledons were removed and the excess bacterial solution was removed by aspiration. The cotyledons were then inverted and placed in co-cultivation medium (MS + 1 mg / L IAA + 1.75 mg / L Zeatin) and incubated in the dark for 2-3 days. The cells were then transferred to primary screening medium (MS + 1 mg / L IAA + 1.75 mg / L Zeatin + 10 mg / L hygromycin + 500 mg / L carbenicillin) and cultured at 25°C with 16 hours of light for approximately 2 weeks. The seedlings were then transferred to subculture selection medium (MS + 1 mg / L IAA + 1.75 mg / L ZT + 5 mg / L hygromycin + 500 mg / L carbenicillin) and cultured at 25°C with 16 hours of light for continued selection until adventitious buds emerged. Finally, resistant buds were transferred to rooting medium (MS + 5 mg / L hygromycin + 250 mg / L carbenicillin) at 25°C with 16 hours of light to induce adventitious roots. After rooting, the seedlings were hardened at room temperature for 7-10 days and then transplanted to soil for culture. Positive identification was performed when they reached an appropriate size. RNA and total protein were extracted from tomato fruits for quantitative PCR and Western blot analysis. Quantitative detection primers: MaSCL8-qF: AGGTCTTCGGCAAGTGGC; MaSCL8-qR: TGACCGCCGGTTTCTTCC.

[0083] When the plants reached the T2 generation, tomato fruit phenotypes were observed. Fruit color, firmness, and ethylene production were measured at 28, 34, 36, 38, and 40 days after flowering. Furthermore, quantitative PCR was performed on selected tomato genes, SlAMY2, SlBAM1, and SlEXP1, which are homologous to MaAMY3, MaBAM9b, MaEXPA15, and MaEXP21 in banana.

[0084] The quantitative detection primers are:

[0085] SlAMY2-qF:TTGATGGCTGGCGTTTCGAT;

[0086] SlAMY2-qR:GCCCCACCCCCATTTTGAAC;

[0087] SlBAM1-qF: GGAGAATGCATTGCCACGAT;

[0088] SlBAM1-qR:CGAAATGCTCTGCTTCCCTC;

[0089] SlEXP1-qF:ATCACAGCTACCAATTTCTGCC;

[0090] SlEXP1-qR:TGGGATCCTGCGATAAGTTACA.

[0091] Experimental results:

[0092] In order to analyze the role of MaSCL8 in regulating fruit ripening, MaSCL8 was successfully overexpressed in tomatoes, and finally three independent overexpression lines (MaSCL8-OE-1, 7, and 8) were obtained. Figure 4 As shown in a. By fluorescence quantitative PCR ( Figure 4 b) and Western blot ( Figure 4 c) Testing confirmed that MaSCL8 had been successfully overexpressed in tomatoes. Observation of tomato fruits at the same number of days after flowering revealed that the ripening phenotype of the fruits of the transgenic strain overexpressing MaSCL8 turned red earlier than that of the wild-type fruits ( Figure 4 a). In addition, the expression levels of starch and cell wall degradation-related genes in transgenic tomato fruits were analyzed. Figure 5 As shown in Figure 2, the transcript levels of SlAMY2, SlBAM1, and SlEXP1 in tomato fruits overexpressing MaSCL8 were significantly higher than those in wild type. Figure 6The results showed that the fruits of the MaSCL8-overexpressing strains exhibited an earlier ripening phenotype, with fruits turning from green to red earlier, firmness decreasing earlier, and ethylene release peaking earlier. These results suggest that MaSCL8 can promote tomato ripening by upregulating the expression levels of SlAMY2, SlBAM1, and SlEXP1.

Claims

1. Banana MaSCL8 gene, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

2. Banana MaSCL8 protein, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

3. Use of the banana MaSCL8 gene according to claim 1 in regulating fruit ripening.

4. The application according to claim 3, characterized in that The application of overexpression of banana MaSCL8 gene in promoting fruit ripening or mutation of MaSCL8 gene in fruit plays a role in delaying fruit ripening, extending the post-harvest storage and transportation period of the fruit, and reducing post-harvest losses.

5. The use according to claim 3, characterized in that The fruit is banana or tomato.

6. The use according to claim 3, characterized in that Overexpression of the banana MaSCL8 gene promotes an earlier ripening phenotype in the fruit.

7. The use according to claim 5, characterized in that Overexpression of the banana MaSCL8 gene promotes tomato fruits to turn from green to red earlier, reduce firmness earlier, and have an earlier peak in ethylene release.

8. A method for promoting fruit ripening, characterized in that: The method is to overexpress the banana MaSCL8 gene according to claim 1 in plants to promote fruit ripening.

9. The method according to claim 8, characterized in that The plant is a banana or a tomato.