Amomum villosum blooming period regulation Ghd7 gene and application thereof
By cloning the Yangchun Sand flowering period, the problem of unstable Yangchun Sand yield was solved, providing a foundation for the cultivation of rapid flowering and high-yield high-quality varieties, and promoting the upgrading and genetic improvement of the medicinal materials industry.
Patent Information
- Application Number
- CN202510583379.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-08-08
AI Technical Summary
The growth cycle of Yangchun sand is long and the yield is unstable. It is regulated by genes such as flowering genes and drought resistance genes, resulting in limited development and utilization of medicinal resources. The existing technology lacks effective flowering control methods.
The Ghd7 gene was regulated by cloning the flowering period of Yangchun Sand. The sequence was shown in SEQ ID NO.1. It was confirmed by biological information analysis that it was a negative regulatory gene, encoding 230 amino acids and containing the CCT domain of the CO gene family, and was used to regulate the flowering period of Yangchun Sand.
It provides basic information for cultivating new varieties of Yangchun sand that are fast blooming, high-yield and high-quality, promotes the upgrading of the medicinal materials industry, provides reference for genetic improvement and efficient cultivation, and solves the problems of low yield and long growth cycle of Yangchun sand.
Smart Images
Figure CN120442648A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene cloning, and more particularly to a Ghd7 gene for regulating flowering period of Amomum villosum and application thereof. Background Art
[0002] Amomum villosum L. is a medicinal plant of the Zingiberaceae family, belonging to the genus Cardamom. It is one of the sources of the traditional Chinese medicine Amomum villosum, listed in the Chinese Pharmacopoeia. Its dried, mature fruit is used medicinally, boasting benefits such as regulating qi, stabilizing pregnancy, warming the spleen, and arresting diarrhea. Amomum villosum is native to Guangdong, Yunnan, Guangxi, and Fujian provinces in my country, and is well-suited for cultivation under tropical and subtropical forest valleys. Its growth and yield are significantly influenced by the local ecological environment, resulting in variable yields. Furthermore, its growth and yield are significantly regulated by endogenous factors, such as genes for flowering, drought resistance, and disease resistance. Amomum villosum is a perennial herb that typically takes two to three years to flower. Its long growth cycle and limited yield are increasingly problematic, severely restricting its sustainable development and utilization as a medicinal resource.
[0003] In the applicant's preliminary investigation, it was found that in varieties such as 'Yunsha No. 8', there were early-bearing variant plants that bloomed in one year. Through transcriptome sequencing, the differentially expressed gene Unigene17286 (annotated as CO) related to the flowering of Amomum villosum was screened. The rapid reproductive characteristics exhibited by these early-bearing variant plants indicate that they may have key genetic variations that regulate the flowering period. This has important theoretical and practical value for the variety improvement of Amomum villosum, increasing the yield of medicinal materials, and shortening the cultivation cycle. As an important Chinese medicinal material, Amomum villosum occupies a pivotal position in the traditional Chinese medicine system. It is widely used in the treatment of digestive system diseases, gynecological tocopherols and other fields, and the market demand continues to rise.
[0004] Flowering in plants is the transition from the vegetative to the reproductive phase of growth, regulated by multiple pathways. The CONSTANS (CO) gene and its family members in the photoperiod pathway serve as key components, integrating light and circadian clock signals to rhythmically activate the expression of genes such as FLOWERINGLOCUS T, thereby inducing flowering. CO homologs have been cloned and studied in multiple species. Using map-based cloning, researchers first isolated the CO gene from a delayed flowering mutant in Arabidopsis thaliana. Subsequently, researchers isolated 16 CONSTANS-LIKE (COL) genes in Arabidopsis, collectively forming the CO gene family. With the rapid advancement of molecular biology and genetics, CO homologs have been cloned from over 30 species, including Arabidopsis thaliana, rice (Oryza sativa L.), rapeseed (Brassica chinensis var. oleifera), and potato (Solanum tuberosum), and their sequence characteristics, expression patterns, and functional properties have been studied.
[0005] Therefore, how to study the CO gene of Amomum villosum is an urgent problem that those skilled in the art need to solve. Summary of the Invention
[0006] In view of this, the object of the present invention is to provide a Ghd7 gene for regulating the flowering period of Amomum villosum and its application to address the deficiencies in the prior art.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] A Ghd7 gene regulating flowering period of Amomum villosum, the sequence of which is shown in SEQ ID NO.1.
[0009] The present invention designed specific primers based on the CONSTANS (CO) gene, a differentially expressed gene in the flowering pathway of Amomum villosum, identified by the applicants in their previous screening. The full-length CDS sequence of the gene was obtained by PCR cloning. Homologous sequence alignment analysis using NCBI confirmed the gene as AvGhd7. The full-length CDS is 693 bp, encoding 230 amino acid residues. It contains the CCT domain typical of CO genes and belongs to the CCT supergene family. Phylogenetic analysis revealed that AvGhd7 clusters with plants of the Zingiberaceae family. Gene expression analysis showed that the expression level of the AvGhd7 gene in flowering tissues was significantly lower than in other tissues, and that the expression level in early-bearing plants was significantly lower than that in non-early-bearing plants, indicating that it is a negative regulatory gene for the flowering trait of Amomum villosum. The present invention provides a reference for studying the molecular mechanism of the early-bearing trait of Amomum villosum.
[0010] The present invention also claims to protect the use of the above-mentioned Amomum villosum flowering period regulating Ghd7 gene in regulating the flowering period of Amomum villosum.
[0011] It can be seen from the above technical solution that compared with the prior art, the beneficial effects of the present invention are as follows:
[0012] Based on the applicant's previous transcriptome data from Amomum villosum, this study clones and analyzes genes associated with premature fruiting, providing foundational data for the development of new Amomum villosum varieties that flower quickly, are high-yielding, and offer high-quality results. This research will not only help promote the transformation and upgrading of the Amomum villosum medicinal material industry but also provide important insights and inspiration for the genetic improvement and efficient cultivation of other perennial medicinal plants. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 Figure 5 is the electrophoresis result of PCR amplification of the CDS sequence of the AvGhd7 gene. The marker is DL2000, 1 and 2 are the amplification results using MGWZF-11 as the template, 3 and 4 are the amplification results using MGWZF-39 as the template, and 5 and 6 are the amplification results using GD-2 as the template.
[0014] Figure 2 Comparison of Ghd7 gene sequences of Amomum villosum and Zingiber officinale;
[0015] Figure 3 Comparison of Ghd7 protein sequences in Amomum villosum, Zingiber officinale, and Rice;
[0016] Figure 4 Prediction of conserved domains of AvGhd7 protein;
[0017] Figure 5 The hydrophilicity prediction (A) and transmembrane domain prediction (B) of AvGhd7 protein;
[0018] Figure 6 The secondary structure of AvGhd7 protein, where the blue line segment is α-helix, the red line segment is extended chain, the green line segment is β-sheet, and the purple line segment is random coil;
[0019] Figure 7 is the three-dimensional model of AvGhd7 protein, where the color is the confidence gradient mode;
[0020] Figure 8 Phylogenetic analysis of AvGhd7 protein and other monocot Ghd7;
[0021] Figure 9is the relative expression level of AvGhd7 gene in different parts, among which CK-TL is the young leaves of the control group, EF-TL is the young leaves of the early-flowering group, CK-ST is the stolon tip of the control group, EF-ST is the stolon tip of the early-flowering group, and EF-FB is the flower bud of the early-flowering group. DETAILED DESCRIPTION
[0022] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0023] Example
[0024] 1. Materials and Methods
[0025] 1.1. Materials
[0026] The 'Yunsha No. 8' Amomum villosum variety planted at the Amomum villosum breeding base in Longmen Village, Mohan Town, Mengla County, Xishuangbanna Dai Autonomous Prefecture, Yunnan Province was used as the experimental material. The flower buds, runners and young leaves of three randomly selected plants with flower bud differentiation within one year after planting (early-fruiting plants) were collected in the experimental group. The runners and young leaves of three plants without flower bud differentiation within one year after planting were collected in the control group. All samples were quick-frozen in liquid nitrogen and then stored in a -80℃ refrigerator for later use.
[0027] 1.2. Methods
[0028] 1.2.1. Total RNA extraction and reverse transcription from Amomum villosum
[0029] Total RNA from Amomum villosum was extracted using a polysaccharide and polyphenol plant total RNA extraction kit. The RNA concentration and the absorbance ratio (A) at 260 and 280 nm (A260 / A280) were measured using an ultramicro spectrophotometer and recorded. Total RNA from Amomum villosum was reverse transcribed using a reverse transcription kit to obtain Amomum villosum cDNA. The cDNA was detected by electrophoresis on a 1.5% agarose gel and stored at -20°C for later use.
[0030] 1.2.2. Gene cloning
[0031] The research team initially identified Unigene17286 (annotated as CO), a differentially expressed gene associated with flowering in Amomum villosum. They designed and synthesized specific primers CO-F and CO-R. They cloned and tailed the target fragments via PCR, recovered them, and ligated them into the pMD19-T vector. The fragments were then transformed into competent Escherichia coli cells and cultured. Plaques were selected for PCR and electrophoresis analysis, and the target-positive bacterial cultures were sequenced. Primer synthesis and sequencing were performed by BGI Genomics Co., Ltd. See Table 1 for primer details.
[0032] Table 1 AvGhd7 gene cloning primer sequences and Tm values
[0033]
[0034]
[0035] 1.2.3. Genetic bioinformatics analysis
[0036] NCBI (www.ncbi.nlm.nih.gov) was used for sequence alignment, search and conserved domain analysis. The software DNAMAN was used for nucleotide sequence alignment. The relative molecular mass, isoelectric point and average hydrophobicity of the protein were analyzed using the ProtScale online website. The transmembrane domain of the protein was predicted online using the website TMHMM 2.0. The two-dimensional and three-dimensional protein structures were predicted using the SOPMA and SWISS-MODLE online analysis websites. The website NCBI-blast P and the software Clustal X and MEGA 11.0 were used for homologous protein search and phylogenetic analysis of protein sequences.
[0037] 1.2.4. Fluorescence quantitative PCR
[0038] Primer-BLAST was used to design fluorescent quantitative PCR primers with the sequences F (GACATGGCCTCACGTTTGAC) and R (GCTTCCGGCGAAGGATATGA). Primer synthesis was completed at Beijing Liuhe BGI Genomics Co., Ltd. Using the endogenous actin of Amomum villosum as the internal reference gene and the Amomum villosum cDNA obtained in the above steps as the template, the system was constructed and placed in a fluorescent quantitative PCR instrument for reaction. The reaction procedure was as follows: step 1, 95°C, 30s; step 2, 95°C, 5s, 60°C, 30s, 40 cycles; step 3, 95°C, 10s; 65°C, 5s; 95°C, 5s (refer to TB Green Premix Ex Taq TM II instructions for the use of CFX96 Real-time PCR Detection System operating procedures). Fluorescence quantitative PCR was used to obtain Cq values, using 2 -ΔΔCq Data analysis method was used to analyze the fluorescence quantitative data.
[0039] 2. Results and Analysis
[0040] 2.1. PCR amplification and sequencing results of the AvGhd7 gene
[0041] The sequence length of the differentially expressed gene CO in the floral pathway of Amomum villosum, which was screened by transcriptome analysis in the early stage, is 693 bp. Using primers designed for this specific sequence, polymerase chain reaction (PCR) amplification was performed on the cDNA template of Amomum villosum, and a single band of approximately 700 bp was obtained ( Figure 1 The positive clones were sequenced, and the results showed that the gene sequence was 693 bp in size, encoding 230 amino acid residues. Sequence alignment results showed that the sequence obtained by sequencing was completely consistent with the sequence screened by transcriptome analysis. The sequence obtained by sequencing was used for homology analysis in the GenBank database, and it was found that it had the highest homology with the Ghd7 gene of the same family plant ginger (Zingiber officinale), about 85.17%. It was named AvGhd7 ( Figure 2 ).
[0042] The gene sequence of AvGhd7 is shown in SEQ ID NO. 1, specifically:
[0043] .
[0044] The Ghd7 gene was first discovered in rice. It contains a CCT domain, which is typical of the CO gene family. Therefore, by comparing the Ghd7 protein sequences in rice, ginger, and Amomum villosum, it was found that the protein sequence encoded by the Amomum villosum Ghd7 gene also contains a highly conserved CCT domain ( Figure 3 ), it is speculated that AvGhd7 may have a similar function in regulating flowering as the Ghd7 gene in rice and ginger.
[0045] Bioinformatics analysis
[0046] 2.2.1. Conserved domain analysis
[0047] The conserved domain prediction of AvGhd7 protein using CD-search provided by NCBI showed that (e.g. Figure 4 ), which also has a conserved CCT functional domain, which may be involved in the integration of light signals and circadian clock signals, thereby rhythmically activating the expression of downstream genes (such as the FT gene) and inducing plant flowering, indicating that AvGhd7 belongs to the CCT supergene family, which is consistent with the above analysis results.
[0048] 2.2.2. Protein physicochemical properties and transmembrane domain analysis
[0049] The protein physicochemical properties and transmembrane domain analysis of the AvGhd7 protein sequence showed that the relative molecular mass of the AvGhd7 protein was 230, the isoelectric point was 6.05, and the instability coefficient was 50.48>40, indicating that the protein was unstable. The hydrophilicity / hydrophobicity of the AvGhd7 protein was predicted using the Protscale tool of ExPASy ( Figure 5 A), the total average hydrophilicity is -0.530, indicating that AvGhd7 protein is a hydrophilic protein. The AvGhd7 protein has the lowest peak at the 171st and 176th amino acid positions, with the lowest peak value of -3.833, and the highest peak at the 130th amino acid position, with the highest peak value of 1.522. This may indicate that the structural stability of the AvGhd7 protein is relatively low at the 171st and 176th amino acid positions, and relatively high at the 130th amino acid position. At the same time, the prediction results show that the AvGhd7 protein does not have a transmembrane domain ( Figure 5 These results indicate that AvGhd7 is an unstable hydrophilic protein with a moderate molecular weight and an acidic isoelectric point, with structural stability differences at specific amino acid sites and no transmembrane domain.
[0050] 2.2.3. Protein secondary and tertiary structure prediction
[0051] The secondary structure of AvGhd7 protein was predicted ( Figure 6 ), 62 amino acids contribute to the formation of α-helices (26.96%) in the secondary structure of AvGhd7. Thirty-two amino acids contribute to the formation of extended chains (13.91%). Five amino acids contribute to the formation of β-sheets (2.17%). And 131 amino acids contribute to the formation of random coils (56.96%). AvGhd7's primary structures are α-helices and random coils. α-helices are the most stable protein structure, but the proportion of α-helices is only 26.96%, suggesting that the protein is generally stable.
[0052] The tertiary structure prediction of AvGhd7 protein was performed ( Figure 7), the predicted motif of AvGhd7 protein is A0A804J4P2.1.A, and the tertiary structure of AvGhd7 protein contains 213 amino acids, accounting for 93% of the total number of encoded amino acids, with high credibility.
[0053] 2.2.4. Phylogenetic analysis of AvGhd7 protein
[0054] The phylogenetic tree of Ghd7 proteins from different species was constructed using the NJ method. Figure 8 As shown, the AvGhd7 protein of Amomum villosum clustered with the Ghd7 protein of the same family plant ginger, indicating that they were most closely related, while the AvGhd7 protein of Amomum villosum was more distantly related to the Ghd7 proteins of the palm plants coconut (Cocos nucifera) and oil palm (Elaeis guineensis).
[0055] 2.3. Analysis of AvGhd7 gene expression in different tissues of Amomum villosum
[0056] Fluorescence quantitative PCR was used to detect the expression of AvGhd7 gene in different tissues (young leaves, stolon tips and flower buds) of early-bearing plants and different tissues (young leaves and stolon tips) of non-early-bearing plants. Figure 9 ). The results showed that the expression level of the AvGhd7 gene in the young leaves of early-bearing plants was extremely significantly higher than that in the flower buds and runners, and in the young leaves of non-early-bearing plants was also extremely significantly higher than that in the runners. There was no significant difference in the expression levels in the flower buds of early-bearing plants and the runners where they differentiated and formed. The expression level in the young leaves of non-early-bearing plants was higher than that in the young leaves of early-bearing plants, while there was no significant difference in the expression levels in the runners of the two. In summary, the expression level of the AvGhd7 gene in the flowering part of Amomum villosum was extremely significantly lower than that in other tissue parts, and the expression level in early-bearing plants was lower than that in non-early-bearing plants, indicating that this gene is a negative regulatory factor for flowering in Amomum villosum, and its sensing and regulatory tissue part is the leaf.
[0057] 3 Summary and Discussion
[0058] Amomum villosum, one of my country's four renowned southern medicinal herbs, promotes qi circulation, relieves fullness, and strengthens the spleen and eliminates dampness. As a perennial medicinal plant in the Zingiberaceae family, it also suffers from long vegetative growth periods and pollination difficulties, necessitating careful regulation of its flowering period. This study cloned the flowering-related CO gene from Amomum villosum and identified it as AvGhd7 through sequence alignment. This gene was also preliminarily studied through bioinformatics and expression analysis.
[0059] The rice Ghd7 gene possesses a CCT domain, which regulates rice growth and development through complex molecular mechanisms. Some researchers have found that overexpression of rice Ghd7 in leaf vascular tissues mimics the function of the COL gene, with the amino acid sequence 189-233 highly similar to the CCT domain of the Arabidopsis CO protein. Ghd7 can inhibit the expression of rice flowering genes, influence hormone metabolism, and positively correlate with the duration of the heading period. Under long-day conditions, enhanced Ghd7 expression inhibits Hd3a and delays flowering. Furthermore, researchers have identified four important negative regulatory genes (Ghd7, CDF1, COP1, and RAV2-like) within the photoperiod pathway that regulate light-induced flowering in ginger by inducing floral bud differentiation under red light and long-day conditions. These genes may be important negative regulators of light-induced flowering in ginger. The AvGhd7 gene in Amomum villosum may also function in regulating flowering.
[0060] qPCR expression analysis results showed that the expression level of the AvGhd7 gene in the young leaves of early-bearing Amomum villosum plants was significantly higher than that in flower buds and runners, indicating that it is a negative regulatory gene for Amomum villosum flowering. Current problems encountered in Amomum villosum production, such as low yield, excessive plant height, and a prolonged vegetative growth period, are urgently needed to be addressed. The AvGhd7 gene in rice has the function of regulating these three traits. This present invention preliminarily demonstrates that the AvGhd7 gene is a negative regulator of Amomum villosum flowering traits. Further research will be conducted on the function of the AvGhd7 gene through gene silencing or overexpression to clarify its relationship with Amomum villosum yield, plant height, and early-bearing traits. This present invention cloned the AvGhd7 gene sequence in Amomum villosum for the first time and preliminarily analyzed the gene's function. This provides a certain foundation for the accurate verification and utilization of the AvGhd7 gene function in the future, facilitates the research of early-bearing Amomum villosum breeding, and has extremely high application value.
[0061] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A Ghd7 gene for regulating flowering period of Amomum villosum, characterized in that: The sequence is shown as SEQ ID NO.
1.
2. Use of the Amomum villosum flowering period regulating Ghd7 gene according to claim 1 in regulating the flowering period of Amomum villosum.