Application of oil body protein gene OsOle4 in cultivation of rice strains with different fatty acid contents
The CRISPR/Cas9 system knocked out or overexpressed the rice oil protein gene OsOle4, and the endosperm-specific promoter Gt1 drives the expression of OsOle4, solving the problem that the regulation of rice lipid content in the prior art has greatly affected seed vitality, and achieving precise regulation and quality improvement of rice fatty acid content.
Patent Information
- Application Number
- CN202510643806.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-08
AI Technical Summary
The existing rice oil-body protein gene OsOle6 has a severe effect on regulating rice lipid content, affecting the vitality of rice seeds, making it difficult to fine-tune rice lipid content and improve quality.
The CRISPR/Cas9 system was used to knock out or overexpress the rice oil protein gene OsOle4, and the endosperm-specific promoter Gt1 was used to drive the expression of OsOle4, regulate the fatty acid content of rice, and increase the fatty acid content by knockout reduction or overexpression, ensuring that there is no impact on the growth and development of rice plants.
The precise regulation of the fatty acid content of rice is achieved, which significantly improves the food taste quality of rice without affecting seed germination rate and rice growth and development, providing a new molecular target for improving rice quality.
Smart Images

Figure CN120442653A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to rice cultivation, in particular to oleosin gene OsOle4 Application in breeding rice lines with different fatty acid contents. Background Art
[0002] Lipids are essential energy storage and functional active substances in plant seeds and have multiple biological significances in plant life activities. Lipids are mainly enriched in plants in the form of triglycerides, generally accounting for more than 90%, and are mainly stored in the form of oil bodies. Plant lipids not only have efficient energy reserves but also directly participate in the maintenance of cell structure and material transport. In starch-based grass crops, although lipids only account for 1%-3% of the dry weight of seeds, they play an important role in seed formation, germination, and grain quality characteristics. For example, lipids form stable complexes with starch in rice endosperm, affecting the processing characteristics, cooking and eating quality of rice, and oxidative stability during storage. In addition, some unsaturated fatty acids in lipids, such as linoleic acid and α-linolenic acid, are high-quality fatty acids essential to the human body and are of great significance for regulating human blood lipids and reducing the risk of cardiovascular disease (Bms et al., The Lancet Diabetes & Endocrinology, 2020, 8(11):915-930).
[0003] Rice is an important food crop in the world, and its nutritional composition and quality traits have always been the focus of research. The endosperm is the main part of rice, which is mainly composed of three substances: starch, protein and lipids. Starch, as the most important component, often exists in the form of semi-crystalline particles. Its formation mechanism and composition characteristics directly affect the quality of rice. The content of amylose is a key indicator that determines the cooking and eating quality of rice. Varieties with high amylose content have high hardness and low viscosity, and the palatability of rice will be reduced. Studies have shown that reducing the amylose content and protein content can significantly improve the cooking and eating quality of rice (Cai et al., Plant Biotechnology Journal. 2025, 23(2): 518-531). However, reducing the amylose content often has a greater impact on the appearance quality of rice, resulting in a decrease in rice transparency. Reducing the protein content is difficult to achieve under high-fertilizer cultivation conditions. Although lipids make up a small proportion of rice, their content and composition are closely linked to rice quality, significantly influencing its physical and chemical properties and texture (Zhou et al., International Journal of Food Science & Technology, 2002, 37: 849-868). However, research on the genetic regulation of lipids in rice is limited, and the mechanisms by which they regulate rice quality and their specific effects on rice physical, chemical, cooking, and flavor qualities remain unclear.
[0004] Plant oils mainly exist in the form of oil bodies in cells. The diameter of the oil body is about 0.2–2.0 μm. The core is composed of hydrophobic triacylglycerol (TAG), and the outer layer is wrapped with a single layer of phospholipid membrane. The membrane is embedded with specific proteins such as oil body protein, calmodulin and sterol protein. Among them, oil body protein accounts for the highest proportion (70%-90%). Oil body protein is a highly conserved small molecule basic protein that plays a key role in maintaining the stability of oil body structure (Thiam et.al. Nat Rev Mol Cell Bio, 2013, 14(12): 775-778). Studies have shown that overexpression in microalgae system AtOleo3 The gene can increase TAG content by 1.4 times (Zulu et al. Biotechnology for Biofuels, 2017, 10: 187.). AtOLE1This can cause the seed germination rate to lag significantly behind that of the wild type (Shimada et al. Plant J. 2008, 55(5): 798-809). Studies in rice have found that using the embryo-specific promoter REG-2 to drive the soybean oleosin gene Gm-A / Gm-B can significantly increase the number of oil bodies in the embryos of transgenic lines (Liu et al., Theoretical and Applied Genetics, 2013, 126: 2289-2297). These studies indicate that oleosin plays an important role in plant growth and development, lipid metabolism, and other aspects, making it possible to regulate the lipid content in rice by regulating the gene expression of oleosin.
[0005] Chinese patent application number 202210597877.8 discloses a method for regulating the oil body protein gene of rice OsOle6 Expression can significantly change the lipid content of rice and thus affect the quality of rice. OsOle6 The regulatory effect is quite drastic, which has a certain impact on the vitality of rice seeds, and thus affects the normal growth of rice. Summary of the Invention
[0006] In view of the problem that the existing rice oleosin gene has a more drastic effect on regulating the lipid content of rice and has a certain impact on the vitality of rice seeds, the present invention provides an oleosin gene OsOle4 The application of this gene in cultivating rice lines with different fatty acid contents has a relatively mild effect on rice lipids and quality, especially the endosperm-specific promoter used in this invention drives OsOle4 Expression has no effect on the growth and development of rice plants and can achieve fine-tuning of rice lipid content and taste quality.
[0007] In order to achieve the above object, the present invention provides a rice oleosin gene OsOle4 Application of the oil body protein gene in cultivating rice lines with reduced or increased fatty acid content OsOle4 The nucleotide sequence of the rice oil body protein gene is shown in SEQ ID No. OsOle4 Reducing fatty acid content in rice by overexpressing the rice oleosin gene OsOle4 Improve the fatty acid content of rice. Among them, the reduction in the fatty acid content of rice obtained by the knockout method is moderate, does not affect the seed germination rate, and is significantly better than the published OsOle6 gene, because its knockout will reduce the seed germination rate. OsOle4 It is more useful in regulating rice lipids and quality.
[0008] The oleosin gene OsOle4The encoded amino acid sequence is shown in SEQ ID No.2.
[0009] The present invention integrates the rice genome and transcriptome database resources, and analyzes the tissue-specific expression patterns of each gene in the Oleosin gene family based on the information of the Rice Gene Expression Database (https: / / ricexpro.dna.affrc.go.jp / ). It is found that the oleosin encoding gene OsOle4 (Os09g0324000) is dominantly expressed in rice endosperm. OsOle4 The nucleotide sequence encoding this gene is shown in SEQ ID No. 1. The oleosomal protein encoded by this gene has a typical hydrophobic core domain and hydrophilic regions at both ends, and is composed of a total of 158 amino acids. The amino acid sequence is shown in SEQ ID No. 2.
[0010] SEQ ID No. 1: ATCGATCGATCGATCACAACATTTTCTTGAGGTCGATCAGTAGTACCCATGGCCGGTGGTGGAGGCGCCGTCGGAGAACACTACATGCGGGTGATCCGCGGCGACGACGGGTACGGCGACGACGGCGGCCAGCACCAGGAGAAGCCGGGGGCGGCCGTGTCCGTTGCGAAGGGCGCCGCGGCGGCGGCGGCGGCGGGGTCGATGCTGGCGCTGGCGGGGCTGACGGCGACGGGGACAGCGCTGGCGCTGATCGTGGCGACGCCGCTGCTGGTGCTCTTCAGCCCCGTGCTGGTGCCGGCCGCCTTCGCGGCGTCGCTGCTGGCGGCCGGGCTCGCGTCCTCCGGCGCGCTCGGCGCCGCGGCGGTGGGCGTGCTGGCGTGGATGTACCGGTACCTGCAGTCGCCGTCCGGCGAGCACGCGCCCGCCGGCGCCGGCAAGGTGGAGCACGCCCGCGCGCTGCTCGACGCCAAGGCGCACGACGTTGGGGACTGGGTCCAGCACCGCCTCGACCAGGCGCGCACCTAGAAAAATTAGCTACGGATTAGTTCAAATCAACTCGCCTATAGCTAGCTGATGCAATCACACATATGCATATGCCTTCGTGTTTGTGTAATGTTCCGTGTGTGTACAATAATTAGTTGCAAAATGCTGGATTGCTGGTACGGCGACA; SEQ ID No.2: Met Ala Gly Gly Gly Gly Ala Val Gly Glu His Tyr Met Arg Val Ile ArgGly Asp Asp Gly Tyr Gly Asp Asp Gly Gly Gln His Gln Glu Lys Pro Gly Ala AlaVal Ser Val Ala Lys Gly Ala Ala Ala Ala Ala Ala Ala Gly Ser Met Leu Ala LeuAla Gly Leu Thr Ala Thr Gly Thr Ala Leu Ala Leu Ile Val Ala Thr Pro Leu LeuVal Leu Phe Ser Pro Val Leu Val Pro Ala Ala Phe Ala Ala Ser Leu Leu Ala AlaGly Leu Ala Ser Ser Gly Ala Leu Gly Ala Ala Ala Val Gly Val Leu Ala Trp MetTyr Arg Tyr Leu Gln Ser Pro Ser Gly Glu His Ala Pro Ala Gly Ala Gly Lys ValGlu His Ala Arg Ala Leu Leu Asp Ala Lys Ala His Asp Val Gly Asp Trp Val GlnHis Arg Leu Asp Gln Ala Arg Thr.
[0011] Taking into account the degeneracy of codons and the preference of different species for codons, those skilled in the art can select codons suitable for expression of a specific species according to specific needs. OsOle4 The scope of protection not only covers the nucleotide sequence shown in SEQ ID No. 1, but also includes nucleotide sequences that can still encode the same protein after one or more nucleotides are substituted, deleted and / or added to the sequence. In addition, nucleotide sequences with at least 90% homology to the sequence shown in SEQ ID No. 1 also belong to the rice oleosin gene of the present invention. OsOle4 category.
[0012] Those skilled in the art can obtain corresponding protein mutant sequences based on the amino acid sequence disclosed in the present invention (SEQ ID No. 2) by performing substitutions, deletions, and / or insertions of one or more amino acids while maintaining its biological activity. Sequences that are at least 90% homologous to the amino acid sequence shown in SEQ ID No. 2 are also included within the scope of protein sequences covered by the present invention.
[0013] The invention proposes an innovative method for regulating the fatty acid content of rice. Specifically, by means of genetic engineering technology, OsOle4 By knocking out and over-expressing genes respectively, rice strains with different fatty acid contents were cultivated, thus achieving precise regulation of the fatty acid content of rice.
[0014] Specifically, the knockout uses the CRISPR / Cas9 system.
[0015] Specifically, the overexpression vector used in the overexpression process is Gt1-OsOle4, and the Gt1-OsOle4 contains the gene OsOle4 The vector is a universal plant expression vector pCAMBlA1300, which includes the rice endosperm-specific expression gene OsGt1 The promoter is located 1.8 kb upstream of the gene transcription start site.
[0016] More specifically, OsOle4 The preparation method of gene overexpression vector is as follows: OsOle4 The gene amplification primer pair uses Nipponbare genomic DNA as a template to amplify the OsOle4 The coding sequence was mixed with the linearized pCAMBlA1300-Gt1 vector DNA fragment and ligated using homologous recombination method.
[0017] Preferably, the amplification primer sequences are as follows: Primer3:5'TAGTCCTACAACAACGGATCCATGGCCGGTGGTGGAGG'; Primer4:5'CGATCGGGGAAAATTCGAGCTCAGATGTCGCCGTACCAGCAA'.
[0018] Through the above technical solution, the present invention achieves the following beneficial effects: (1) The present invention reveals the rice oil body protein gene OsOle4 The gene and its encoded protein play a key regulatory role in the formation of rice quality. This gene and its encoded protein affect rice quality by regulating the fatty acid content of rice. OsOle4When the biological function of the gene-encoded protein is disrupted, the fatty acid content in rice seeds is significantly reduced, while the rice's flavor quality is significantly improved, with no significant effect on seed germination rate. This discovery provides a new molecular target for improving rice quality and demonstrates great potential and value in breeding new rice varieties with superior flavor characteristics.
[0019] (2) The present invention innovatively uses the rice endosperm-specific expression promoter Gt1 to drive OsOle4 Gene expression, through precise regulation of gene expression patterns, has successfully achieved a significant increase in the fatty acid content of rice. This technological breakthrough effectively improves the nutritional quality of rice and gives it a higher nutritional value. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Created for use with the CRISPR / Cas9 vector system OsOle4 The specific mutation information of the two mutation types D1 and D6 of the gene are named OsOle4-KO1 and OsOle4-KO2 ; Figure 2 GT1 promoter driven by gene-specific primers primer7 and primer8 OsOle4 Gel electrophoresis images of PCR detection of homozygous transgenic rice, from left to right: Marker, positive plasmid control, overexpression plants (2-10) and parental control; Figure 3 for OsOle4 Triglyceride content of mutant rice, where A and B are the triglyceride determination results in brown rice and polished rice, respectively; Figure 4 for OsOle4 Results of taste (A) and texture properties of mutant rice (B); Figure 5 for OsOle4 The results of triglyceride content determination in overexpressing transgenic rice, where A and B are the triglyceride determination results in brown rice and polished rice, respectively; Figure 6 for OsOle4 Taste (A) and texture characteristics (B) of transgenic rice overexpressing the gene. Figure 7 for OsOle4 and OsOle6 Comparison of gene-edited line seeds after germination for 6 days, where A and B are OsOle4 and OsOle6 Comparison of seed germination curves of edited lines under the background of Nipponbare (Nip); C and D are OsOle4 and OsOle6Comparison of seedling growth status of gene-edited lines 6 days after seed germination. DETAILED DESCRIPTION
[0021] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.
[0022] Unless otherwise specified, the methods used in the following examples are conventional methods; the experimental materials used, unless otherwise specified, were purchased from conventional biochemical reagent companies.
[0023] Example 1 Rice oleosin gene in the CRISPR / Cas9 system OsOle4 Editing Method (1) The CRISPR primer sequences are as follows: primer1: 5' GGCAATCCGCGGCGACGACGGGTA 3' (SEQ ID No.3) primer2: 5' AAACTACCCGTCGTCGCCGCGGAT 3' (SEQ ID No. 4).
[0024] (2) Vector construction and genetic transformation Target sites for the CRISPR / Cas9 system of this invention are primarily selected using the target site design tool Target Design (http: / / skl.scau.edu.cn / targetdesign / ) within the online toolkit CRISPR-GE. Target sites are selected based on specific sequences located at the beginning of the coding region and not detected at off-target sites using the off-target prediction tool Off Target (http: / / skl.scau.edu.cn / ). The CRISPR / Cas9 vector system used in this invention comprises two vectors: the intermediate vector SKgRNA and the final vector pC1300-Cas9. Their backbones are derived from the pBlueScript (SK+) vector and the pCAMBlA1300 vector, respectively.
[0025] The steps of constructing the vector are as follows: dilute the above primers primer1 and primer2 to 100 μM respectively, denature and anneal them, and take 8 μL of them to Aar I mixed and digested the intermediate vector SK-gRNA with the county magistrate endonuclease, then connected the vector fragment and the target site fragment, transformed Escherichia coli and obtained the connection plasmid by colony PCR positive identification.
[0026] Reuse Kpn I and Bgl II, cut out the gRNA in the positive clone and Kpn I and Bam The pC1300-Cas9 vector after HI digestion was ligated and transformed into Escherichia coli. The target site was confirmed by sequencing for construction into the final vector. The successfully constructed plasmid was extracted and transformed into Agrobacterium for subsequent creation of transgenic rice.
[0027] The strain obtained above was transformed into Nipponbare (Nip) using the Agrobacterium-mediated method to induce callus tissue, which was then differentiated into rice seedlings through tissue culture. Positive plants were detected using hygromycin primers to obtain T0 generation rice plants.
[0028] Example 2 OsOle4 Overexpression vector construction and genetic transformation methods (1) OsOle4 The coding sequence amplification primer sequences are as follows: primer3:5'TAGTCCTACAACAACGGATCCATGGCCGGTGGTGGAGG3'(SEQ ID No.5) primer4:5'CGATCGGGGAAATTCGAGCTCAGATGTCGCCGTACCAGCAA3' (SEQ ID No. 6).
[0029] (2) Vector construction and genetic transformation The plant expression vector used in the present invention is pCAMBlA1300 (purchased from Shanghai Lianmai Company), which contains the constitutively highly expressed gene from rice itself. OsGT1 promoter.
[0030] because OsOle4 There is only one exon, so the rice Nipponbare genomic DNA was used as a template and the above primer pair was used to amplify the target gene CDS. The PCR system was: 10 μL of high-fidelity enzyme, 6 μL of sterile water, 2 μL of DNA, and 1 μL each of F / R. PCR conditions: denaturation at 95°C for 3 minutes; then 95°C-15 seconds, 58°C-30 seconds, and 72°C-40 seconds, for a total of 35 cycles; then extension at 72°C for 5 minutes; and storage at 4°C. The target product was detected by 1% agarose electrophoresis of the PCR product. The strain carrying PC1300-696-Gt1 (vector) (kanamycin resistance) was cultured in LB liquid medium. After overnight culture of the bacterial solution, the vector plasmid was extracted and cloned using BamHI and Kpn I. Perform double enzyme digestion on the plasmid (enzyme digestion system: 20 μL system, 10 μL vector plasmid, Bam HI 1 μL, Kpn I 1μL, endonuclease 2μL, and the rest is made up with sterile water).
[0031] The digested product was recovered by electrophoresis on 1% agarose gel. After determining the concentrations of the PCR product and vector plasmid, the product was recombined using the homologous recombinase. The recombinant product was then transformed into competent E. coli DH5@ (Kanamycin-resistant medium). After overnight incubation, 3-5 single clones were selected and cultured. Approximately 100 μl of the transformed cells were plated onto Kanamycin-resistant medium and incubated inverted at 37°C overnight. After preserving the culture product, plasmids were extracted and single clones were selected for sequencing. The correctly sequenced plasmid was designated GT1-Ole5.
[0032] The positive GT1-Ole5 Agrobacterium strain was used to transfer the constructed target plasmid into Agrobacterium for subsequent rice transformation. The recipient was the japonica rice variety Nipponbare (Nip). Transformed plants were primarily detected using a common primer specific for the hygromycin resistance gene.
[0033] Example 3 Analysis of transgenic materials (1) Design of detection primers for OsOle4 To identify gene-edited mutants, we design primers 100-500 bp in length at both ends of the target site. Sequencing primers are Primer5 and Primer6. The target gene product, after PCR amplification, is sent to our company for sequencing. The PCR-amplified target fragment, including the target site, is used for sequencing identification and mutation analysis.
[0034] primer5: 5' CAGCCACACTCCACATGTCCACCC 3' (SEQ ID No.7) Primer6: 5' GCCCTTCGCAACGGACACGG 3' (SEQ ID No. 8).
[0035] For the detection of GT1-Ole5 rice, primers primer7 and primer OsOle4 Primer8 was designed on the coding sequence to identify pure lines of positive transgenic plants.
[0036] primer7: 5' CAGTTCCTTAGTCCTACAACAACG 3' (SEQ ID No.9) primer8: 5' CAGTCCCCAACGTCGTGC 3' (SEQ ID No. 10).
[0037] (2) Identification of transgenic plants for OsOle4 Mutant rice was isolated from T0 generation using CTAB method. OsOle4DNA was extracted from the leaves of mutant rice. Using the extracted DNA as a template, primers Primer5 and Primer6 were used to perform conventional PCR amplification of the target gene segment. The amplified product was detected by 1% agarose gel electrophoresis. After ensuring that the amplification results were in line with expectations, it was sent to Nanjing Qingke Biological Company for sequencing. The sequencing results were analyzed for mutation types using SnapGene. At the T0 generation transgenic test tube seedling stage, all test tube seedlings were first tested for transgenic properties, and the results showed that all were positive plants. Then, the target site sequencing primers were used to sequence and analyze the gene editing target site. Through analysis, two types of mutations were successfully identified in the T0 generation, namely 1bp deletion and 6bp deletion (specific results are shown in the figure). Figure 1 The cells were then grown and two homozygous lines, D1 and D6, were obtained in the T1 generation for subsequent analysis.
[0038] for OsOle4 Overexpression of transgenic rice, the CTAB method was used to extract the DNA of the leaves of T0 generation plants, and the primers Primer7 and Primer8 were used for conventional PCR amplification and then gel electrophoresis detection was performed to screen the T0 generation positive plants ( Figure 2 The transgenic plants were harvested and planted to obtain T1 generation positive transgenic seedlings.
[0039] (3) Analysis of transgenic rice traits for OsOle4 Gene-edited rice, homozygous mutation OsOle4-KO1 and OsOle4-KO2 Observations throughout the rice's growth period revealed that key growth stages, such as flowering and grain filling, were essentially identical in timing. Important agronomic traits, such as plant height, tiller number, panicle length, and seed setting rate, grain length, grain width, and 1,000-grain weight, were comparable to those of the parental control. OsOle4 The mutation had no significant effect on the growth and development of rice.
[0040] For CRISPR / Cas9 gene-edited rice, harvesting homozygous mutations OsOle4-KO1 and OsOle4-KO2 The seeds of the rice were used. Brown rice and polished rice were ground into powder using a mill (FOSS, Denmark). Large particles of rice flour were sieved through a 100-mesh sieve. The triglyceride content of the samples was determined using the CheKine™ Triglyceride (TG) Assay Kit (microassay). Triglycerides were extracted with isopropanol, saponified with potassium hydroxide, and then hydrolyzed to produce glycerol and fatty acids. Glycerol was oxidized with periodic acid to produce formaldehyde. In the presence of chloride ions, the formaldehyde condensed with acetylacetone to produce a yellow substance with an absorbance peak at 420 nm.
[0041] After analyzing the experimental data, OsOle4The triglyceride content of the two mutants in brown rice and polished rice was extremely significantly reduced, decreasing by more than 10% compared with the parent control, and the trends in brown rice and polished rice were basically the same ( Figure 3 A and B in the figure).
[0042] for OsOle4 For the gene-edited rice lines, after hulling, roughing and polished rice extraction, 20.0 g of polished rice sample was accurately weighed and placed in a special aluminum container. After washing with running water for 30 seconds, the outer wall of the container was wiped dry and distilled water was added to a total weight of 55 g (rice-to-water ratio of 1:1.4). The rice was steamed in a unified electric rice cooker for 30 minutes. After steaming, the rice was cooled at room temperature for 1 hour. 8.0 g of cooled rice was put into a metal ring, flattened on both sides for 8 seconds, and then placed in a rice taste meter calibrated with black and white standards for measurement. Each sample was measured 5 times, and the average of the positive and negative measurement values was taken as the single repetition result. The average of the 5 repetitions was taken as the taste quality index of the sample.
[0043] for OsOle4 For gene-edited rice, 8.0 g of the cooked rice was weighed and placed in a circular metal ring. After flattening it by pressing back and forth, the entire rice ball was carefully removed and placed on a test plate. The texture properties were measured using a TA-XT texture analyzer (Texture Technologies Corp, Scarsdale, NY / Stable Micro Systems, Godalming, Surrey, UK). The test procedure used a TPA.P / 36R probe, a compression level of 90%, and a speed of 5.0 mm / s before, during, and after the test. The hardness (HD) and adhesiveness (ADH) parameters were analyzed using the system's built-in software (Texture Expert software program, Version 5.16). For improved accuracy, each sample was measured six times, and the average value was calculated.
[0044] Through the analysis of experimental data, it can be found that OsOle4 The taste of rice in the mutant rice was significantly higher than that in the parental control ( Figure 4 ), and the taste values of the two mutants were comparable. To further clarify this result, the texture characteristics of the rice were analyzed using a physical property analyzer, and it was found that the hardness of the two mutants increased significantly, and the viscosity decreased significantly. The above results indicate that by knocking out OsOle4 It can significantly improve the taste of rice.
[0045] for OsOle4Analysis of agronomic traits of the gene-edited lines revealed that, compared with the parental control, the timing of key growth nodes such as flowering and grain filling was essentially synchronized during the rice growth and development cycle. Furthermore, there were no significant differences in important agronomic traits such as plant height, number of tillers, seed setting rate, grain length, grain width, and 1000-grain weight. This suggests that OsOle4 The gene mutation has no obvious effect on the growth and development of rice.
[0046] for OsOle4 Overexpression of transgenic rice, after analysis of experimental data, overexpression plants OsOle4-OE1 and OsOle4-OE2 The triglyceride content is higher than that of its parent Nip, and it shows a significant increase in both brown rice and polished rice ( Figure 5 A and B).
[0047] for OsOle4 The overexpression of transgenic rice was found through experimental data analysis. OsOle4-OE1 and OsOle4- OE2 The taste value was significantly higher than that of the parent control Nip ( Figure 6 A and B in the figure). Further analysis of the textural properties of rice revealed that the hardness of the overexpressed transgenic rice decreased while the viscosity increased, indicating that the upregulation of OsOle4 Gene expression also improves the taste of rice, and also indicates that there is a complex regulatory relationship between lipid content and composition and rice quality.
[0048] right OsOle4 Gene-edited lines of seeds and OsOle6 Activity analysis was performed on the seeds of the gene-edited lines. Selected seeds were rinsed 2-3 times with clean water to remove surface dust and impurities. The soaked seeds were sterilized in a 0.1% sodium hypochlorite solution for 10 minutes and then rinsed 3-4 times with sterile water. Moistened filter paper was used as the germination bed. The filter paper was spread flat on a Petri dish and an appropriate amount of distilled water was added to fully moisten the filter paper without stagnant water. Fifty seeds were placed in each Petri dish, with a certain distance between the seeds to avoid mutual influence. The Petri dishes were placed in a constant temperature incubator set to 28°C, 75% humidity, and maintained in darkness. The seeds were observed regularly daily and an appropriate amount of distilled water was added to ensure that the filter paper remained moist. From the start of the experiment, seed germination was observed regularly daily, and the germination rate, radicle, and plumule growth length were recorded. The germination standard was that the radicle broke through the seed coat and extended to half the seed length. The data was recorded and photographed for archiving.
[0049] After analyzing the experimental data, it was found that the different days after seed germination were the same as those of the parent control, and did not affect the seed germination rate ( Figure 7 A), and OsOle6The germination of the gene-edited seeds was significantly slowed down, with the germination rate being less than 50% from 3 to 5 days after germination, while the parent control had reached 80% ( Figure 7 At the same time, by comparing the seedlings 6 days after germination, OsOle4 The seedlings of the gene-edited line germinated normally ( Figure 7 C), and OsOle6 The elongation of seedlings of the gene-edited lines was significantly shorter ( Figure 7 D), description OsOle6 The significant decrease in lipid content in the seeds of the gene-edited lines had a significant impact on seed vigor. OsOle4 The gene mutation had no significant effect on rice seed vigor.
[0050] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.
[0051] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.
[0052] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.
Claims
1. Rice oleosin gene OsOle4 The application of the method in breeding rice lines with reduced or increased fatty acid content is characterized in that: The oleosin gene OsOle4 The nucleotide sequence of the rice oil body protein gene is shown in SEQ ID No.
1. OsOle4 Reducing fatty acid content in rice by overexpressing the rice oleosin gene OsOle4 The fatty acid content of rice is increased without affecting the vitality of rice seeds.
2. The use according to claim 1, characterized in that The oleosin gene OsOle4 The encoded amino acid sequence is shown in SEQ ID No.
2.
3. The use according to claim 1, characterized in that The knockout was performed using the CRISPR / Cas9 system.
4. The use according to claim 1, characterized in that The overexpression vector used in the overexpression process is Gt1-OsOle4, which contains the gene OsOle4 The vector is a universal plant expression vector pCAMBlA1300, which includes a promoter 1.8 kb upstream of the transcription start site of the rice endosperm-specific expression gene OsGt1.
5. The use according to claim 4, characterized in that OsOle4 The preparation method of gene overexpression vector is as follows: OsOle4 The gene amplification primer pair uses Nipponbare genomic DNA as a template to amplify the OsOle4 The coding sequence was mixed with the linearized pCAMBlA1300-Gt1 vector DNA fragment and ligated using homologous recombination method.
6. The use according to claim 5, characterized in that The primer sequences for the amplification are as follows: Primer3:5'TAGTCCTACAACAACGGATCCATGGCCGGTGGTGGAGG'; Primer4:5'CGATCGGGGAAAATTCGAGCTCAGATGTCGCCGTACCAGCAA'.
Citation Information
Patent Citations
Rice oleosin gene OsOle6 as well as encoding protein and application thereof
CN114990134A