AcBBX19 gene and application thereof in regulating and controlling ester aroma of fruits
By overexpressing or silencing the AcBBX19 gene in kiwi fruits, the formation of ester aroma is regulated, and the problem of insufficient research on fruit aroma synthesis in the prior art is solved, and a new storage-resistant kiwi fruit germplasm is created under genetic improvement.
Patent Information
- Application Number
- CN202510946868.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-07-10
AI Technical Summary
In the prior art, there are few studies on the influence of BBX protein on fruit aroma synthesis, lack of clear regulatory mechanisms, and it is difficult to create storage-resistant new kiwi fruit germplasm through genetic improvement.
The kiwi fruit AcBBX19 gene and its encoded protein are provided, and the formation of ester aroma is regulated in kiwi fruit by constructing recombinant overexpression and transient silencing vectors using Agrobacterium-mediated transformation method.
The precise regulation of the ester aroma content in kiwi fruits through genetic engineering technology is achieved, and the theoretical basis and technical means for creating new kiwi fruit germplasms resistant to storage are provided.
Smart Images

Figure CN120442655A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically, relates to the AcBBX19 gene and its application in regulating the aroma of fruit esters. Background Art
[0002] When kiwifruit is unripe, its aroma is primarily composed of C6 alcohols and aldehydes. As the fruit matures and softens, the aldehyde and alcohol content gradually decreases, while ester aroma components such as methyl butyrate, ethyl butyrate, and ethyl acetate rapidly increase. Aroma synthesis in kiwifruit primarily relies on fatty acid metabolism, a process involving two key pathways: lipoxygenase and β-oxidation. Fatty acids in the fruit are catalyzed by fatty acid desaturase to produce unsaturated fatty acids such as linoleic acid and linolenic acid. The 1,4-isoprene structure of unsaturated fatty acids such as linoleic acid and linolenic acid is recognized by lipoxygenase and oxidized to form peroxyhydroxy fatty acids. Hydroperoxide lyase cleaves the peroxyhydroxy fatty acids into oxoacids and aldehydes. Alcohol dehydrogenase then acts on the aldehydes, reducing them to the corresponding alcohols. Alcohol acyltransferase catalyzes the conversion of these alcohols into esters. Fatty acids can also produce C6 and C9 acids through β-oxidation. These substances, under the action of reductase, generate corresponding aldehydes. Under the action of alcohol dehydrogenase, the aldehydes are catalyzed into corresponding alcohols, and then, under the action of alcohol acyltransferase, they generate ester aroma components. During the post-harvest ripening process of kiwifruit, the content of ester aroma shows a significant upward trend. This process is accompanied by the enhancement of the activities of lipoxygenase, hydroperoxide lyase, alcohol dehydrogenase, and alcohol acyltransferase, among which the increase in alcohol acyltransferase activity is the most significant.
[0003] B-box proteins, abbreviated as BBX, are a group of zinc-finger transcription factors. BBX proteins play a key role in regulatory networks controlling various growth and developmental processes. Recent studies have revealed additional roles for BBX proteins in various biological processes, including anthocyanin accumulation, carotenoid biosynthesis, and fruit ripening and softening. However, studies investigating the effects of BBX proteins on fruit aroma synthesis are limited. Therefore, clarifying the regulatory mechanism of the AcBBX19 gene provides a key breakthrough for the precise creation of new kiwifruit germplasm with storage stability through genetic improvement. Summary of the Invention
[0004] The purpose of the present invention is to provide the AcBBX19 gene and its application in regulating the ester aroma of fruits.
[0005] To achieve the above object, the technical solution adopted by the present invention is: The present invention provides a kiwifruit AcBBX19 gene for regulating the ester aroma of the fruit. The nucleotide sequence of the kiwifruit AcBBX19 gene is shown in SEQ ID NO.3.
[0006] The present invention cloned the differentially expressed gene AcBBX19 related to ester formation in kiwifruit, and found that transient overexpression of the AcAAT1 gene in red kiwifruit can reduce the content of ester aroma substances, while transient silencing of the AcAAT1 gene can increase the content of ester aroma substances.
[0007] The present invention also provides a recombinant overexpression vector comprising the above-mentioned kiwifruit AcBBX19 gene.
[0008] The present invention also provides a recombinant cell comprising the above-mentioned recombinant overexpression vector.
[0009] The present invention also provides a recombinant transient silencing vector, which comprises a specific fragment for silencing the kiwifruit AcBBX19 gene.
[0010] The present invention also provides the use of the kiwifruit AcBBX19 gene in regulating the formation of ester aroma in kiwifruit fruits.
[0011] Furthermore, the content of kiwifruit ester aroma substances is reduced by increasing the expression of the kiwifruit AcBBX19 gene.
[0012] Furthermore, the content of kiwifruit ester aroma substances is increased by reducing the expression of the kiwifruit AcBBX19 gene.
[0013] The present invention also provides use of the recombinant overexpression vector and the recombinant cell in reducing the formation of ester aroma substances in kiwi fruit.
[0014] The present invention also provides application of the recombinant transient silencing vector in promoting the formation of ester aroma substances in kiwi fruit.
[0015] The present invention has the following beneficial effects: The present invention provides a kiwifruit AcBBX19 gene related to the formation of ester aroma and the protein it encodes, and constructs an overexpression vector and a transient silencing vector of the kiwifruit AcBBX19 gene. The overexpression vector and the transient silencing vector containing the kiwifruit AcBBX19 gene are transferred into kiwifruit fruit by Agrobacterium-mediated transformation. The results show that overexpression or silencing of the kiwifruit AcBBX19 gene can reduce or increase the content of ester aroma substances in kiwifruit fruit. It can be seen that the kiwifruit AcBBX19 gene described in the present invention can regulate the formation of ester aroma. The present invention utilizes genetic engineering technology to provide a theoretical basis and technical means for accurately creating new storage-resistant kiwifruit germplasm through genetic improvement, and has very important application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 Figure 2 is the result of PCR amplification of AcBBX19 gene.
[0017] Figure 2 This is a graph showing the aroma ester content and AcBBX19 expression level of postharvest kiwifruit.
[0018] Figure 3 Figures 2 and 3 are the detection results of kiwifruit fruits with transient overexpression and silencing of the AcBBX19 gene, among which A is the identification result of AcBBX19 expression in kiwifruit fruits with transient overexpression of the AcBBX19 gene, B is the analysis of ester aroma content in kiwifruit fruits with transient overexpression of the AcBBX19 gene, C is the identification result of AcBBX19 expression in kiwifruit fruits with transient silencing of the AcBBX19 gene, and D is the analysis of ester aroma content in kiwifruit fruits with transient silencing of the AcBBX19 gene.
[0019] Figure 4 This is the result of a yeast one-hybrid experiment on the binding between the kiwifruit transcription factor AcBBX19 and the promoter of the ester aroma formation gene AcAAT1.
[0020] Figure 5 This is a schematic diagram of the results of kiwifruit transcription factor AcBBX19 inhibiting the promoter activity of the ester aroma forming gene AcAAT1, where different lowercase letters indicate significant differences between groups. p <0.05. DETAILED DESCRIPTION
[0021] The present invention is described in detail below with reference to specific examples, but these examples should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0022] Example 1: Acquisition of the AcBBX19 gene sequence.
[0023] Total RNA was extracted from Donghong kiwifruit pulp using a polysaccharide and polyphenol plant total RNA extraction kit, and reverse transcribed into cDNA using a PrimeScript RT-reagent kit. Using the resulting cDNA as a template, primers for full-length amplification of AcBBX19 were designed, and PCR amplification was performed using a high-fidelity PCR enzyme. The primers for full-length amplification of AcBBX19 are listed in Table 1.
[0024] Table 1: Primers for amplifying the full-length sequence of AcBBX19
[0025] The PCR amplification system is shown in Table 2 Table 2: PCR amplification system
[0026] The PCR amplification program was as follows: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 10 s; annealing at 55°C for 30 s; extension at 72°C for 30 s; return to the second step for 34 cycles; final extension at 72°C for 7 min; and storage at 4°C.
[0027] The products obtained by PCR amplification were detected by agarose gel electrophoresis. Figure 1 As shown, the specific band obtained is the kiwifruit AcBBX19 gene. After purification and recovery of the PCR product, it was ligated into a TA cloning vector and transformed into competent E. coli DH5α. Positive clones were screened and sequenced. Sequencing results showed that the AcBBX19 gene is 633 bp in length and encodes 210 amino acids. The AcBBX19 gene sequence is shown in SEQ ID NO. 3, and the encoded amino acid sequence is shown in SEQ ID NO. 4.
[0028] SEQ ID NO.3: ATGAGAACGCTTTGCGACGTTTGTGAGAGCGCCGCCGCGATCCTCTTCTGCGCGGCCGACGAGGCTGCTCTTTGCCGTTCTTGCGACGATAAGGTTCATATGTGTAACAAGCTTGCTAGTCGTCATGTACGTGTTGGGCTAGCTAGCCCTAGTGATGTTCCCCGGTGTGACATATGTGAAAATGCACCTGCTTTCTTCTACTGCGAGGTCGATGGTACTTCCCTTTGTCTGCAATGTGATATGATTGTACATGTTGGGGGTAAAAGAACACATGAAAGATACCTCCTAATGAGGCAGAGAGTTGAGTTTCCAGGTGATAAACCTAGTTGCATTGATGAGCTAGGTCCACAACCTTGTGAAGTGGGTCAAATTAGGAGGGAACAAAATCAGCTACGTAGGCCTACAATGAGAGAGAACCAGCAAAATCACATGGTGTCTGCTGTTCCAGTGCTAGACTCAAATATTGGTGGCAAGATAGAGAATAGAATGATTGATCTTAATGCCAAGCCCCAACGTCCACATGGGCAGGCTTCAAACAATCAGGAACAAGGAATGGTTGTTCAAAGTGAGGCTAATCATGAATCTTCTGGAGTGGTTCCTATTGGATCCTTCAAGAGAGAGCTTGAGAAGTGA。
[0029] SEQ ID NO.4: MRTLCDVCESAAAILFCAADEAALCRSCDDKVHMCNKLASRHVRVGLASPSDVPRCDICENAPAFFYCEVDGTSLCLQCDMIVHVGGKRTHERYLLMRQRVEFPGDKPSCIDELGPQPCEVGQIRREQNQLRRPTMRENQQNHMVSAVPVLDSNIGGKIENRMIDLNAKPQRPHGQASNNQEQGMVVQSEANHESSGVVPIGSFKRELEK。
[0030] Example 2: AcBBX19 gene expression analysis.
[0031] The aroma ester content and AcBBX19 gene expression of Donghong kiwifruit were determined on days 0, 2, 4, 6, 8, and 10 after harvest.
[0032] Approximately 0.5 g of kiwifruit sample was collected from a -80°C ultra-low temperature freezer, ground into a fine powder with liquid nitrogen, and placed in a 20 mL headspace vial. A saturated sodium chloride solution at a concentration of 0.4 g / mL and 20 µL of a 10 µg / mL 3-hexanone solution were added to the vial, which was immediately sealed with a polytetrafluoroethylene / silicone rubber gasket. The sample was extracted using a fully automated headspace solid-phase microextraction (SPME) system for GC-MS analysis. The headspace vial was placed in a magnetic stirrer and shaken at 60°C for 5 minutes. A 120 µm DVB / CARWR / PDMS extractor was then inserted into the headspace vial. Adsorption and extraction were performed at 60°C for 15 minutes, followed by desorption at 250°C for 5 minutes. Volatile organic compounds were then separated and identified using a triple quadrupole gas chromatography-mass spectrometry system. The system used a DB-5MS capillary column with dimensions of 30 m × 0.25 mm × 0.25 µm. High-purity helium (≥99.999%) was used as the carrier gas at a constant flow rate of 1.2 mL / min. The inlet temperature was set at 250°C, with splitless injection and a solvent delay time of 3.5 minutes. A temperature program was then used: the temperature was initially maintained at 40°C for 3.5 minutes, then increased to 100°C at a rate of 10°C / min. The temperature was then increased to 180°C at a rate of 7°C / min, and finally rapidly increased to 280°C at a rate of 25°C / min, where it was held for 5 minutes. Mass spectrometry was performed using an electron impact ion source with a source temperature of 230°C, a quadrupole temperature of 150°C, a mass spectrometer interface temperature of 280°C, and an electron energy of 70 eV, using ion detection mode. The raw data from mass spectrometry analysis were processed using MassHunter software for qualitative and quantitative analysis. The relative content of ester compounds in the sample was determined by comparing the electron ionization mass spectrometry results of the ester compounds with the results of the NIST-2017 mass spectral library and the retention time of the standards.
[0033] qRT-PCR analysis was performed using a CFX196-Touch fluorescent quantitative PCR instrument. A 10-µL reaction system was used. 3.4 µL of ddH2O, 0.3 µL of each specific upstream and downstream primer, 5 µL of 2× Realtime-PCR-Super-mix, and 1 µL of template DNA were added to an RNase-free centrifuge tube. The reaction procedure was as follows: 95°C for 30 s; 95°C for 5 s; 60°C for 30 s; and 72°C for 45 s, repeated for 40 cycles. Gene relative expression was expressed as -2 △△Ct The specific upstream and downstream primers are shown in Table 3.
[0034] Table 3: qPCR primer sequences
[0035] The results are as follows Figure 2 As shown in the data, as Donghong kiwifruit fruits mature and soften after harvest, the content of ester aroma substances in the fruits gradually increases, while the relative expression level of AcBBX19 gradually decreases, and the two show a negative correlation trend.
[0036] Example 3: Functional study of the AcBBX19 gene.
[0037] 1. AcBBX19 gene overexpression in kiwifruit.
[0038] 1. Overexpression vector construction: Use the one-step rapid cloning kit to insert the SEQ ID NO.3 sequence into the overexpression vector PBI121. Nde I and BamH I restriction enzyme cutting site, and the AcBBX19-PBI121 overexpression recombinant plasmid was obtained. The PBI121 empty vector and AcBBX19-PBI121 were respectively transformed into Agrobacterium competent GV3101 by freeze-thaw method.
[0039] 2. Experimental method: Pick up the transformed Agrobacterium and transfer it to 1 mL of LB liquid medium with cannabinoid resistance, shake it overnight at 28℃. The next day, take 0.2 mL of Agrobacterium and transfer it to 6 mL of LB liquid medium, shake it at 28℃ for 9 hours, and adjust the OD value to 0. 600 The value reached 0.8. At room temperature, the bacteria were collected by centrifugation at 4000 rpm for 10 minutes. After resuspension, the OD value was adjusted to 0.8, and the resuspended Agrobacterium was allowed to stand for about 3 hours. The bacterial solutions containing the PBI121 empty vector and the AcBBX19-PBI121 plasmid were injected into the stele of Donghong kiwifruit fruits on the day of harvest. The SK group was injected with the bacterial solution containing the PBI121 empty vector plasmid, and the AcBBX19-OE group was injected with the bacterial solution containing the AcBBX19-PBI121 plasmid. Each fruit was injected with 0.2 mL of bacterial solution. The expression level of the AcBBX19 gene in the kiwifruit and the ester aroma content at the injection site were measured 3 days after injection.
[0040] 3. Experimental results: Figure 3 As shown in Figure A, after overexpression of the AcBBX19 gene in kiwifruit, the relative expression level of AcBBX19 increased significantly, indicating that the gene was successfully overexpressed. The total ester aroma compound content in the fruit overexpressing the AcBBX19 gene was determined, as shown in Figure 4. Figure 3 As shown in Figure 3B, overexpression of the AcBBX19 gene significantly reduced the content of ester substances.
[0041] 2. AcBBX19 gene transiently silenced kiwifruit.
[0042] 1. Construction of VIGS silencing vector: A 442 bp specific fragment was obtained from SEQ ID NO.3, whose sequence is shown in SEQ ID NO.9, and inserted into the pTRV2 vector. BamH I and Xba I between the two restriction enzyme cutting sites to obtain AcBBX19-pTRV2 recombinant plasmid, the pTRV1+pTRV2 group was prepared by mixing pTRV1 and pTRV2 in a mass ratio of 1:1 and then transferring them into the Agrobacterium competent GV3101 by the freeze-thaw method, and the pTRV1+AcBBX19-pTRV2 group was prepared by mixing pTRV1 and AcBBX19-pTRV2 in a mass ratio of 1:1 and then transferring them into the Agrobacterium competent GV3101 by the freeze-thaw method.
[0043] SEQ ID NO.9: TCCCGAGGAATCCAATGCTGAACCACGAGTTTTCTCATGCAACTATTGTCAAAGAAAATTCTTCAGTTCACAAGCACTTGGAGGGCACCAAAATGCTCACAAGAGAGAGGACTCTAGCAAAAAGAGGACTTAAAATAGGGTCACCTCTCGGGCACTCCCACTCATACCATCAGCAGCACCACTATTCTAGCATGTCTAGTCTTCCTCTCCATGGTGC TTATAATAGGAGTCTTGGAATTCAAGTCCACTCAATGATCCATAAACCCTCTTATATACCAAGTTCTTCTGGGATTAGGGGTATTTATGGACATGGTGGATGGTTTAGGCATCCGATTGACCAACAACCAGCTATAGGGAAGCTAGCAGCAGAGAGTTGCCATGGAAATTCATCAACAGGACTGTCAACTCAAGGCAGAGCCGGTAGATTCGGCACGGTAAGG.
[0044] 2. Experimental Methods: The bacterial suspensions from the pTRV1+pTRV2 group and the pTRV1+AcBBX19-pTRV2 group were injected into the stele of harvested kiwifruit, with 0.2 mL injected per fruit. The expression of the AcBBX19 gene and the aroma ester content at the injection site were measured 3 days after injection.
[0045] 3. Experimental results: Figure 3As shown in Figure C, after silencing the AcBBX19 gene in kiwifruit, the relative expression level of AcBBX19 was significantly reduced, indicating that the gene was successfully silenced transiently. The content of ester aroma substances in fruits with silenced AcBBX19 gene was determined, as shown in Figure 4. Figure 3 As shown in D, silencing the AcBBX19 gene significantly increased the content of ester aroma substances.
[0046] Example 4: AcBBX19 directly negatively regulates the expression of kiwifruit ester aroma forming genes.
[0047] 1. Yeast one-hybrid assay.
[0048] Insert the AcAAT1 promoter sequence SEQ ID NO.10 into the pHIS2 vector Sac I and Mlu I between the two restriction sites, obtain proAcAAT1-pHIS2 recombinant plasmid; insert SEQ ID NO.3 into the pGADT7 vector Nde I and BamH I, the recombinant plasmid AcBBX19-pGADT7 was obtained. Four combinations of AcBBX19-pGADT7 + proAcAAT1-pHIS2, AcBBX19-pGADT7 + pHIS2, pGADT7 + proAcAAT1-pHIS2, and pGADT7 + pHIS2 were co-transformed into yeast strain Y187 and plated onto SD-TL or SD-TLH + 5 mM 3AT-deficient medium, respectively. The cells were placed in a 30°C incubator protected from light for 5 days, and yeast growth was monitored.
[0049]
[0050] The results are as follows Figure 4 As shown, neither pGAD7+proAcAAT1-pHIS2 nor pGAD7+pHIS2 yeast cells grew in SD-TLH+5mM 3AT medium. This indicates that 5mM 3-amino-1,2,4-triazole (3AT) inhibits the activation of the AcAAT1 promoter. AcBBX19-pGAD7+proAcAAT1-pHIS2 grew well in SD-TLH+5mM 3AT medium, demonstrating that the transcription factor AcBBX19 binds to the AcAAT1 promoter.
[0051] 2. Tobacco dual luciferase assay.
[0052] Insert the SEQ ID NO.10 sequence into the pGreenII 0800-LUC vector Xho I and Sal I enzyme cutting site, obtain proAcAAT1-LUC recombinant plasmid, insert SEQ ID NO.3 into pGreenII-0029-62-SK vector Spe I and Xma The recombinant plasmid AcBBX19-SK was obtained between the restriction enzyme cutting sites I. The recombinant plasmid was transformed into Agrobacterium competent GV3101 using the freeze-thaw method.
[0053] After successful transformation, the bacterial suspension was resuspended and adjusted to an OD value of approximately 0.6. The resuspended Agrobacterium was allowed to rest for 3 hours. Selected tobacco plants in good growth were then injected with the bacterial suspension. The ST group received an empty plasmid-containing suspension, while the AcBBX19 group received a suspension containing the proAcAAT1-LUC and AcBBX19-SK plasmids. The injected tobacco plants were cultured under low light for 2 days. The intensity of firefly luciferin (LUC) and Renilla luciferin (REN) was measured. The regulatory effect of the transcription factor on the target promoter was expressed as the LUC / REN ratio.
[0054] The results are as follows Figure 5 As shown in the results, AcBBX19 could significantly inhibit the expression of LUC reporter gene driven by the AcAAT1 promoter, indicating that AcBBX19 could directly negatively regulate the activity of the AcAAT1 promoter.
[0055] In summary, the content of ester aroma compounds increases during postharvest ripening and softening in kiwifruit, while expression of the AcBBX19 gene is downregulated, indicating that the transcription factor AcBBX19 is negatively correlated with the formation of ester aroma in kiwifruit. Transient overexpression and silencing of the AcBBX19 gene in kiwifruit inhibit and promote ester aroma formation, respectively. AcBBX19 was also found to directly bind to the promoter of the kiwifruit ester aroma gene AcAAT1 and inhibit its transcriptional activity. This indicates that the kiwifruit transcription factor AcBBX19 described in this paper can regulate the formation of ester aroma in the fruit, providing a theoretical basis for understanding the mechanism of ester aroma formation during kiwifruit ripening. It also provides genetic resources for the precise creation of new kiwifruit germplasm with strong aroma and good storage stability through genetic improvement, thus possessing important application value.
[0056] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
Claims
1. A kiwifruit AcBBX19 gene for regulating fruit ester aroma, characterized in that: The nucleotide sequence of the kiwifruit AcBBX19 gene is shown in SEQ ID NO.
3.
2. A recombinant overexpression vector, characterized in that: It comprises the kiwifruit AcBBX19 gene according to claim 1.
3. A recombinant cell, characterized in that It comprises the recombinant overexpression vector according to claim 2.
4. A recombinant transient silencing vector, characterized in that: The recombinant transient silencing vector comprises a specific fragment for silencing the kiwifruit AcBBX19 gene according to claim 1.
5. Use of the kiwifruit AcBBX19 gene according to claim 1 in regulating the formation of ester aroma in kiwifruit fruit.
6. The use according to claim 5, characterized in that The content of kiwifruit ester aroma substances is reduced by increasing the expression of the kiwifruit AcBBX19 gene.
7. The use according to claim 5, characterized in that The content of kiwifruit ester aroma substances is increased by reducing the expression of the kiwifruit AcBBX19 gene.
8. Use of the recombinant overexpression vector according to claim 2 and the recombinant cell according to claim 3 in reducing the formation of ester aroma substances in kiwi fruit.
9. Use of the recombinant transient silencing vector according to claim 4 in promoting the formation of ester aroma substances in kiwi fruit.
Citation Information
Patent Citations
Transcription factor PpNAC1 participating in synthesis regulation of peach ester aromatic substances and application of transcription factor PpNAC1
CN109913469A
Kiwi fruit transcription factor AcNAC4 and application thereof in synthesis of fruit ester aromatic substances
CN113088525A
AcAAT1 gene and application thereof in regulation and control of formation of fruit ester aroma
CN119614598A
Regulating the ethylene response of a plant by modulation of F-box proteins
US20060200875A1