Application of OsCPS2 gene in regulation and control of salt stress resistance of plants

Abstract

The invention discloses application of an OsCPS2 gene in regulating and controlling salt stress resistance of plants, and belongs to the technical field of biology. The expression quantity of the OsCPS2 gene is increased, and the salt stress resistance of the plant is improved; when the expression quantity of the gene is reduced, the salt stress resistance of the plant is reduced. By revealing the key effect of the OsCPS2 gene in regulating and controlling the plant to resist salt stress, an important theoretical basis and a technical means are provided for improvement of crop stress resistance, understanding of the OsCPS2 gene in responding to a plant salt stress mechanism is deepened, a new molecular target and a new genetic resource are provided for crop stress resistance breeding, and the application of the OsCPS2 gene in regulating and controlling the plant to resist salt stress is provided. The method has important scientific value and practical significance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of OsCPS2 gene in regulating the ability of plants to resist salt stress. Background Art

[0002] Salt stress is a major abiotic stress factor restricting crop production, affecting plant growth and development through multiple pathways. Physiologically, salt stress disrupts photosynthesis and transpiration, interfering with water and mineral nutrient transport. Morphologically, it leads to phenotypic defects such as decreased germination rate, reduced plant height, and fewer tillers. As a salt-sensitive crop, understanding the salt tolerance mechanisms of rice is crucial for unlocking its potential for stress resistance.

[0003] CPSs are the first key enzymes in the synthesis of active diterpenoid metabolites. Three functional OsCPSs have been identified in rice: OsCPS1, OsCPS2, and OsCPS4. OsCPS2 catalyzes the conversion of GGPP to ent-CPP and participates in the synthesis of diterpenoid active molecules such as phytocassanes. It has been shown to respond to various biotic and abiotic stresses, including rice blast, bacterial blight, and drought. However, research on OsCPS2 in rice salt stress is relatively limited. Therefore, in-depth research on the mechanisms linking the OsCPS2 gene to salt stress in rice can provide new genetic resources and molecular targets for genetic improvement of crop stress resistance. Summary of the Invention

[0004] The present invention aims to provide applications of the OsCPS2 gene for regulating plant resistance to salt stress, thereby addressing the aforementioned problems in the prior art. By revealing the key role of the OsCPS2 gene in regulating plant resistance to salt stress, the present invention provides an important theoretical basis and technical means for improving crop stress resistance. This not only deepens our understanding of the mechanism by which the OsCPS2 gene responds to plant salt stress, but also provides new molecular targets and genetic resources for crop stress resistance breeding, thus possessing significant scientific value and practical significance.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides the use of the OsCPS2 gene and related biological materials in regulating the ability of plants to resist salt stress. When the expression level of the OsCPS2 gene is increased, the ability of the plant to resist salt stress is improved; when the expression level of the gene is reduced, the ability of the plant to resist salt stress is reduced. The nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0007] Optionally, the relevant biological material includes a protein encoded by the OsCPS2 gene, a recombinant vector or a recombinant microorganism containing the OsCPS2 gene.

[0008] Optionally, the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0009] Optionally, the plant comprises rice.

[0010] The present invention also provides a method for improving the ability of plants to resist salt stress, comprising the steps of introducing an OsCPS2 gene into the plant to stably overexpress the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0011] Optionally, the plant comprises rice.

[0012] The present invention also provides the use of the OsCPS2 gene and related biological materials in cultivating plants with high salt stress resistance. The nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0013] Optionally, the plant comprises rice.

[0014] The present invention also provides a method for cultivating plants with high salt stress resistance, comprising the steps of introducing the OsCPS2 gene into the plant to obtain a plant capable of stably overexpressing the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1.

[0015] Optionally, the plant comprises rice.

[0016] The present invention discloses the following technical effects:

[0017] The present invention provides an important theoretical basis and technical means for improving crop stress resistance by revealing the key role of the OsCPS2 gene in regulating plant resistance to salt stress. The present invention shows through biological experiments that increasing the expression of the OsCPS2 gene can significantly enhance the salt tolerance of rice, which is specifically manifested in improved survival rate, increased water content and enhanced phenotypic recovery ability under salt stress conditions. The survival rate of the overexpression strain after salt stress treatment is about 20% higher than that of the wild type, and it shows better recovery growth ability. At the same time, this gene regulates Na + and K + The accumulation of Na + / K + These findings provide new molecular targets and genetic resources for breeding salt-tolerant crop varieties.

[0018] The application of the present invention is not limited to rice, but can also be extended to other salt-sensitive crops, with broad agricultural application prospects. Through CRISPR / Cas9 technology and overexpression vector construction, efficient editing and expression regulation of the OsCPS2 gene are achieved, providing reliable technical support for subsequent research and practical applications. In addition, the development of related biological materials (such as encoding proteins, recombinant vectors or microorganisms) further broadens the scope of application of this gene. In summary, the present invention not only deepens the understanding of the OsCPS2 gene's response mechanism to plant salt stress, but also provides new strategies and tools for crop stress resistance breeding, which has important scientific value and practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 The sequencing results of the OsCPS2 gene knockout strain at the editing target site;

[0021] Figure 2 is the gene expression analysis of OsCPS2 at different time points in the wild type under salt stress;

[0022] Figure 3 Figures show the phenotypes of wild-type Kitaake, Oscps2-27 and Oscps2-60 mutants, and OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing lines under normal conditions, after 14 days of salt stress treatment, and after 7 days of recovery.

[0023] Figure 4 Survival rate (A) and water content (B) analysis of wild-type Kitaake, Oscps2-27 and Oscps2-60 mutants, and OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing lines;

[0024] Figure 5 The OsCPS2 related genetic material is the Na + and K + Content analysis; A, B, and C are the aboveground Na content of wild-type Kitaake, Oscps2-27 and Oscps2-60 mutants, and OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing materials, respectively. + , K + Content and Na + / K +; D, E, F are the underground Na of wild-type Kitaake, Oscps2-27 and Oscps2-60 mutants and OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing materials respectively. + , K + Content and Na + / K + . DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The following examples are used to illustrate the present invention but are not intended to limit the scope of the invention. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 21), or according to the conditions recommended in the manufacturer's instructions. The main reagents in the following examples are: various restriction endonucleases, Taq DNA polymerase, T4 ligase, Pyrobest Taq enzyme, and KOD were purchased from biological companies such as NEB and Toyobo; dNTPs were purchased from Genestar; plasmid miniprep kits and agarose gel recovery kits were purchased from Shanghai Jierui Bioengineering Co.; agar powder, agarose, antibiotics such as ampicillin (Amp), kanamycin (Kan), gentamicin sulfate (Gen), and rifampicin (Rif), as well as glucose, BSA, and LB medium were purchased from Sigma, Bio-Rad, and other companies; reagents used for real-time quantitative PCR were purchased from TaKaRa. All other chemical reagents used in the examples were imported or domestically produced analytical grade reagents. The primers used in the examples were synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd., and the relevant sequencing was performed.

[0031] The carriers used in the following examples are:

[0032] pENTR-gRNA and pBY02-Cas9 are disclosed in the non-patent document “Large chromosomal deletions and heritable small genetic changes induced by CRISPR / Cas9 in rice”, Huanbin Zhou et al., Nucleic acids research, 2014, Vol. 42, No. 1710903–10914.

[0033] pBY02 is disclosed in the non-patent document "Gene targeting by the TAL effector PthXo2reveals cryptic resistance gene for bacterial blight of rice", Junhui Zhouet., The Plant journal: for cell and molecularbiology, The Plant Journal (2015) 82, 632-643.

[0034] Example 1 Construction and genetic transformation of rice OsCPS2 gene knockout and overexpression vectors

[0035] 1. Construction of rice OsCPS2 gene knockout vector

[0036] An OsCPS2 gene knockout vector was constructed using CRISPR / Cas9 technology. Sequence analysis of the rice OsCPS2 gene showed that the gene contains 12 exons. Two target sites were designed in the third exon, resulting in two types of OsCPS2 gene mutant rice. The target site sequences are as follows:

[0037] Target 1: GGGAATGGAAAACTTGGACTG, SEQ ID NO.3;

[0038] Target 2: GCTTACGCTCTCAGCGAAACA, SEQ ID NO.4.

[0039] The nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.1:

[0040] SEQ ID NO.1:

[0041]

[0042] The amino acid sequence of the protein encoded by this gene sequence is shown in SEQ ID NO.2:

[0043] SEQ ID NO.2:

[0044] MQMQVLTAASSLPRATLLRPAAAEPWRQSFLQLQARPIQRPGIMLHCKAQLQGQETRERRQLDDDEHARPPQGGDDDVAASTSELPYMIESIKSKLRAARNSLGETTVSAYDTAWIALVNRLDGGGERSPQFPEAIDWIARNQLPDGSWGDAGMFIVQDRLINTLGCVVALATWGVHEEQRARGLAYIQDNLWRLGEDDEEWMMVGFEITFPVLLEKAKNLGLDINYDDPALQDIYAKRQLKLAKIPREALHARPTTLLHSLEGMENLDWERLLQFKCPAGSLHSSPAASAYALSETGDKELLEYLETAINNFDGGAPCTYPVDNFDRLWSVDRLRRLGISRYFTSEIEEYLEYAYRHLSPDGMSYGGLCPVKDIDDTAMAFRLLRLHGYNVSSSVFNHFEKDGEYFCFAGQSSQSLTAMYNSYRASQIVFPGDDDGLEQLRAYCRAFLEERRATGNLMDKWVIANGLPSEVEYALDFPWKASLPRVETRVYLEQYGASEDAWIGKGLYRMTLVNNDLYLEAAKADFTNFQRLSRLEWLSLKRWYIRNNLQAHGVTEQSVLRAYFLAAANIFEPNRAAERLGWARTAILAEAIASHLRQYSANGAADGMTERLISGLASHDWDWRESKDSAARSLLYALDELIDLHAFGNASDSLREAWKQWLMSWTNESQGSTGGDTALLLVRTIEICSGRHGSAEQSLKNSADYARLEQIASSMCSKLATKILAQNGGSMDNVEGIDQEVDVEMKELIQRVYGSSSNDVSSVTRQTFLDVVKSFCYVAHCSPETIDGHISKVLFEDVN。

[0045] Based on the above target design, the corresponding sgRNA was synthesized. The present invention used the intermediate vector pENTR-gRNA for both gRNAs, which contains two cloning sites (BtgZI and BsaI) after the rice U6 promoter. For the BtgZI cloning site, the sense strand contained a 5'4-nt TGTT residue, and the antisense strand contained a 5'4-nt AAAC residue. For the BsaI cloning site, the sense strand contained a 5'4-nt GTGT residue, and the antisense strand contained a 5'4-nt AAAC residue.

[0046] The primers for synthesizing sgRNA1 are as follows:

[0047] gOsCPS2-1-F:5'-tgttGGGAATGGAAAACTTGGACT-3', SEQ ID NO.5;

[0048] gOsCPS2-1-R: 5'-aaacAGTCCAAGTTTTCCATTCCC-3', SEQ ID NO. 6.

[0049] The primers for synthesizing sgRNA2 are as follows:

[0050] gOsCPS2-2-F:5'-gtgtGCTTACGCTCTCAGCGAAAC-3', SEQ ID NO.7;

[0051] gOsCPS2-2-R: 5'-aaacGTTTCGCTGAGAGCGTAAGC-3', SEQ ID NO. 8.

[0052] Two sgRNA sequences were synthesized using annealing at 95°C for 10 minutes and 55°C for 10 minutes. The first sgRNA was cloned into the BtgZI restriction site, and the second was inserted into the BsaI restriction site. Sequencing was performed to verify the constructs. These two sgRNA fragments were then subcloned into the CRISPR vector pBY02-Cas9 using LR clonase. This generated an OsCPS2 gene knockout vector.

[0053] 2. Construction of rice OsCPS2 gene overexpression vector

[0054] The open reading frame of OsCPS2 was amplified from the cDNA of japonica rice Kitaake by PCR. The primer sequences are as follows:

[0055] Forward primer: ATCGATCTTGCATCTTGCGAGCACACG, SEQ ID NO. 9;

[0056] Reverse primer: TGTACCATCAAGTGAAACAAATATCGA, SEQ ID NO.10.

[0057] The PCR fragment was cloned into the KpnI and XbaI restriction sites of the vector pBY02, so that its expression was controlled by the maize ubiquitin 1 gene promoter, and the OsCPS2 gene overexpression vector was obtained.

[0058] The cloning primer sequences are as follows:

[0059] OsCPS2-F: CGGGGTACCATGCAGATGCAGGTGCTCACC, SEQ ID NO.11;

[0060] OsCPS2-R: GCTCTAGACTAATTGACATCCTCGAACA, SEQ ID NO. 12.

[0061] 3. Genetic transformation of OsCPS2 gene knockout and overexpression vectors in rice

[0062] Agrobacterium-mediated rice genetic transformation was used to transform immature embryonic callus cells of rice to create OsCPS2 gene knockout mutants and overexpression materials. The specific steps are as follows:

[0063] (1) Kitaake japonica rice seeds were used as the material. After removing the outer husk and disinfecting, they were placed in an induction medium and cultured in a light incubator at 28°C for 3 to 4 weeks. Then, naturally divided embryonic callus tissue was selected and placed in a subculture medium and cultured for another 7 days. After three subcultures, naturally dispersed, bright yellow granular callus tissue with a diameter of about 2-3 mm was selected for Agrobacterium transformation.

[0064] (2) The constructed OsCPS2 gene knockout vector and overexpression vector were transformed into Agrobacterium competent EHA105 by electroporation to obtain Agrobacterium suspension.

[0065] (3) Soak the callus obtained in step (1) in the Agrobacterium suspension of step (2), let it stand for 30-40 minutes, dry it on sterile filter paper, and inoculate it on the co-culture medium, and culture it in the dark at 25°C for 3 days.

[0066] (4) Collect the callus tissue obtained in step (3), wash it thoroughly with sterile water, and then wash it twice with sterile water containing 300 mg / L carbenicillin sodium. Finally, place it on sterile filter paper to drain; transfer the drained callus to a screening medium containing 300 mg / L carbenicillin sodium for the first round of screening, and culture it at 28°C under light for 14 days. Transfer the initial callus with resistant callus to a screening medium containing 300 mg / L carbenicillin sodium for a second round of screening until granular resistant callus grows.

[0067] (5) Transfer 3-7 calli obtained in step (4) to a differentiation tank containing differentiation medium, place it in a constant temperature culture room at 25°C, and when the seedlings grow to the top of the differentiation tank lid, place them in rooting medium to root and strengthen the seedlings. After 7 days, open the sealing film and add an appropriate amount of sterile water to prevent bacterial growth. Harden the seedlings for about 3 days until the seedlings stand upright, then wash off the agar, and culture in solution for 7-14 days before transplanting.

[0068] 4. Detection of gene knockout and overexpression strains

[0069] (1) Detection of OsCPS2 gene knockout strains

[0070] After the rice plants transplanted after transformation have formed ears, Reagent (Invitrogen) was used to extract genomic DNA (gDNA) from leaves of T0 transgenic rice seedlings for genotyping, and the amplification primer sequences were designed as follows:

[0071] Forward primer: ATATACTAACGAAATTGAAAAGGG, SEQ ID NO. 13;

[0072] Reverse primer: ACGGTTTTAAAGAGGAACAT, SEQ ID NO.14.

[0073] The PCR amplification products were processed with ExoSAPIT (Affymetrix, Santa Clara, CA, USA) and then subjected to Sanger sequencing.

[0074] The two homozygous knockout rice mutants obtained in the above steps were harvested and sown to obtain homozygous T1 generation mutants. To obtain homozygous plants with Cas9-free knockout, the present invention used the same genotyping method on the homozygous T1 generation transgenic rice. Homozygous mutant lines were screened for the Cas9 gene by PCR screening using the following primers:

[0075] Forward primer: GGGTAATGAACTCGCTCTGC, SEQ ID NO. 15;

[0076] Reverse primer: TGGCGTCAAGAACTTCCTTTG, SEQ ID NO.16.

[0077] The amplified products were sequenced by Sanger sequencing and no longer contained the exogenous Cas9 gene and sgRNA expression elements. Finally, two homozygous plants, OsCPS2-27 and OsCPS2-60, were obtained, which only retained the target gene knockout mutation. The sequencing results of the two OsCPS2 gene knockout lines at the editing target site are shown in the figure. Figure 1 shown.

[0078] (2) Detection of OsCPS2 gene overexpression lines

[0079] After the transformed rice plants were transplanted and set, semi-quantitative reverse transcription-polymerase chain reaction was used to confirm overexpression of the OsCPS2 gene. Three generations of screening were performed to obtain non-segregating homozygous CPS2-OE lines, OE-CPS2-4-4 and OE-CPS2-14-1. The semi-quantitative primer sequences for detecting OsCPS2 gene overexpression are as follows:

[0080] Forward primer OsCPS2-RT-F: ACGAGGAGTGGATGATGGTC, SEQ ID NO. 17;

[0081] Reverse primer OsCPS2-RT-R: GCTATGGAGCAAGGTGGTC, SEQ ID NO.18.

[0082] Example 2 Analysis of the expression pattern of OsCPS2 gene under salt stress

[0083] Wild-type japonica rice Kitaake seedlings grown to the two-leaf, one-heart stage were treated with 100 mM NaCl. 0.1 g of shoot and root tissues were collected at 0, 3, 6, 9, 12, 24, 36, and 48 hours, quickly frozen in liquid nitrogen, and used for OsCPS2 gene expression analysis. Total RNA from rice leaves and roots at different time points after salt treatment was extracted using Trizol reagent (Invitrogen, USA); cDNA was then synthesized using 5× All-in-One RT Master Mix (ABM, Canada); and TBGreen was used to generate the RNA. TM PreMix Ex Taq TM Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed on a QuantStudio 5 Real-Time PCR System (ABI, USA). The primer sequences for the quantitative detection of OsCPS2 are as follows:

[0084] qOsCPS2-F: 5'-CGAGGACGACGAGGAGTG-3', SEQ ID NO.19;

[0085] qOsCPS2-R: 5'-GGACTCAGGTGCCTGTAGGC-3', SEQ ID NO. 20.

[0086] OsActin was used as the internal reference gene, and the amplification primer sequences were as follows:

[0087] OsActin-F: 5'-CTCAGCACATCCAGCAGAT-3', SEQ ID NO. 21;

[0088] OsActin-R: 5'-ACAGATAGGCCGGTTGAAAA-3', SEQ ID NO. 22.

[0089] Each time point sample included three biological replicates, and each sample had three technical replicates; the data were obtained using 2 -ΔΔCt The data were analyzed by the fluorescence quantitative analysis method, and the results were given as mean ± standard deviation (Means ± SD).

[0090] The results are as follows Figure 2 As shown, NaCl treatment affected the expression of OsCPS2 in both the aboveground and underground parts. OsCPS2 expression in the underground part was induced to increase from 0 to 48 hours after treatment with 100 mM NaCl, reaching its peak at 24 hours. In contrast, expression in the aboveground part increased slightly and continuously from 0 to 48 hours after treatment with 100 mM NaCl. These results indicate that OsCPS2 expression levels respond to NaCl treatment, suggesting that the OsCPS2 gene is likely involved in the salt stress signaling pathway.

[0091] Example 3 Analysis of Salt Stress Phenotypes of OsCPS2 Knockout Mutants and Overexpression Strains

[0092] In this example, to further explore whether OsCPS2 has a role in regulating salt tolerance and the specific degree of regulation, salt stress experiments were carried out at the seedling stage on the OsCPS2 knockout mutants Oscps2-27 and Oscps2-60 and the overexpression lines OE-CPS2-4-4 and OE-CPS2-14-1.

[0093] 1. Rice material cultivation

[0094] Seeds of the wild-type japonica rice variety Kitaake, OsCPS2 overexpression lines (OE-CPS2-4-4 and OE-CPS2-14-1), and OsCPS2 knockout lines (Oscps2-27 and Oscps2-60) were selected for germination and seedling culture. The desired rice seeds were disinfected by soaking them in 70% alcohol for 1 minute, then sterilized in 1.5% NaClO for 30 minutes. Afterwards, they were rinsed several times with sterile water to remove the sodium hypochlorite solution. The seeds were then sown on 1 / 2 MS culture medium and incubated at 28°C for 7 days, with a 10-hour light cycle, a temperature of 28°C, and a relative humidity of 65%. When seedlings reached a height of more than 4 cm, they were transplanted. Seedlings with consistent growth were selected and transferred to perforated rice culture boxes. After transplanting, the rice seeds were cultured in International Rice Research Institute nutrient solution (pH 5.8), with the nutrient solution replaced every three days.

[0095] 2. Phenotypic analysis

[0096] The Kitaake wild type, OsCPS2 gene overexpression lines (OE-CPS2-4-4 and OE-CPS2-14-1), and OsCPS2 gene knockout lines (Oscps2-27 and Oscps2-60) rice seedlings in Example 2 were cultured to the two-leaf, one-heart stage and then treated with a hydroponic nutrient solution containing 100 mM NaCl for 14 days. The seedlings were then recovered with a normal hydroponic nutrient solution for 7 days. The salt stress phenotypes were observed and photographed, and the survival rate and water content were counted.

[0097] Phenotypic observations were conducted on wild-type, OsCPS2 overexpression, and OsCPS2 knockout strains under salt stress, focusing on differences in salinization phenotypes such as leaf wilting, yellowing, curling, and water loss. Salt stress tolerance was assessed based on seedling survival. Seedling survival was defined as the number of seedlings with newly green leaves, and the ratio of surviving plants to treated plants was used as the seedling survival rate.

[0098] Fresh weight measurement: The aerial parts of the wild-type Kitaake, Oscps2-27 and Oscps2-60 mutants, and OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing lines were separated from the roots using a razor blade, and the separated aerial parts were weighed and the data were recorded. Every six plants were regarded as one biological replicate, and each plant line included three biological replicates.

[0099] Dry weight measurement: The aerial parts of the wild-type Kitaake, Oscps2-27 and Oscps2-60 mutants, and the OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing lines, which had been weighed fresh, were dried in a 65°C oven to a constant weight and then weighed. The data were recorded, with every six lines as one biological replicate and each line including three biological replicates.

[0100] Survival rate analysis: After the rice seedlings were grown in the recovery nutrient solution for 7 days, the survival rate of each variety was calculated by counting the number of surviving plants, with the growth of new leaves as the standard.

[0101] Survival rate (%) = number of surviving plants / total number of surviving plants before treatment × 100%

[0102] Water content analysis: The water content of each strain was calculated by statistically analyzing the dry weight and fresh weight. Water content (%) = (fresh weight - dry weight) / fresh weight × 100%.

[0103] The results are as follows Figure 3 and Figure 4 As shown in the figure, under normal nutrient solution culture conditions, there was no significant difference in the growth of the Oscps2-27 and Oscps2-60 mutants and the OE-CPS2-4-4 and OE-CPS2-14-1 overexpressing lines. Two-week-old seedlings of the wild type (Kitaake), OsCPS2 knockout line, and OsCPS2 overexpressing line were treated with 100 mM NaCl for 14 days. The wild type Kitaake, the knockout mutant, and the overexpressing line all showed varying degrees of wilting, but the mutants Oscps2-2 and Oscps2-11 showed more severe wilting than the wild type, while the overexpressing materials showed the opposite. When the lines treated with salt for 14 days were transferred to normal nutrient solution for 7 days, it was found that most of the OsCPS2 knockout mutant lines had difficulty in recovering growth, while some overexpressing lines were able to recover growth ( Figure 3 Further statistics on the survival rates showed that the wild type had a survival rate of 44.5%, while the survival rates of the knockout mutant strains Oscps2-27 and Oscps2-60 were 33.3% and 30.1%, respectively, which were significantly lower than those of the wild type. The survival rates of the overexpression strains OE-CPS2-4-4 and OE-CPS2-14-1 were 61.9% and 59.5%, respectively, which were higher than those of the wild type ( Figure 4 A). Further statistical analysis of water content revealed that under normal conditions, there was no significant difference in water content among the strains. Under 100 mM NaCl treatment, the water contents of Oscps2-27 and Oscps2-60 were 75.1% and 74.1%, respectively, which were lower than those of the wild type (78.1%). The water contents of OE-CPS2-4-4 and OE-CPS2-14-1 were 80.6% and 80.2%, respectively, which were higher than those of the wild type ( Figure 4In summary, the two overexpression lines showed better salt tolerance than the wild type, and the OsCPS2 loss-of-function mutant line showed a salt-sensitive phenotype compared with the wild type, indicating that OsCPS2 may be involved in the salt stress response process and positively regulate salt stress.

[0104] Example 4: Na content of rice plants at seedling stage under salt stress conditions + and K + Physiological indicator analysis

[0105] The rice seedlings of Kitaake wild type, OsCPS2 gene overexpression lines (OE-CPS2-4-4 and OE-CPS2-14-1), and OsCPS2 gene knockout lines (Oscps2-27 and Oscps2-60) in Example 2 were cultured to the two-leaf, one-heart stage and then treated with a hydroponic nutrient solution containing 100 mM NaCl for 14 d. The seedlings were then cultured with a normal hydroponic nutrient solution and the seedlings were recovered for 7 d. The corresponding samples of the aboveground and underground parts were taken and dried in a 65°C oven to constant weight. The sample tissues were ground into powder in a mortar and pestle. 0.1 g of the sample was weighed into a 10 mL tube and dissolved in 10 mL of 1% (V / V) HCl. The sample was placed in a shaker at 28°C and soaked overnight at 200 rpm. The sample was filtered through a 0.22 μm filter into a new 10 mL tube to prepare a mother solution. The Na + and K + All data were obtained from three independent experiments, plotted using Graphpad Prism software, and analyzed using SPSS software.

[0106] The sodium and potassium ion contents of OsCPS2-related materials were determined under 100 mM NaCl treatment conditions. Figure 5 As shown in the figure, under normal nutrient solution culture conditions, the Na + There was no significant difference in the content between the wild-type strains, but under the condition of 100mM NaCl treatment, all strains had + The contents of Na + The content was significantly higher than that of wild type, and the Na + The content was significantly lower than that of wild type ( Figure 5 AD);

[0107] Under normal nutrient solution culture and 100 mM NaCl treatment conditions, the K + There was no significant difference in the contents between the mutant and the wild type strain, but in the underground part, the K + The content was significantly lower than that of the wild type after salt treatment, and the K+ The content was significantly higher than that of wild type ( Figure 5 BE);

[0108] Further analysis of Na + / K + The ratio of the contents of each strain, under the conditions of normal nutrient solution culture and 100mM NaCl treatment, the Na + / K + The ratio was significantly higher than that of the wild-type strain, and the Na + / K + The ratio was significantly lower than that of the wild-type strain ( Figure 5 These results indicate that the function of OsCPS2 is closely related to the Na + Increased content, K + related to the reduction of content.

[0109] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of OsCPS2 gene and related biological materials in regulating plant resistance to salt stress, characterized in that: By increasing the expression level of the OsCPS2 gene, the plant's ability to resist salt stress is improved; by decreasing the expression level of the OsCPS2 gene, the plant's ability to resist salt stress is reduced; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The relevant biological materials include the protein encoded by the OsCPS2 gene, a recombinant vector or a recombinant microorganism containing the OsCPS2 gene.

3. The use according to claim 2, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. The use according to claim 1, characterized in that The plants include rice.

5. A method for improving the ability of plants to resist salt stress, characterized in that: The method comprises the steps of introducing the OsCPS2 gene into the plant to stably overexpress the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that The plants include rice.

7. Use of the OsCPS2 gene and related biological materials in cultivating plants with high salt stress resistance, characterized in that: The nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that The plants include rice.

9. A method for cultivating plants with high resistance to salt stress, characterized in that: The method comprises the steps of introducing the OsCPS2 gene into the plant to obtain the plant capable of stably overexpressing the OsCPS2 gene; the nucleotide sequence of the OsCPS2 gene is shown in SEQ ID NO.

1.

10. The method according to claim 9, characterized in that The plants include rice.

Images