Application of OsCPS4 gene in regulation and control of plant salt tolerance
By regulating the expression of OsCPS4 gene in rice, the growth and development problems under rice salt stress were solved, and its salt tolerance and recovery ability were improved, providing a new solution for crop stress-resistant breeding.
Patent Information
- Application Number
- CN202510594830.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-05-08
AI Technical Summary
In the prior art, insufficient research on the salt stress response mechanism of rice and other crops has led to its growth and development under salt stress, and there is a lack of effective stress-resistant breeding methods.
By in-depth study of the regulatory mechanism of the OsCPS4 gene in plant salt stress response, the expression of the OsCPS4 gene is increased or reduced to regulate the salt tolerance of plants. The specific methods include constructing OsCPS4 gene knockout and overexpression vectors and introducing it into rice through Agrobacterium-mediated genetic transformation technology.
Overexpression of OsCPS4 gene significantly improves salt tolerance and recovery ability after stress in rice seedlings, and improves the stress resistance of crops, especially adaptability under intermittent salt stress.
Smart Images

Figure CN120442669A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to application of OsCPS4 gene in regulating plant salt tolerance. Background Art
[0002] Salt stress is a major abiotic stress factor restricting crop production, affecting plant growth and development through multiple pathways. Physiologically, salt stress disrupts photosynthesis and transpiration, interfering with water and mineral nutrient transport. Morphologically, it leads to phenotypic defects such as decreased germination rate, reduced plant height, and fewer tillers. As a salt-sensitive crop, understanding the salt tolerance mechanisms of rice is crucial for unlocking its potential for stress resistance.
[0003] The CPSs family is the key initial enzyme in the biosynthesis pathway of plant diterpenoids, catalyzing the conversion of GGPP to CPP precursors of different structures. The rice genome contains multiple functionally differentiated CPS gene family members, of which OsCPS1, OsCPS2, and OsCPS4 have been shown to be involved in different diterpenoid metabolic pathways. OsCPS4 can specifically catalyze the conversion of GGPP to syn-CPP, thereby participating in the biosynthesis of phytoalexins such as Momilactones. Studies have found that OsCPS4 plays an important role in plant response to various environmental stresses, including responding to infection by pathogens such as rice blast and bacterial blight, as well as regulating drought stress adaptability, indicating that this gene has multiple regulatory functions in plant stress resistance mechanisms.
[0004] However, current research on this gene family in rice salt stress is relatively limited. Therefore, in-depth research on the relationship between CPS4 genes and salt stress response in rice can provide new gene resources for genetic improvement of crop stress resistance and provide a theoretical basis for molecular target research. Summary of the Invention
[0005] The purpose of the present invention is to provide the application of the OsCPS4 gene in regulating plant salt tolerance to solve the problems existing in the above-mentioned prior art. The present invention provides a breakthrough technical solution for crop stress resistance breeding by deeply analyzing the regulation and mechanism of action of the OsCPS4 gene in plant salt stress response. Overexpression of OsCPS4 can not only improve the salt tolerance of rice seedlings, but also significantly improve the recovery ability of plants after stress. This characteristic is of great value for coping with intermittent salt stress in actual agricultural production. The present invention is expected to play an important role in the stress resistance breeding of rice and other important crops.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides the use of the OsCPS4 gene and related biological materials in regulating plant salt tolerance. When the expression level of the OsCPS4 gene is increased, the salt tolerance of the plant is improved; when the expression level of the gene is reduced, the salt tolerance of the plant is reduced. The nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.
[0008] Optionally, the relevant biological material includes a protein encoded by the OsCPS4 gene, a recombinant vector or a recombinant microorganism containing the OsCPS4 gene.
[0009] Optionally, the amino acid sequence of the protein is shown in SEQ ID NO.2.
[0010] Optionally, the plant comprises rice.
[0011] The present invention also provides a method for improving plant salt tolerance, comprising the steps of introducing an OsCPS4 gene into the plant to stably overexpress the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.
[0012] Optionally, the plant comprises rice.
[0013] The present invention also provides the use of the OsCPS4 gene and related biological materials in cultivating highly salt-tolerant plants. The nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.
[0014] Optionally, the plant comprises rice.
[0015] The present invention also provides a method for cultivating highly salt-tolerant plants, comprising the steps of introducing the OsCPS4 gene into the plant to obtain a plant capable of stably overexpressing the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.
[0016] Optionally, the plant comprises rice.
[0017] The present invention discloses the following technical effects:
[0018] The present invention provides a breakthrough technical solution for crop stress resistance breeding by deeply analyzing the regulation and mechanism of action of the OsCPS4 gene in plant salt stress response. Biological experiments have shown that the expression level of the OsCPS4 gene is significantly positively correlated with plant salt tolerance. The survival rate of the overexpression strain after salt stress treatment is nearly 60% higher than that of the wild type, and it shows a stronger ability to regulate ion homeostasis. The present invention not only reveals the molecular mechanism by which OsCPS4 enhances plant salt tolerance by regulating ion balance, but also suggests that it may play a key role in the plant stress signal transduction pathway.
[0019] Overexpression of OsCPS4 not only improves salt tolerance in rice seedlings but also significantly enhances plant recovery after stress. This property is of great value for managing intermittent salt stress in practical agricultural production. This invention is expected to play a significant role in stress-tolerant breeding of rice and other important crops. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0021] Figure 1 The sequencing results of the OsCPS4 gene knockout strain at the editing target site;
[0022] Figure 2 Expression analysis of OsCPS4 at different time points under salt stress in wild-type Kitaake;
[0023] Figure 3 Figures show the phenotypes of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpressing lines under normal conditions, after 14 days of salt stress treatment, and after 7 days of recovery.
[0024] Figure 4 Survival rate (A) and water content (B) analysis of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpression lines;
[0025] Figure 5 The OsCPS4 related genetic material is the Na + and K + Content analysis; A, B, and C are the aboveground Na content of wild-type Kitaake, Oscps4-2, Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpressing materials, respectively. + , K + Content and Na + / K + ; D, E, F are the underground Na of wild-type Kitaake, Oscps4-2, Oscps4-11 mutants and OE-CPS4-4 and OE-CPS4-10 overexpressing materials respectively. + , K + Content and Na + / K+ . DETAILED DESCRIPTION
[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0027] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0031] The following examples are used to illustrate the present invention but are not intended to limit the scope of the invention. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 21), or according to the conditions recommended in the manufacturer's instructions. The main reagents in the following examples are: various restriction endonucleases, Taq DNA polymerase, T4 ligase, Pyrobest Taq enzyme, and KOD were purchased from biological companies such as NEB and Toyobo; dNTPs were purchased from Genestar; plasmid miniprep kits and agarose gel recovery kits were purchased from Shanghai Jierui Bioengineering Co.; agar powder, agarose, antibiotics such as ampicillin (Amp), kanamycin (Kan), gentamicin sulfate (Gen), and rifampicin (Rif), as well as glucose, BSA, and LB medium were purchased from Sigma, Bio-Rad, and other companies; reagents used for real-time quantitative PCR were purchased from TaKaRa. All other chemical reagents used in the examples were imported or domestically produced analytical grade reagents. The primers used in the examples were synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd., and the relevant sequencing was performed.
[0032] The carriers used in the following examples are:
[0033] pENTR-gRNA and pBY02-Cas are disclosed in the non-patent literature “Large chromosomal deletions and heritable small genetic changes induced by CRISPR / Cas9 in rice”, Huanbin Zhou et al., Nucleic acids research, 2014, Vol. 42, No. 1710903–10914;
[0034] pBY02 is disclosed in the non-patent document "Gene targeting by the TAL effector PthXo2reveals cryptic resistance gene for bacterial blight of rice", Junhui Zhouet., The Plant journal: for cell and molecularbiology, The Plant Journal (2015) 82, 632-643.
[0035] Example 1 Construction and genetic transformation of rice OsCPS4 gene knockout and overexpression vectors
[0036] 1. Construction of rice OsCPS4 gene knockout vector
[0037] An OsCPS4 gene knockout vector was constructed using CRISPR / Cas9 technology. Sequence analysis of the rice OsCPS4 gene showed that the gene contains 13 exons. Two target sites were designed in the first exon, resulting in two types of OsCPS4 gene mutant rice. The target site sequences are as follows:
[0038] Target 1: GTTTGGGCAGCCAGCATCGGCGG, SEQ ID NO. 3;
[0039] Target 2: GACGCCCAGCCATTGCTGCAAGG, SEQ ID NO.4.
[0040] The nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1:
[0041] SEQ ID NO.1:
[0042]
[0043] The amino acid sequence of the protein encoded by this gene sequence is shown in SEQ ID NO.2:
[0044] SEQ ID NO.2:
[0045] MPVFTASFQCVTLFGQPASAADAQPLLQGQRPFLHLHARRRRPCGPMLISKSPPYPASEETREWEADGQHEHTDELRETTTTMIDGIRTALRSIGEGEISISAYDTSLVALLKRLDGGDGPQFPSTIDWIVQNQLPDGSWGDASFFMMGDRIMSTLACVVALKSWNIHTDKCERGLLFIQENMWRLAHEEEDWMLVGFEIALPSLLDMAKDLDLDIPYDEPALKAIYAERERKLAKIPRDVLHSMPTTLLHSLEGMVDLDWEKLLKLRCLDGSFHCSPASTATAFQQTGDQKCFEYLDGIVKKFNGGVPCIYPLDVYERLWAVDRLTRLGISRHFTSEIEDCLDYIFRNWTPDGLAHTKNCPVKDIDDTAMGFRLLRLYGYQVDPCVLKKFEKDGKFFCLHGESNPSSVTPMYNTYRASQLKFPGDDGVLGRAEVFCRSFLQDRRGSNRMKDKWAIAKDIPGEVEYAMDYPWKASLPRIETRLYLDQYGGSGDVWIGKVLHRMTLFCNDLYLKAAKADFSNFQKECRVELNGLRRWYLRSNLEKFGGTDPQTTLMTSYFLASANIFEANRAAERLGWARVALLADAVSSHFRRIGGPKNSTSNLEELISLVPFDDAYSGSLREAWKQWLMAWTAKESSQESIEGDTAILLVRAIEIFGGRHVLTGQRPDLWEYSQLEQLTSSICCKLSRRVLAQENGESTEKVEEIDQQVDLEMQELTRRVLQGCSAINRLTRETFLHVVKSFCYVAYCSPETIDSHIDKVIFQDVI。
[0046] Based on the above target design, the corresponding sgRNA was synthesized. The present invention used the intermediate vector pENTR-gRNA for both gRNAs, which contains two cloning sites (BtgZI and BsaI) after the rice U6 promoter. For the BtgZI cloning site, the sense strand contained a 5'4-nt TGTT residue, and the antisense strand contained a 5'4-nt AAAC residue. For the BsaI cloning site, the sense strand contained a 5'4-nt GTGT residue, and the antisense strand contained a 5'4-nt AAAC residue.
[0047] The primers for synthesizing sgRNA1 are as follows:
[0048] gOsCPS4-1-F:5'-tgttGTTTGGGCAGCCAGCATCGG-3', SEQ ID NO.5;
[0049] gOsCPS4-1-R:5'-aaacCCGATGCTGG CTGCCCAAAC-3', SEQ ID NO.6.
[0050] The primers for synthesizing sgRNA2 are as follows:
[0051] gOsCPS4-2-F:5'-gtgtGACGCCCAGCCATTGCTGCA-3', SEQ ID NO.7;
[0052] gOsCPS4-2-R:5'-aaacTGCAGCAATGGCTGGGCGTC-3', SEQ ID NO.8.
[0053] Two sgRNA sequences were synthesized using annealing at 95°C for 10 minutes and 55°C for 10 minutes. The first sgRNA was cloned into the BtgZI restriction site, and the second was inserted into the BsaI restriction site. Sequencing was performed to verify the constructs. These two sgRNA fragments were then subcloned into the CRISPR vector pBY02-Cas9 using LR clonase. This generated an OsCPS4 gene knockout vector.
[0054] 2. Construction of rice OsCPS4 gene overexpression vector
[0055] The open reading frame of OsCPS4 was amplified from the cDNA of japonica rice Kitaake by PCR. The primer sequences for the amplification were as follows:
[0056] OsCPS4-CDS-F:CCCATGCTAATAAGCAAATC,SEQ ID NO.9
[0057] OsCPS4-CDS-R:AAGGTCGGGAATTGGTAGTG,SEQ ID NO.10
[0058] The PCR fragment was cloned into the KpnI and XbaI restriction sites of the vector pBY02, so that its expression was controlled by the maize ubiquitin 1 gene promoter, and the OsCPS4 gene overexpression vector was obtained.
[0059] The cloning primer sequences are as follows:
[0060] OsCPS4-F: CGGGGTACCATGCCGGTCTTCACTGCGTC, SEQ ID NO.11;
[0061] OsCPS4-R: GCTCTAGACTAAATCACATCTTGGAATATGAC, SEQ ID NO. 12.
[0062] 3. Genetic transformation of OsCPS4 gene knockout and overexpression vectors in rice
[0063] Agrobacterium-mediated rice genetic transformation was used to transform immature embryonic callus cells of rice to create OsCPS4 gene knockout mutants and overexpression materials. The specific steps are as follows:
[0064] (1) Kitaake japonica rice seeds were used as the material. After removing the outer husk and disinfecting, they were placed in an induction medium and cultured in a light incubator at 28°C for 3 to 4 weeks. Then, naturally divided embryonic callus tissue was selected and placed in a subculture medium and cultured for another 7 days. After three subcultures, naturally dispersed, bright yellow granular callus tissue with a diameter of about 2-3 mm was selected for Agrobacterium transformation.
[0065] (2) The constructed OsCPS4 gene knockout vector and overexpression vector were transformed into Agrobacterium competent EHA105 by electroporation to obtain Agrobacterium suspension.
[0066] (3) Soak the callus obtained in step (1) in the Agrobacterium suspension of step (2), let it stand for 30-40 minutes, dry it on sterile filter paper, and inoculate it on the co-culture medium, and culture it in the dark at 25°C for 3 days.
[0067] (4) Collect the callus tissue obtained in step (3), wash it thoroughly with sterile water, and then wash it twice with sterile water containing 300 mg / L carbenicillin sodium. Finally, place it on sterile filter paper to drain; transfer the drained callus to a screening medium containing 300 mg / L carbenicillin sodium for the first round of screening, and culture it at 28°C under light for 14 days. Transfer the initial callus with resistant callus to a screening medium containing 300 mg / L carbenicillin sodium for a second round of screening until granular resistant callus grows.
[0068] (5) Transfer 3-7 calli obtained in step (4) to a differentiation tank containing differentiation medium, place it in a constant temperature culture room at 25°C, and when the seedlings grow to the top of the differentiation tank lid, place them in rooting medium to root and strengthen the seedlings. After 7 days, open the sealing film and add an appropriate amount of sterile water to prevent bacterial growth. Harden the seedlings for about 3 days until the seedlings stand upright, then wash off the agar, and culture in solution for 7-14 days before transplanting.
[0069] 4. Detection of gene knockout and overexpression strains
[0070] (1) Detection of OsCPS4 gene knockout strains
[0071] After the rice plants transplanted after transformation have formed ears, Reagent (Invitrogen) was used to extract genomic DNA (gDNA) from leaves of T0 transgenic rice seedlings for genotyping, and the amplification primer sequences were designed as follows:
[0072] Forward primer: ATCATTCATCCCAATATCTATTG, SEQ ID NO. 13;
[0073] Reverse primer: AACGTTTTAACTATTTATCTTA, SEQ ID NO.14.
[0074] The PCR amplification products were processed with ExoSAPIT (Affymetrix, Santa Clara, CA, USA) and then subjected to Sanger sequencing.
[0075] The two homozygous knockout rice mutants obtained in the above steps were harvested and sown to obtain homozygous T1 generation mutants. To obtain homozygous plants with Cas9-free knockout, the present invention used the same genotyping method on the homozygous T1 generation transgenic rice. Homozygous mutant lines were screened for the Cas9 gene by PCR screening using the following primers:
[0076] Forward primer: GGGTAATGAACTCGCTCTGC, SEQ ID NO. 15;
[0077] Reverse primer: TGGCGTCAAGAACTTCCTTTG, SEQ ID NO.16.
[0078] The amplified products were sequenced by Sanger sequencing and no longer contained the exogenous Cas9 gene and sgRNA expression elements. Finally, two homozygous plants, Oscps4-2 and Oscps4-11, were obtained, which only retained the target gene knockout mutation. The sequencing results of the two OsCPS4 gene knockout lines at the editing target site are as follows: Figure 1 shown.
[0079] (2) Detection of OsCPS4 gene overexpression lines
[0080] After the transformed rice plants were transplanted and set, semi-quantitative reverse transcription-polymerase chain reaction was used to confirm overexpression of the OsCPS4 gene. Three generations of screening were performed to obtain non-segregating homozygous CPS4-OE lines, OE-CPS4-4 and OE-CPS4-10. The semi-quantitative primer sequences for detecting OsCPS4 gene overexpression are as follows:
[0081] Forward primer OsCPS4-RT-F: ATGCTAATAAGCAAATCACCG, SEQ ID NO. 17;
[0082] Reverse primer OsCPS4-RT-R: GGCATAGAGTGTAGCACGTCTC, SEQ ID NO.18.
[0083] Example 2 Analysis of the expression pattern of the OsCPS4 gene under salt stress in the wild type
[0084] Wild-type japonica rice Kitaake seedlings grown to the two-leaf, one-heart stage were treated with 100 mM NaCl. 0.1 g of shoot and root tissues were collected at 0, 3, 6, 9, 12, 24, 36, and 48 hours, quickly frozen in liquid nitrogen, and used for OsCPS4 gene expression analysis. Total RNA from rice leaves and roots at different time points after salt treatment was extracted using Trizol reagent (Invitrogen, USA); cDNA was then synthesized using 5× All-in-One RTMaster Mix (ABM, Canada); and TBGreen was used to generate the RNA. TM PreMix Ex Taq TM Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed on a QuantStudio 5 Real-Time PCR System (ABI, USA). The amplification primer sequences for OsCPS4 quantitative detection are as follows:
[0085] qOsCPS4-F: 5'-CCCAGGCGAGGTTGAGTAT-3', SEQ ID NO.19;
[0086] qOsCPS4-R: 5'-TGAGGTACAGGTCGTTGCAG-3', SEQ ID NO. 20.
[0087] OsActin was used as the internal reference gene, and the amplification primer sequences were as follows:
[0088] OsActin-F: 5'-CTCAGCACATCCAGCAGAT-3', SEQ ID NO. 21;
[0089] OsActin-R: 5'-ACAGATAGGCCGGTTGAAAA-3', SEQ ID NO. 22.
[0090] Each time point sample included three biological replicates, and each sample had three technical replicates; the data were obtained using 2 -ΔΔCt The data were analyzed by the fluorescence quantitative analysis method, and the results were given as mean ± standard deviation (Means ± SD).
[0091] The results are as follows Figure 2 As shown in the results, NaCl treatment affected the expression of OsCPS4 in both the aboveground and underground parts. In the underground part, OsCPS4 expression was continuously upregulated between 0 and 36 hours after 100 mM NaCl treatment. In the aboveground part, OsCPS4 expression was downregulated between 0 and 6 hours after 100 mM NaCl treatment, but was induced to upregulate between 6 and 12 hours. These results indicate that OsCPS4 expression levels respond to NaCl treatment, suggesting that the OsCPS4 gene is likely involved in the salt stress signaling pathway.
[0092] Example 3 Analysis of Salt Stress Phenotypes of OsCPS4 Gene Knockout Mutants and Overexpression Strains
[0093] In order to further explore whether OsCPS4 has a role in regulating salt tolerance and the specific degree of regulation, this example conducted salt stress experiments on the OsCPS4 knockout mutants Oscps4-2 and Oscps4-11 and the overexpression lines OE-CPS4-4 and OE-CPS4-10 at the seedling stage.
[0094] 1. Rice material cultivation
[0095] Seeds of the wild-type japonica rice variety Kitaake, OsCPS4 overexpression lines (OE-CPS4-4 and OE-CPS4-10), and OsCPS4 knockout lines (Oscps4-2 and Oscps4-11) were selected for germination and seedling culture. The desired rice seeds were disinfected by soaking them in 70% alcohol for 1 minute, then sterilized in 1.5% NaClO for 30 minutes. Afterwards, they were rinsed several times with sterile water to remove the sodium hypochlorite solution. The seeds were then sown on 1 / 2 MS culture medium and incubated at 28°C for 7 days, with 10-hour light periods, a temperature of 28°C, and a relative humidity of 65%. When seedlings reached a height of more than 4 cm, they were transplanted. Seedlings with consistent growth were selected and transferred to perforated rice culture boxes. After transplanting, the rice seeds were cultured in International Rice Research Institute nutrient solution (pH 5.8), with the nutrient solution replaced every three days.
[0096] 2. Phenotypic analysis
[0097] The Kitaake wild type, OsCPS4 gene overexpression lines (OE-CPS4-4 and OE-CPS4-10), and OsCPS4 gene knockout lines (Oscps4-2 and Oscps4-11) rice seedlings in Example 2 were cultured to the two-leaf, one-heart stage and then treated with a hydroponic nutrient solution containing 100 mM NaCl for 14 days. The seedlings were then recovered with a normal hydroponic nutrient solution for 7 days. The salt stress phenotypes were observed and photographed, and the survival rate and water content were counted.
[0098] Phenotypic observations were conducted on wild-type, OsCPS4 overexpression, and OsCPS4 knockout strains under salt stress, focusing on differences in salinization phenotypes such as leaf wilting, yellowing, curling, and water loss. Salt stress tolerance was assessed based on seedling survival. Seedling survival was defined as the number of seedlings with newly green leaves, and the ratio of surviving plants to treated plants was used as the seedling survival rate.
[0099] Fresh weight measurement: The aerial parts of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpressing lines were separated from the roots using a razor blade, and the separated aerial parts were weighed and the data were recorded. Every six plants were used as a biological replicate, and each plant line included three biological replicates.
[0100] Dry weight measurement: The aerial parts of the wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpressing lines, which had been weighed fresh, were dried in a 65°C oven to a constant weight and then weighed. The data were recorded, with every six lines as one biological replicate and each line including three biological replicates.
[0101] Survival rate analysis: After the rice seedlings were grown in the recovery nutrient solution for 7 days, the survival rate of each variety was calculated by counting the number of surviving plants, with the growth of new leaves as the standard.
[0102] Survival rate (%) = number of surviving plants / total number of surviving plants before treatment × 100%
[0103] Water content analysis: The water content of each strain was calculated by statistically analyzing the dry weight and fresh weight. Water content (%) = (fresh weight - dry weight) / fresh weight × 100%.
[0104] The results are as follows Figure 3 and Figure 4 As shown in the results, under normal nutrient solution culture conditions, there was no significant difference in the growth of the Oscps4-2 and Oscps4-11 mutants and the OE-CPS4-4 and OE-CPS4-10 overexpressing lines. Two-week-old seedlings of the wild type (Kitaake), OsCPS4 knockout line, and OsCPS4 overexpressing line were treated with 100 mM NaCl for 14 days. The wild type Kitaake, the knockout mutant, and the overexpressing line all showed varying degrees of wilting, but the mutants Oscps4-2 and Oscps4-11 showed more severe wilting than the wild type, while the overexpressing materials showed the opposite. When the lines treated with salt for 14 days were transferred to normal nutrient solution for 7 days, it was found that most of the OsCPS4 knockout mutant lines had difficulty in recovering growth, while some of the overexpressing lines were able to recover growth ( Figure 3 Further statistical analysis of the survival rates revealed that the wild type had a survival rate of 42%, while the knockout mutant lines Oscps4-2 and Oscps4-11 had survival rates of 27% and 31%, respectively, which were significantly lower than those of the wild type. The overexpression lines OE-CPS4-4 and OE-CPS4-10 had survival rates of 67% and 70%, respectively, which were significantly higher than those of the wild type ( Figure 4 A). Further statistical analysis of water content revealed that under normal conditions, there was no significant difference in water content among the strains. Under 100 mM NaCl treatment, the water contents of Oscps4-2 and Oscps4-11 were 63% and 73%, respectively, lower than the wild type (79%). The water contents of OE-CPS4-4 and OE-CPS4-10 were 82% and 81%, respectively, higher than the wild type ( Figure 4 In summary, the two overexpression lines showed good salt tolerance compared with the wild type, and the Oscps4 loss-of-function mutant line showed a salt-sensitive phenotype compared with the wild type, indicating that OsCPS4 may be involved in the salt stress response process and positively regulate salt stress.
[0105] Example 4: Na content of rice plants at seedling stage under salt stress conditions + and K + Physiological indicator analysis
[0106] The rice seedlings of Kitaake wild type, OsCPS4 gene overexpression lines (OE-CPS4-4 and OE-CPS4-10), and OsCPS4 gene knockout lines (Oscps4-2 and Oscps4-11) in Example 2 were cultured to the two-leaf, one-heart stage and then treated with a hydroponic nutrient solution containing 100 mM NaCl for 14 days. The seedlings were then recovered with a normal hydroponic nutrient solution for 7 days. The corresponding samples of the aboveground and underground parts were taken and dried in a 65°C oven to constant weight. The sample tissues were ground into powder using a mortar and pestle. 0.1 g of the sample was weighed into a 10 mL tube and dissolved in 10 mL of 1% (V / V) HCl. The sample was placed in a shaker at 28°C and soaked overnight at 200 rpm. The sample was filtered through a 0.22 μm filter into a new 10 mL tube to prepare a mother solution. The Na + and K + All data were obtained from three independent experiments, plotted using Graphpad Prism software, and analyzed using SPSS software.
[0107] The sodium and potassium ion contents of OsCPS4-related materials were determined under 100 mM NaCl treatment conditions. Figure 5 As shown, under normal nutrient solution culture conditions, the Na + Content and Na + / K + The ratios were not significantly different from those of the wild-type strains, but under the condition of 100 mM NaCl treatment, all strains had Na + The contents of wild-type Na + The content of Na in the aboveground parts of two loss-of-function mutant strains Oscps4-2 and Oscps4-11 was 24.76 mg / g. + The contents were 33.04 mg / g and 29.70 mg / g, respectively, which were significantly higher than those of wild-type plants ( Figure 5 A); K of loss-of-function mutant lines Oscps4-2 and Oscps4-11 + The contents were 54.66 mg / g and 54.43 mg / g, respectively, which were significantly lower than those in the wild type plant (95.57 mg / g) ( Figure 5 of B); Na + / K + The ratios were 0.64 and 0.51, which were also significantly higher than those of wild-type plants (0.23) ( Figure 5 C);
[0108] Na overexpression in the shoots of OE-CPS4-4 and OE-CPS4-10+ The contents were 12.64 mg / g and 9.70 mg / g, respectively, which were significantly lower than those of the wild type ( Figure 5 A), K + The contents were 73.38 mg / g and 76.96 mg / g, respectively, which were significantly lower than those in the wild type plants ( Figure 5 B), Na + / K + The ratios were 0.17 and 0.12, respectively, which were also significantly lower than those of the wild-type plants ( Figure 5 C); analysis of its underground data showed that the underground data showed a similar trend to the aboveground data ( Figure 5 These results indicate that the Oscps4-2 and Oscps4-11 mutants are more sensitive to salt stress and that the Na + Increased content, K + related to the reduction of content.
[0109] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Application of OsCPS4 gene and related biological materials in regulating plant salt tolerance, characterized in that: By increasing the expression level of the OsCPS4 gene, the salt tolerance of the plant is improved; by decreasing the expression level of the OsCPS4 gene, the salt tolerance of the plant is reduced; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The relevant biological materials include the protein encoded by the OsCPS4 gene, a recombinant vector or a recombinant microorganism containing the OsCPS4 gene.
3. The use according to claim 2, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.
2.
4. The use according to claim 1, characterized in that The plants include rice.
5. A method for improving plant salt tolerance, characterized in that: The method comprises the steps of introducing the OsCPS4 gene into the plant to stably overexpress the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.
1.
6. The method according to claim 5, characterized in that The plants include rice.
7. Application of OsCPS4 gene and related biological materials in cultivating highly salt-tolerant plants, characterized in that: The nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.
1.
8. The use according to claim 7, characterized in that The plants include rice.
9. A method for cultivating highly salt-tolerant plants, characterized in that: The method comprises the steps of introducing the OsCPS4 gene into the plant to obtain the plant capable of stably overexpressing the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.
1.
10. The method according to claim 9, characterized in that The plants include rice.
Citation Information
Patent Citations
Sclareol and labdenediol diphosphate synthase polypeptides, encoding nucleic acid molecules and uses thereof
US20140073020A1