Application of DNA (Deoxyribose Nucleic Acid) methyltransferase gene DMT2 in regulating and controlling salt resistance of poplar
Knocking out the poplar DNA methyltransferase gene DMT2 through CRISPR/Cas9 gene editing technology, solving the problem of improving salt resistance of poplars and improving the growth adaptability of poplars in saline-alkali environment.
Patent Information
- Application Number
- CN202510490303.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is difficult to effectively improve the salt resistance of poplars, and traditional breeding methods are difficult to achieve high resistance improvement of poplars in saline-alkali and dry land.
The poplar DNA methyltransferase gene DMT2 was knocked out by CRISPR/Cas9 gene editing technology, and the recombinant vector was constructed and the poplar was transformed using Agrobacterium mediated method to obtain a transgenic plant to improve its salt resistance.
It significantly enhances the anti-salt stress ability of poplars, reduces the malondialdehyde content under salt stress, improves the activity of catalase CAT enzyme, and enhances its growth adaptability in a saline-alkali environment.
Smart Images

Figure CN120442691A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular botany, and particularly relates to application of a DNA methyltransferase gene DMT2 in regulating salt resistance of poplar. Background Art
[0002] Periodic extreme environments (such as high temperature, drought, and salt stress) pose persistent abiotic stresses to plant survival, driving the evolution of multi-layered regulatory networks, including coordinated response mechanisms such as transcriptional regulation and epigenetic modification. Cytosine DNA methylation, as a core epigenetic marker, plays a key role in plant responses to environmental stress by regulating gene expression patterns with spatiotemporal specificity. DNA methylation is a highly conserved epigenetic modification in eukaryotes that can regulate genome function without altering DNA sequence, playing an important role in gene regulation, transposon silencing, and genome stability. Its specific molecular mechanism involves the enzyme DNA methyltransferase (DMT), which catalyzes the attachment of a methyl group released from S-adenosylmethionine to the fifth carbon atom of cytosine, forming 5-methylcytosine (5-mC). As a key tool for regulating DNA methylation, DNA methyltransferases play an important role in plant responses to environmental stress. Different stress signals can induce specific and dynamic changes in DNA methylation levels in plants, regulate the expression of stress-responsive genes, and control the activity of transposable elements (TEs), thereby inducing and improving the physiological adaptation and defense responses of plants to adversity.
[0003] Poplars are widely distributed and highly adaptable, making them an important afforestation species. However, their cultivars are limited, and there is a lack of highly resistant varieties suitable for saline-alkali and arid lands. Traditional breeding methods, such as introduction and domestication, hybridization, and selective breeding, have struggled to achieve the comprehensive improvement of multiple traits, including high-quality, fast-growing varieties and high stress resistance. With the increasing area of arid and saline-alkali land, the sustainable development of forestry production is facing severe constraints. Improving the stress resistance of poplars and cultivating new, more tolerant varieties could provide a rich genetic resource for molecular breeding. Summary of the Invention
[0004] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide an application of a DNA methyltransferase gene DMT2 in regulating salt resistance (salt tolerance) in poplars.
[0005] Another object of the present invention is to provide a method for improving salt resistance of poplar by knocking out DNA methyltransferase DMT2.
[0006] Another object of the present invention is to provide a DNA methyltransferase DMT2 mutant.
[0007] The purpose of the present invention is achieved through the following technical solutions:
[0008] Application of a DNA methyltransferase gene DMT2 in regulating salt resistance in poplar.
[0009] The amino acid sequence encoded by the DNA methyltransferase gene DMT2 is shown in SEQ ID NO.1.
[0010] The nucleotide sequence of the DNA methyltransferase gene DMT2 is shown in SEQ ID NO.2.
[0011] The regulation is achieved by knocking out the DNA methyltransferase gene DMT2, and the salt stress resistance of the poplar is improved by inhibiting the expression of the DNA methyltransferase gene DMT2 of the poplar.
[0012] The poplar is preferably Populus alba.
[0013] The knockout of the DNA methyltransferase gene DMT2 is achieved by any of the following methods:
[0014] (a) Inserting a base A (+A) between bp 1174 and bp 1175 of the CDS sequence of the DNA methyltransferase gene DMT2 to terminate amino acid transcription prematurely;
[0015] (b) inserting a C base (+C) between bp 1140 and bp 1141 of the CDS sequence of the DNA methyltransferase gene DMT2, and deleting the 5-base CCTTG between bp 1170 and bp 1174, thereby terminating amino acid transcription prematurely;
[0016] (c) A base C (-C) is deleted at 1140 bp in the CDS sequence of the DNA methyltransferase gene DMT2, causing premature termination of amino acid transcription.
[0017] A method for improving salt resistance of poplars by knocking out DNA methyltransferase DMT2 comprises the following steps: targeted knockout of the DMT2 gene in DNA methyltransferase, constructing a knockout vector, and then genetically transforming poplar leaves using Agrobacterium-mediated method to obtain transgenic plants, thereby achieving the purpose of improving salt resistance of poplars.
[0018] The poplar is preferably Populus alba.
[0019] A DNA methyltransferase DMT2 mutant, which is any one of the following:
[0020] (a) inserting an A base (+A) between bp 1174 and bp 1175 of the CDS sequence of the DNA methyltransferase gene DMT2;
[0021] (b) a C base was inserted between bp 1140 and bp 1141 of the CDS sequence of the DNA methyltransferase gene DMT2 (+C), and 5 bases CCTTG were deleted between bp 1170 and 1174;
[0022] (c) A base C (-C) is deleted at 1140 bp in the CDS sequence of the DNA methyltransferase gene DMT2.
[0023] A recombinant expression vector or recombinant bacteria containing the DNA methyltransferase DMT2 mutant.
[0024] The recombinant expression vector is preferably pYLCRISPR / Cas9P 35S -H vector.
[0025] The recombinant bacteria is preferably Agrobacterium; more preferably Agrobacterium GV3101.
[0026] The DNA methyltransferase DMT2 mutant is used to improve the salt resistance of poplars (preparation of transgenic poplars).
[0027] The poplar is preferably Populus alba.
[0028] The application of the DNA methyltransferase DMT2 mutant in salt-alkali tolerant forest tree breeding.
[0029] The trees are preferably poplars; more preferably, Populus alba.
[0030] The present invention has the following advantages and effects compared to the prior art:
[0031] 1. DNA methylation participates in the process of plant response to abiotic stresses such as drought and salinity, and is a key mechanism for plant response to adversity. DNA methyltransferase, as the main regulatory factor of methylation level, can improve plant stress resistance by inducing changes in methylation levels. In the present invention, by knocking out the DNA methyltransferase gene DMT2, the transgenic material obtained has a significantly lower malondialdehyde content under salt stress than the wild type, while the catalase CAT enzyme activity is significantly higher than the wild type, and its salt stress resistance is enhanced.
[0032] 2. The present invention improves salt tolerance by knocking out the DNA methyltransferase gene DMT2 in Populus alba. An sgRNA expression cassette was designed for the DNA methyltransferase gene DMT2 using CRISPR / Cas9 gene editing technology and constructed into pYLCRISPR / Cas9P 35S-H knockout vector was used to transform Populus alba through Agrobacterium-mediated transformation to obtain transgenic Populus alba plants. Phenotypic observations were then conducted on the knockout Populus alba plants, along with the salt tolerance of the transgenic Populus alba, to analyze the effects of the DNA methyltransferase gene DMT2 on poplar growth and salt tolerance.
[0033] 3. Under the same growth environment, the plant height of the DNA methyltransferase gene DMT2 knockout plant was significantly smaller than that of the wild type. The transgenic strains were subjected to salt stress treatment using 250mM NaCl, and it was found that the leaves at the base of the wild-type stems wilted and shrank, while the transgenic strains showed no significant changes. The malondialdehyde (MDA) content and catalase (CAT) enzyme activity of the transgenic strains after salt stress were measured, and it was found that the MDA content of the transgenic strains after salt stress was significantly lower than that of the wild type, while the CAT activity was significantly higher than that of the wild type. The above experimental results show that knocking out the DNA methyltransferase gene can inhibit the growth and development of the height of Populus alba. After salt stress, the MDA content of the knockout plants accumulated less than that of the wild type, while the CAT activity was higher than that of the wild type, thereby enhancing the salt tolerance of Populus alba.
[0034] 4. The transgenic plants obtained by the method of improving the salt resistance of poplars by knocking out the DNA methyltransferase gene DMT2 in the present invention can cope with adverse stress environments such as saline-alkali, fundamentally improve the salt resistance, enhance the adversity adaptability of poplars, and promote the application of the poplars in adverse environments.
[0035] 5. The present invention utilizes biotechnology to knock out the DNA methyltransferase gene DMT2 in Populus alba, and the knocked-out Populus alba has stronger salt tolerance. The material obtained by the method of the present invention can be used in fields such as salt-alkali tolerant tree planting, and can also be used in the genetic improvement of trees. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 Schematic diagram of Cas9 primer identification and gene editing types in knockout-positive plants; A is the electrophoresis result diagram (in the figure, lanes 1-20 are knockout-positive plants; "+" is the positive control; "-" is the negative control; WT is the wild type of Populus alba; M: Maker DL2000); B is a schematic diagram of gene editing types.
[0037] Figure 2 This is the statistical result of plant height of poplar trees with the DNA methyltransferase gene DMT2 knocked out.
[0038] Figure 3 This is the phenotype of poplar trees with the DNA methyltransferase gene DMT2 knocked out under salt stress.
[0039] Figure 4This is the result of measuring malondialdehyde and CAT antioxidant enzyme activities under salt stress in poplar trees with the DNA methyltransferase gene DMT2 knocked out; A is the MDA content; B is the CAT content. DETAILED DESCRIPTION
[0040] The present invention is further described in detail below with reference to the following examples, but the embodiments of the present invention are not limited thereto. Experimental methods in the following examples, where specific experimental conditions are not specified, generally followed conventional experimental conditions or those recommended by the manufacturer. Materials and reagents used were commercially available unless otherwise specified.
[0041] Example 1
[0042] Construction of knockout vector for DNA methyltransferase DMT2 gene. CRISPR / Cas9 constructed loss-of-function mutants were constructed using the multi-target gene editing method developed by Professor Liu Yaoguang's team from the College of Life Sciences, South China Agricultural University (Reference: Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Methods for construction of plant CRISPR / Cas9 multi-gene editing vectors and mutation analysis [J]. Science China: Life Sciences, 2018, 48(07): 783-794.). Two target sites were designed based on the sequence of the DMT2 gene (NCBI accession number: KAL3612013.1) (amino acid sequence as shown in SEQ ID NO. 1, CDS sequence as shown in SEQ ID NO. 2), located at the CDS sequence of the DMT2 gene (1036-1055 bp; 1172-1191 bp), and primers DMT2-gR-T1 and DMT2-AtU3d-T1, DMT2-gR-T2 and DMT2-AtU3b-T2 were synthesized. The amplification primer sequences are shown in Table 1. By Overlapping PCR, using promoters pYLgRNA-AtU3d and pYLgRNA-AtU3b as templates, the promoter and gRNA were amplified respectively, and the target sequence was introduced downstream of the promoter and upstream of the gRNA; then 1 μL of the promoter and gRNA products of target one and target two were diluted 10 times as templates, and the universal primers Pps-R / Pgs-2 and Pps-2 / Pgs-L were mixed in pairs to amplify and construct expression cassettes. The two expression cassette structures obtained were promoter AtU3d+target one+gRNA and AtU3b+target two+gRNA. Afterwards, the two expression cassettes were mixed in equal amounts according to their concentrations, and the two expression cassettes were assembled into pYLCRISPR / Cas9P using the restriction endonuclease BsaI-HF and T4 ligase enzyme digestion method. 35S -H knockout vector backbone ( Figure 1 ).
[0043] DMT2 amino acid sequence (SEQ ID NO.1):
[0044] MGEVLDSLMITCLGGTRKLVESGEDGDSLCGDNDDFDWDSEDEKEIENFASSSSSSLRLPQVETRSSSAETSSSASSSGSKLFDRFVGMGFAEKMVAKAIQENGEGDADSVLETLLTYAAIGKSPQEQPNNDSDHCSSGHEGSFLDDFSDVDSADDEVITKTVSDEDNKLAFLRRMGYKEADASIAITRCGTEATISELADFICAAQIAKAEDAFFAEDEKKPKHLDKQKKRSFLESDMLEKKRQKGLENGDDEGVRLPNPMVGFGVPTEPGIVTCRTLSEAAIGPPFFYYENVALAPKGVWQTISRFLYDVEPEFVDSKHFCAAARKRGYVHNLPIHNRFPLLPLPPHTIHEALPLTRKWWPAWDERTKLNCLQTCIASAKLTEKIRKALEAYEGEPPLHVQKFILDECRKWNLVWVGRNKVAPLEADEVEMLLGFPRNHTRGGGISRTDRYKSLGNSFQVDTVAYHLSSLKDLFPRGINVLSLFSGIGGAEVALHRLGIRLKNVVSVEISNVNRSIMSCWWEQTNQTGNLIHIEDVQHLTADRLEHLMTMYGSFDLVVGGSPCNNLAGSNRHHRDGLEGKESSLFFDYCRILDVVKSLTSRYS;
[0045] DMT2 gene sequence (CDS sequence) (SEQ ID NO.2):
[0046] CCG CTTC C TCCACACACCATACATGAAGCTCTGCCCTTAACAAGGAAATGGTGGCCTGCATGGGATGAGAGAACAAAACTGAATTGCTTACAGACTTGCATTGCTAGTGCAAAGCTGACAGAGAAGATACGGAAGG CCC TT G AAGCCTATGAAGGGGAGCCCCCTTTGCATGTCCAGAAGTTTATATTGGATGAATGCCGGAAATGGAACCTGGTTTGGGTCGGAAGGAATAAGGTTGCTCCTCTTGAGGCTGATGAAGTTGAAATGCTTTTGGGATTTCCAAGGAACCACACCAGGGGAGGCGGTATAAGTAGGACTGACAGATACAAGTCACTAGGTAACTCATTCCAGGTTGATACTGTTGCTTATCATCTGTCAAGTTTGAAAGACTTGTTCCCAAGAGGGATCAATGTTCTGTCTCTTTTCTCTGGAATTGGTGGTGCCGAAGTAGCTCTTCATCGGCTTGGTATTCGTTTGAAGAATGTGGTGTCGGTTGAGATCTCAAATGTGAATAGGAGTATCATGAGTTGCTGGTGGGAGCAAACAAATCAGACTGGGAATTTGATCCACATTGAAGATGTGCAACACCTAACTGCTGATAGGTTGGAGCATTTGATGACCATGTATGGCAGTTTTGATCTTGTTGTGGGGGGGAGTCCATGCAACAATCTGGCAGGTAGCAATCGCCATCACCGTGATGGACTTGAGGGCAAAGAATCTTCCCTCTTCTTTGATTACTGTCGTATCCTAGATGTGGTTAAGAGTTTAACATCTAGATACAGTTGA。
[0047] Table 1 CRISPR / Cas9 amplification primers
[0048]
[0049] Example 2[[ID=Obtaining poplars with knockout of the DNA methyltransferase DMT2 gene. Transformation of poplars (Populus alba) was performed using Agrobacterium GV3101-mediated leaf infection and callus culture. The specific steps are as follows:
[0051] First, Agrobacterium GV3101 carrying the recombinant plasmid constructed in Example 1 was cultured in LB medium containing kanamycin (Kan, 50 μg / mL) and rifampicin (Rif, 50 μg / mL) with shaking until the OD 600 ≈0.4. The bacterial liquid was centrifuged at 4000 rpm and 4°C for 10 min to collect the bacteria, and resuspended with WPM resuspension solution (WPM medium 2.41 g / L, sucrose 30 g / L, acetosyringone AS 100 μmol / L; WPM medium was obtained from a conventional commercial source) and revived at 28°C and 220 rpm for 0.5-1 hour (hr), and stored in an ice bath for later use. Leaves of 4-week-old sterile tissue culture seedlings (sterile seedlings were obtained by sterilization of Populus alba explants and subcultured every four weeks for sustainable use) were selected (reference: Liu YJ, Jiang PF, Han XM et al. Genomeand CRISPR / Cas9 system of a widespread forest tree (Populus alba) in the world [J]. Plant Biotechnology Journal, 2024, 23 (3): 857-859) to remove the leaf edges and cut the leaves into 0.5 cm 2Small pieces of explants were immersed in the prepared bacterial solution (GV3101) and infected for 15 minutes. After infection, the explants were blotted dry with sterile filter paper and plated on CM1 co-cultivation medium (WPM medium 2.41 g / L, agar 6 g / L, sucrose 30 g / L, AS 100 μmol / L, zeatin ZT 10 mg / L, naphthaleneacetic acid NAA 1 mg / L) for 2 days in the dark at 25°C. Subsequently, they were transferred to CM3 medium (WPM medium 2.41 g / L, agar 6 g / L, sucrose 30 g / L, ZT 10 mg / L, NAA 1 mg / L, cephalosporin Cef 400 mg / L, hygromycin Hgy 10 mg / L) and cultured in the dark for 5-6 weeks (medium change every 10-14 days). When pale yellow callus appeared on the edge of the leaves, it was transferred to CM3 medium (WPM medium 2.41 g / L, agar 6 g / L, sucrose 30 g / L, ZT 10 mg / L, NAA 0.1 mg / L, Cef 400 mg / L, Hgy 10 mg / L) and cultured under 2000 lx light intensity, 25 ° C, and 16 / 8 hr photoperiod (the medium was changed regularly). After adventitious buds differentiated from callus, they were transferred to CM4 medium (WPM medium 2.41 g / L, agar 6 g / L, sucrose 30 g / L, NAA 0.1 mg / L, 6-benzylaminopurine 6-BA 0.5 mg / L, Cef 400 mg / L, Hgy 10 mg / L). When the adventitious buds grew to more than 2 cm, they were cut and transferred to CM5 medium (WPM medium 2.41 g / L, agar 6 g / L, sucrose 30 g / L, indolebutyric acid IBA 0.5 mg / L, Cef 400 mg / L, Hgy 10 mg / L) to induce rooting, complete the genetic transformation and regeneration process, and obtain transgenic plants.
[0052] Initial PCR analysis of DNA extracted from positive plants using Cas9 primers (Cas9-F and Cas9-R) revealed a single band at the corresponding position in each positive plant, while no amplified band was observed in the wild-type plant, preliminarily indicating that the target vector had been incorporated into the poplar genome. Primers were designed to amplify the 150-250 bp flanking region of the target site. PCR products were then sequenced using next-generation sequencing to identify the type of gene editing. Three lines, KO2-4, KO2-7, and KO2-15, were identified with distinct editing patterns. The sequences of the Cas9 primers and genotyping primers are shown in Table 2. The sequencing results showed that strain KO2-4 had a single base insertion (+A) at the second target site of the gene sequence (1174bp); strain KO2-7 had a C base insertion at the first target site of the gene sequence (1040bp), and a 5bp deletion (-CCTTG) at the second target site (1170bp-1174bp); strain KO2-15 had a single base deletion (-C) at the first target site (1040bp). All three strains showed premature termination of amino acid transcription, indicating that these three strains were loss-of-function mutants ( Figure 1 ).
[0053] Table 2 Identification primer sequences
[0054] Primers Sequence information 5'→3' Length / bp Cas9-F TTCTCAGGCTTGTGACGACC(SEQ ID NO.11) 20 Cas9-R GAACCTCCCCCAACGAGAAGG(SEQ ID NO.12) 20 DMT2-T1-F actgcgtacaagctcCGATTGTGGAGCCAGAATTTGT(SEQ ID NO.13) 36 DMT2-T1-R cagagtcctgagtgcTCTTTCTCTGTCAGCTTTGCACT(SEQ ID NO.14) 37 DMT2-T2-F actgcgtacaagctcGCCTGCATGGGATGAGAGAA(SEQ ID NO.15) 35 DMT2-T2-R cagagtcctgagtgcGCATTTCAACTTCATCAGCCTCA(SEQ ID NO.16) 38
[0055] Example 3
[0056] The plant heights of the two-month-old knockout plants and the wild-type Populus alba in Example 2 were measured, and the experiment was repeated three times.
[0057] The results are as follows Figure 2 The results showed that compared with the wild type, the plant height of the three knockout lines was significantly reduced by 39.36%, 46.81% and 42.53% respectively. Growth and development were significantly inhibited.
[0058] Example 4
[0059] Two-month-old knockout plants and wild-type Populus alba from Example 2 were subjected to salt stress using 250 mM NaCl. Specifically, seedlings from each strain with consistent growth status were randomly divided into treatment and control groups (at least three plants per group per strain). The treatment group was drenched with a 250 mM NaCl solution, while the control group was simultaneously irrigated with an equal amount of pure water. Four days after treatment, the Populus alba plants were systematically observed for phenotypic changes and resistance responses.
[0060] The results are as follows Figure 3 As shown: It was observed that after 4 days of salt stress treatment, leaves wilted at the base of the stems of the wild-type Populus alba, while the knockout plants grew well.
[0061] Example 5
[0062] The effects of salt stress on malondialdehyde (MDA) content and catalase (CAT) antioxidant enzyme activity in transgenic and wild-type P. alba plants were analyzed. Oxidative indices were measured for each two-month-old transgenic strain and wild-type plant from Example 4 before and after salt stress treatment. Malondialdehyde (MDA) content and catalase (CAT) antioxidant enzyme activity in P. alba leaves were measured using kits from Suzhou Keming Biotechnology Co., Ltd. Three replicates were used for the experiment.
[0063] The results are as follows Figure 4As shown: Before salt stress treatment (CK), there was no significant difference in MDA content among plants. After salt stress, the MDA content of the wild type was significantly increased compared with the control group CK (P < 0.05), while the MDA content of the knockout plants was not significantly different from that of the CK. Before salt stress, there was no significant difference in CAT activity among plants. After salt stress, the CAT activity of the wild type was significantly reduced by 36.85% compared with the control group CK, while the CAT activity of the knockout plants increased by an average of 15.40% compared with the CK. Under salt stress treatment, the CAT activity of the knockout plants was significantly increased by an average of 96.22% compared with the wild type.
[0064] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. Application of a DNA methyltransferase gene DMT2 in regulating salt resistance in poplar.
2. The use according to claim 1, characterized in that: The amino acid sequence encoded by the DNA methyltransferase gene DMT2 is shown in SEQ ID NO.
1.
3. The use according to claim 2, characterized in that: The nucleotide sequence of the DNA methyltransferase gene DMT2 is shown in SEQ ID NO.
2.
4. The use according to claim 1, characterized in that: The regulation is achieved by knocking out the DNA methyltransferase gene DMT2, and the salt stress resistance of the poplar is improved by inhibiting the expression of the DNA methyltransferase gene DMT2 of the poplar.
5. The use according to claim 1, characterized in that The knockout of the DNA methyltransferase gene DMT2 is achieved by any of the following methods: (a) Inserting a base A between bp 1174 and bp 1175 of the CDS sequence of the DNA methyltransferase gene DMT2 to terminate amino acid transcription prematurely; (b) inserting a C base between 1140bp and 1141bp of the CDS sequence of the DNA methyltransferase gene DMT2, and deleting the 5 bases CCTTG between 1170bp and 1174bp, thereby terminating amino acid transcription prematurely; (c) A base C is deleted at 1140 bp in the CDS sequence of the DNA methyltransferase gene DMT2, causing premature termination of amino acid transcription.
6. A method for improving salt resistance of poplar by knocking out DNA methyltransferase DMT2, characterized in that: The method comprises the following steps: performing targeted knockout on the DMT2 gene in DNA methyltransferase, constructing a knockout vector, and then genetically transforming poplar leaves by Agrobacterium-mediated method to obtain transgenic plants, thereby achieving the purpose of improving the salt resistance of poplars.
7. A DNA methyltransferase DMT2 mutant, characterized in that: The DNA methyltransferase DMT2 mutant is any one of the following: (a) inserting a base A between bp 1174 and bp 1175 of the CDS sequence of the DNA methyltransferase gene DMT2; (b) inserting a C base between bp 1140 and bp 1141 of the CDS sequence of the DNA methyltransferase gene DMT2, and deleting 5 bases CCTTG between bp 1170 and bp 1174; (c) A base C is deleted at 1140 bp in the CDS sequence of the DNA methyltransferase gene DMT2.
8. A recombinant expression vector or recombinant bacterium containing the DNA methyltransferase DMT2 mutant according to claim 7.
9. Use of the DNA methyltransferase DMT2 mutant according to claim 7 in improving salt resistance of poplar or in breeding salt-alkali tolerant trees.
10. The use according to claim 9, characterized in that: The trees are poplars; The poplar is Populus alba.