Application of rice OsC3H33 gene in regulation and control of plant grain size

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a rice OsC3H33 gene to regulation and control of plant grain sizes. According to the invention, under the background of different rice varieties, the mutants of the osc3h33-1 and the osc3h33-2, which are lack of functions, are successfully obtained. Researches find that the two mutants both have the phenomena that the number of grains per ear is reduced, and the grain length and thousand grain weight are reduced. Cytological observation shows that the longitudinal cell width and length of the osc3h33-1 and osc3h33-2 mutants are obviously reduced, the length of the transverse cell of the osc3h33-1 is not obviously changed, but the width is reduced. When the OsC3H33 mutant is applied to rice, the grains of the two mutants become smaller, and the cell area becomes smaller, which indicates that the OsC3H33 can adjust the grain size by influencing the cell expansion under different rice backgrounds, and further influence the thousand grain weight. In addition, the chalkiness degree of the grains of the mutant after the OsC3H33 gene is knocked out is obviously increased compared with that of the wild type.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of rice OsC3H33 gene in regulating plant grain size. Background Art

[0002] Rice, the staple food for half the world's population, has a wide range of uses, serving not only as food but also as feed and medicinal. While rice production has shown a clear upward trend thanks to advances in breeding, irrigation systems, and farming techniques, it still faces multiple challenges. First, arable land is limited, especially in regions experiencing rapid urbanization and industrialization. At the same time, global food demand continues to grow, primarily in densely populated Asia and Africa. Furthermore, market fluctuations and climate change are impacting rice production. Rice yield will remain a key research and focus for a long time to come. The "four elements" of rice yield generally refer to the number of effective panicles per mu (approximately 1,000 acres), the number of grains per panicle, the seed set rate, and the 1,000-grain weight. These four elements are the core foundation for rice yield per unit area and collectively influence final yield performance. Optimizing these traits through genetic research and technological innovation is crucial. Integrating modern biobreeding, resource management, and international cooperation is the key path to breaking through the bottleneck of grain production and ensuring food security. Summary of the Invention

[0003] In response to the problems existing in the prior art, the present invention provides an application of the rice OsC3H33 gene in regulating plant grain size, aiming to solve some of the problems in the prior art or at least alleviate some of the problems in the prior art.

[0004] The present invention is achieved by using the OsC3H33 gene in regulating plant agronomic traits. The OsC3H33 gene is numbered LOC_Os05g03760.

[0005] Furthermore, the plant includes rice.

[0006] Furthermore, the agronomic traits include plant height, fruit set rate, number of grains per ear, grain size, thousand-grain weight or grain chalkiness.

[0007] Furthermore, the OsC3H33 gene regulates grain size by affecting the expansion of rice husk cells.

[0008] The present invention also provides a method for breeding new rice varieties, wherein the OsC3H33 gene in rice plants is knocked out or overexpressed by genetic engineering methods to obtain plants with improved agronomic traits. The OsC3H33 gene is numbered LOC_Os05g03760.

[0009] Furthermore, the genetic engineering method includes using CRISPR-Cas9 technology to construct mutant plants in which the OsC3H33 gene is knocked out or silenced.

[0010] Furthermore, the rice includes CX35-2x or japonica rice Zhonghua 11 line.

[0011] In summary, the advantages and positive effects of the present invention are as follows: the present invention successfully obtained the functional loss-of-function mutants osc3h33-1 and osc3h33-2 in different rice variety backgrounds. The study found that both mutants showed a decrease in the number of grains per panicle. Continuing to observe the grain morphology, it was found that the grain length and 1000-grain weight of the two mutants also decreased. Cytological observations found that the width and length of the longitudinal cells of the osc3h33-1 and osc3h33-2 mutants were significantly reduced, and the length of the transverse cells of osc3h33-1 did not change significantly, but the width was reduced. The grains of the two mutants became smaller and the cell area became smaller, indicating that OsC3H33 can regulate grain size by affecting cell expansion in different rice backgrounds, thereby affecting the 1000-grain weight. In addition, the chalkiness of the mutant grains was significantly increased compared with the wild type. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Selected agronomic traits of rice CX35-2x and the mutant osc3h33-1; (a) Mutation types of OsC3H33 in CX35-2x and osc3h33-1. Red marks indicate missing parts. (b and c) Comparison of plant height (b) and panicle morphology (c) between rice CX35-2x and the mutant osc3h33-1. Scale bars: 20 cm (b), 3 cm (c). (d-f) Comparison of seed set rate (d), plant height (e), and number of grains per panicle (f) between rice CX35-2x and the mutant osc3h33-1. Values are mean ± SD. Statistical differences were determined by t-test. * indicates significant difference from the control group. *** P < 0.001.

[0013] Figure 2 This is the sequencing result of the mutant osc3h33-1.

[0014] Figure 3Figure 2 shows some agronomic traits of rice ZH11 and the mutant osc3h33-2. (a) Gene sequence differences between OsC3H33 and ZH11. Red boxes indicate missing bases. (b and c) Comparison of plant height (b) and panicle morphology (c) between rice ZH11 and the mutant osc3h33-2. Scale bars: 20 cm (b), 3 cm (c). (d-f) Comparison of seed set rate (d), plant height (e), and number of grains per panicle (f) between rice ZH11 and the mutant osc3h33-2. Values are mean ± SD. Statistical differences were determined by t-test. ns indicates no significant difference. * indicates significant difference compared with the control group. *P < 0.05.

[0015] Figure 4 It is the vector backbone of BGK032.

[0016] Figure 5 This is the sequencing result of the mutant osc3h33-2.

[0017] Figure 6 Grain phenotypic analysis of rice CX35-2x and the mutant osc3h33-1; (a) Comparison of grains between rice CX35-2x and the mutant osc3h33-1. Scale bar: 1 cm. (bd) Comparison of (b) grain length, (c) grain width, and (d) 1000-grain weight between rice CX35-2x and the mutant osc3h33-1. Values are mean ± SD. Statistical differences were determined by t-test. ns indicates no significant difference. * indicates significant difference compared with the control. ***P < 0.001.

[0018] Figure 7 Grain phenotypic analysis of rice ZH11 and the mutant osc3h33-2; (a) Comparison of grains between rice ZH11 and the mutant osc3h33-2. Scale bar: 1 cm. (bd) Comparison of (b) grain length, (c) grain width, and (d) 1000-grain weight between rice ZH11 and the mutant osc3h33-2. Values are mean ± SD. Statistical differences were determined by t-test. * indicates significant difference compared with the control group; *P < 0.05, **P < 0.01, ***P < 0.001.

[0019] Figure 8Cytological observations of glumes from rice plants CX35-2x and the mutant osc3h33-1; (a) Paraffin section illustration. (b and c) Comparison of paraffin sections of glumes from rice plants CX35-2x and osc3h33-1. (c) Magnified image of cells in the black boxed area in (b). Scale bars: 1 mm (b), 100 μm (c). (d) Scanning electron microscopic comparison of glumes from rice plants CX35-2x and osc3h33-1. Scale bar: 50 μm. (e) Comparison of transverse cell length (e), transverse cell width (f), and transverse cell number (g) between rice plants CX35-2x and osc3h33-1 with respect to (c). (hj) Comparison of longitudinal cell length (h), longitudinal cell width (i), and longitudinal cell number (j) between rice plants CX35-2x and osc3h33-1 with respect to (d). The values are mean ± SD, and statistical differences were determined by t-test. ns indicates no significant difference, * indicates significant difference compared with the control group, **P < 0.01, ***P < 0.001.

[0020] Figure 9 Cytological observation of glumes of rice ZH11 and the mutant osc3h33-2; (a) Scanning electron microscopic comparison of glumes of rice ZH11 and the mutant osc3h33-2. Scale bar: 50 μm. (bd) Comparison of longitudinal cell length (b), longitudinal cell width (c), and longitudinal cell number (d) in (a) between rice ZH11 and the mutant osc3h33-2. Values are mean ± SD. Statistical differences were determined by t-test. ns indicates no significant difference. * indicates significant difference compared with the control. **P < 0.01, ***P < 0.001.

[0021] Figure 10 Comparative analysis of chalkiness between wild type and mutant. DETAILED DESCRIPTION

[0022] To further clarify the objectives, technical solutions, and advantages of the present invention, the present invention is further described in detail below with reference to the following examples. Unless otherwise specified, the equipment and reagents used in each example and test example are commercially available. RNA extraction and reverse transcription procedures can be performed using commercial kits. The specific examples described herein are intended only to illustrate the present invention and are not intended to limit the present invention.

[0023] Based on the information contained in this application, it will be readily apparent to those skilled in the art that various changes can be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are provided merely to illustrate specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields would clearly be able to make to the embodiments of the present invention are encompassed within the scope of the appended claims.

[0024] In order to better understand the present invention and not to limit the scope of the present invention, all numbers used in this application to express amounts, percentages, and other numerical values should be understood to be modified by the word "approximately" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods. In the present invention, "about" means within 10% of a given value or range, preferably within 5%.

[0025] In the following embodiments of the present invention, unless otherwise specified, room temperature is used. Room temperature refers to natural room temperature in all seasons without additional cooling or heating, and is generally controlled at 10-30°C, preferably 15-25°C.

[0026] The present invention discloses the application of the rice OsC3H33 gene in regulating plant grain size. The wild-type rice varieties used in this experiment are: CX35-2x and japonica rice Zhonghua 11 (ZH11). Both varieties belong to existing rice varieties in this field and have been disclosed in other patent documents or non-patent documents, such as invention patents with application numbers CN202410409863.8 and CN201610159085.7. All genetic materials were planted in the experimental fields of Wuhan Oil Crops Research Institute in 2023 and 2024. The gene number of OsC3H33 involved in the present invention is LOC_Os05g03760, and the CDS sequence is shown in SEQ ID NO.1. The gene is located on chromosome 5 of rice. The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0027] Example 1 Construction of mutants

[0028] 1. Mutant osc3h33-1

[0029] In this example, a homozygous mutant was constructed in the CX35-2x background and named osc3h33-1. This mutant has a 170 bp deletion between the 423 bp site and the 594 bp site in the coding region of the OsC3H33 gene ( Figure 1 The specific construction method is as follows:

[0030] (1) Target design: Two targets were designed based on the CDS sequence of C3H33: T1: GGTCGACGCGCTCTCGGCTTCGG, SEQ ID NO. 2; and T2: AGGTCGGGCAGCGTCAGGTCAGG, SEQ ID NO. 3.

[0031] (2) Amplification of sgRNA expression cassette.

[0032] ① Primers for amplifying the sgRNA expression cassette

[0033] Cas-9-gRT1: GTCGACGCGCTCTCGGCTT gttttagagctagaaat, SEQ ID NO.4 Cas-9-OsU6aT1: AAGCCGAGAGCGCGTCGAC Cggcagccaagccagca, SEQ ID NO.5 Cas-9-gRT2: AGGTCGGGCAGCGTCAGGTC gttttagagctagaaat, SEQ ID NO.6

[0034] Cas-9-OsU6bT2: GACCTGACGCTGCCCGACCT Caacacaagcggcagc, SEQ ID NO.7U-F: CTCCGTTTTACCTGTGGAATCG, SEQ ID NO.8

[0035] gRNA-R:CGGAGGAAAATTCCATCCAC, SEQ ID NO.9

[0036] Pps-R: TTCAGAggtctcT accg ACTAGTATGGAATCGGCAGCAAAGG, SEQ ID NO.10

[0037] RB-R:AAGTTGGGTAACGCCAGGGT, SEQ ID NO.13

[0038] ② Overlap PCR and nested PCR amplification of sgRNA expression cassette

[0039] 1) First round of PCR amplification of U6 promoter and gRNA;

[0040]

[0041]

[0042] PCR reaction parameters:

[0043]

[0044] 2) Second round of PCR amplification of the sgRNA expression cassette;

[0045] sgRNA expression cassette amplification system:

[0046]

[0047] PCR reaction parameters:

[0048]

[0049] (3) Enzyme digestion-ligation reaction

[0050] Connection system:

[0051]

[0052]

[0053] Connection conditions:

[0054]

[0055] (4) Recombinant plasmid transformation. Take a tube of 100μL DH5a competent E. coli cells and mix it with 2-5μL ligation product, and place it on ice for 30 minutes; quickly place it in a 42℃ constant temperature water bath, heat shock it for 90 seconds, and place it on ice for 2 minutes; add 500μL LB liquid culture medium and mix it evenly; culture it at 37℃ and 200rpm for 45 minutes to allow the cells to return to normal growth state; evenly spread the bacterial liquid on a Kana-resistant LB solid culture medium plate; after 30 minutes, place it in a 37℃ constant temperature incubator and culture it overnight. (5) Bacterial detection. Use the SP-L / RB-R primer pair for colony PCR detection, and the band size is about 1300bp; the positive plaques detected are picked and shaken.

[0056] Colony PCR amplification system:

[0057]

[0058] Colony PCR reaction parameters:

[0059]

[0060] (6) Sequencing: The plasmids extracted from the positive plaques were subjected to Sanger sequencing using the sequencing primers SP-L / RB-R.

[0061] (7) Transformation of expression vector Agrobacterium and genetic transformation of rice. The plasmid of the correctly sequenced vector was extracted and transformed into EHA105 Agrobacterium. The plasmid was screened and cultured on YEB plates containing kanamycin (50 μg / mL) and rifampicin resistance (50 μg / mL). The plaques were picked for colony PCR (95℃5min; 95℃30sec; 55℃30sec; 72℃2min; 72℃2min) verification. The positive bacterial liquid was expanded and cultured, the bacterial liquid was centrifuged, and the bacteria were resuspended in MS liquid medium. The resuspended liquid was then used to infect rice callus tissue. The infected callus tissue was screened in MS solid medium containing NAA (2 μg / L), 6-BA (1 mg / L) and hygromycin (200 mg / L). Finally, callus tissue and positive seedlings that passed the resistance screening were obtained; the gene-edited plants were self-pollinated and the T1 generation was obtained for subsequent experiments. Sequencing identification of mutant positive seedlings: the sequencing primers used were F: GGTGCTTGGGTATGTCGTGG, SEQ ID NO.14; R: TCCAGTCATGGGAGTAGGCG, SEQ ID NO.15.

[0062] The mutation of the mutant occurred between the 423bp site and the 594bp site in the coding region of the OsC3H33 gene, with a base deletion of 170bp. The sequencing results are as follows: Figure 2 .

[0063] 2. Mutant osc3h33-2

[0064] osc3h33-2 is a mutant constructed in the ZH11 background ( Figure 3 The specific construction method is as follows: Use the instructions for the CRISPR / Cas vector construction kit of BioGene Technology (Jiangsu) Co., Ltd. (Cat. No.: BGK03) to construct. Use BGK032 as the vector, Figure 4 As its carrier skeleton.

[0065] (1) Design sgRNA target sequence.

[0066] The target was designed according to the CDS sequence of OsC3H33, and GGAGAAGGTGTCTCTTGGCGTGG was finally selected as the target of sgRNA.

[0067] (2) Preparation of oligo dimers.

[0068] Synthetic Oligo sequence, UP: 5'-TGTGTGGGAGAAGGTGTCTCTTGGCG, SEQ ID NO. 16. LOW: 5'-AAACCGCCAAGAGACCTTTCCCCA, SEQ ID NO. 17.

[0069] Dissolve the synthesized oligo in water to 10 μM using the following reaction system: 18 μl of Buffer Aneal, 1 μl of UP Oligo, 1 μl of Low Oligo, and 20 μl of Total. After mixing, heat at 95°C for 3 minutes, then slowly reduce the temperature to 20°C at a rate of approximately 0.2°C / second.

[0070] (3) Construct the oligo dimer into the CRISPR / Cas vector.

[0071] Prepare the following reaction system: 6 μl of H2O, 2 μl of CRISPR / Cas Vector, 1 μl of Oligo Dimer, 1 μl of Enzyme Mix, and 10 μl of Total. Mix all components on ice and incubate at room temperature (20°C) for 1 hour.

[0072] (4) Transformation competent state.

[0073] Add 5 μl of the reaction solution to at least 50 μl of DH5α competent cells, mix thoroughly, and incubate on ice for 30 minutes (do not shake during this time; keep the cells stationary). Gently remove the cells, heat shock them at 42°C for 60 seconds, and immediately place them on ice for 2 minutes. Add 500 μl of SOB / LB and incubate them at 37°C at 200 rpm for 1 hour. Spread an appropriate amount of the bacterial solution onto an LB plate containing kanamycin and incubate them inverted at 37°C overnight. Screen for positive clones. Perform colony PCR (95°C for 5 minutes, 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 2 minutes, and 72°C for 2 minutes) using the target-specific primer pair (F: GGAGAAGGTGTCTCTTGGCG, SEQ ID NO. 18; R: CGCCAAGAGACACCTTCTCC, SEQ ID NO. 19). After electrophoresis on a 1% agarose gel, confirm the results by sequencing.

[0074] (6) Transformation of the expression vector with Agrobacterium and genetic transformation of rice. The transformation was carried out according to the above-described method for transforming the osc3h33-1 mutant. The gene-edited plants were self-pollinated to obtain the T1 generation for subsequent experiments. Sequencing of positive mutant seedlings was performed: the sequencing primers used were F: CCGCGCAAGCCGTCCACACC, SEQ ID NO. 20; R: GCCGCCACGACATACCCAAG, SEQ ID NO. 21.

[0075] The osc3h33-2 mutant was found to be a homozygous mutant with a G base deletion. Figure 5 .

[0076] Example 2 Analysis of agronomic traits of rice

[0077] Rice seedlings were transplanted after they grew to a certain size and grown to maturity under natural conditions. The main agronomic traits such as plant height, grain length, grain width, 1000-grain weight and fruit set rate of wild-type and mutant plants planted in the field were examined.

[0078] 1. Analysis of some agronomic traits of OsC3H33 mutant materials

[0079] A systematic analysis of agronomic traits was conducted on CX35-2x and the mutant osc3h33-1. No significant differences were found between the two at the seedling stage. However, when the rice entered the mature stage, it was found that the mutant osc3h33-1 plants were significantly shorter than CX35-2x. The average plant height of CX35-2x plants was significantly higher than that of osc3h33-1 by 20.82 cm, a significant increase of 16.93% ( Figure 1 In terms of fruit set rate, the fruit set rate of osc3h33-1 was only 63.52%, which was a significant decrease compared with CX35-2x ( Figure 1 The statistical results of the number of grains per ear also showed significant differences. Compared with CX35-2x, the number of grains per ear of osc3h33-1 was reduced by 23.30% ( Figure 1 f) in the above example.

[0080] A comparative analysis of agronomic traits of ZH11 and the mutant osc3h33-2 also revealed no significant differences between the two at the seedling stage. However, unlike osc3h33-1, at maturity, the height and fruit set rate of the mutant osc3h33-2 were not significantly different from those of ZH11. Figure 3 However, there was a significant difference in the number of grains per ear between ZH11 and osc3h33-2. The number of grains per ear in osc3h33-2 was significantly less than that in ZH11, with the reduction reaching 15.25% ( Figure 3(f) The above results indicate that knockout of OsC3H33 negatively regulates the number of grains per ear, a factor affecting yield.

[0081] 2. Functional study of OsC3H33 in regulating grain size

[0082] The grains of osc3h33-1 were compared with those of CX35-2x. The results showed that the grain length of the mutant osc3h33-1 was significantly shorter than that of CX35-2x, which was 4.49% shorter ( Figure 6 In addition, the thousand-grain weight of osc3h33-1 was also significantly lower than that of CX35-2x, with a reduction of 11.58% ( Figure 6 However, the grain width of osc3h33-1 was not significantly different from that of CX35-2x ( Figure 6 a and c).

[0083] The grains of osc3h33-2 and ZH11 were compared and the results showed that the length and width of the grains of ZH11 were significantly larger than those of the mutant osc3h33-2 ( Figure 7 In addition, the thousand-grain weight of the mutant osc3h33-2 was also significantly lower than that of ZH11 ( Figure 7 The above results indicate that knockout of OsC3H33 leads to smaller rice grains, so OsC3H33 can promote the enlargement of rice grains.

[0084] 3. OsC3H33 regulates grain size by affecting rice husk cell expansion

[0085] To understand the cytological mechanism behind the smaller grains of the mutants osc3h33-1 and osc3h33-2, we first observed the transverse cells of the hulls of CX35-2x and the mutant osc3h33-1 using paraffin sections. The results showed that the length and number of transverse cells of the mutant osc3h33-1 were not significantly different from those of CX35-2x. However, the width of the transverse cells of osc3h33-1 was significantly reduced, with a reduction of 24.18% ( Figure 8 At the same time, scanning electron microscopy was used to observe the longitudinal cells of CX35-2x and the mutant osc3h33-1. The number of longitudinal cells in osc3h33-1 did not change significantly compared with CX35-2x, but the length and width of the cells were significantly reduced, with a reduction of 29.35% and 12.93%, respectively. Figure 8 hj in).

[0086] In addition, the longitudinal cells of ZH11 and the mutant osc3h33-2 were also observed using scanning electron microscopy. Similar to the comparison results between CX35-2x and the mutant osc3h33-1, the number of longitudinal cells in the mutant osc3h33-2 did not change significantly compared with ZH11, but the length and width of the cells were significantly reduced, with a reduction of 21.55% and 7.5%, respectively. Figure 9 ).

[0087] These results suggest that the small grains of osc3h33-1 and osc3h33-2 mutants may be caused by a reduction in cell area. These data further indicate that OsC3H33 regulates grain size by affecting cell expansion.

[0088] 4. Regulation of OsC3H33 on grain chalkiness

[0089] To investigate the regulatory effect of this gene on the chalky trait of rice grains ( Figure 10 In the cx35-2x genetic background, the chalkiness of the osc3h33-1 mutant was significantly different from that of the wild type ( Figure 10 C). In the ZH11 genetic background, the chalkiness of the osc3h33-2 mutant was significantly different from that of the wild type ( Figure 10 (F) In the ZH11 background, the increase in chalkiness of the osc3h33-2 mutant was 9.06-fold greater than that of the c3h33-1 mutant in the cx35-2x background.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of the OsC3H33 gene in regulating plant agronomic traits. The OsC3H33 gene is numbered LOC_Os05g03760.

2. The use according to claim 1, characterized in that: The plants include rice.

3. The use according to claim 2, characterized in that: The agronomic traits include plant height, fruit set rate, number of grains per ear, grain size, thousand-grain weight or grain chalkiness.

4. The use according to claim 3, characterized in that: The OsC3H33 gene regulates grain size by affecting the expansion of rice husk cells.

5. A method for cultivating new rice varieties, characterized by: The OsC3H33 gene in rice plants is knocked out or overexpressed by genetic engineering methods to obtain plants with improved agronomic traits. The OsC3H33 gene is numbered LOC_Os05g03760.

6. The method for cultivating new rice varieties according to claim 5, characterized in that: The genetic engineering method includes using CRISPR-Cas9 technology to construct a mutant plant in which the OsC3H33 gene is knocked out or silenced.

7. The method for cultivating new rice varieties according to claim 6, characterized in that: The rice includes CX35-2x or japonica rice Zhonghua 11 line.

Images