Application of GhCOX11 protein and coding gene thereof in regulation and control of drought tolerance and low temperature resistance of cotton

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly provides application of GhCOX11 protein and a coding gene thereof in regulation and control of drought tolerance and low temperature resistance of cotton. The protein meets the following conditions: B1) a protein with an amino acid sequence of SEQ ID NO.1; and B2) a fusion protein with the same function obtained by connecting a tag to the N end and / or C end of B1). After the GhCOX11 gene is cloned and an overexpression vector is constructed, the overexpression vector is transformed into tobacco to obtain an overexpression plant, and the drought tolerance and the low temperature resistance of the overexpression plant are obviously improved. The identification of the cotton GhCOX11 gene and the analysis of the drought-resistant and low-temperature-resistant functions enrich the gene resources of the drought-resistant and low-temperature-resistant breeding of cotton, and have important theoretical significance and application value for the breeding and screening of drought-resistant and low-temperature-resistant plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering and relates to the application of GhCOX11 protein and its encoding gene in regulating drought resistance and low temperature resistance of cotton. Background Art

[0002] Drought and low-temperature stresses are currently daunting challenges facing global agricultural production, severely restricting the entire process of plant growth and development. Water deficit disrupts normal crop physiological metabolism through multiple pathways and multi-level mechanisms, triggering profound changes in plant morphology, structure, and physiological function. Research has shown that reactive oxygen species (ROS) signaling networks and mitochondrial regulatory mechanisms play a central role in plant responses to drought and low-temperature stress. Drought and low-temperature stress disrupt the dynamic balance between ROS production and clearance in plants, leading to oxidative stress and cellular damage. Notably, ROS also act as signaling molecules to activate stress-responsive gene expression networks. Mitochondria, as the core sites of energy metabolism and ROS production, play a dual role in drought response. Under drought conditions, mitochondria regulate cellular energy homeostasis by remodeling electron transport chain activity and ATP synthesis patterns. Changes in their redox state can also regulate nuclear gene expression through retrograde signaling.

[0003] Cytochrome c oxidase (COX / CcO) is a terminal oxidase in the mitochondrial respiratory chain. Members of the COX family possess a characteristic cytochrome c binding domain and oxidase catalytic domain. In plants, the COX gene family significantly enhances stress tolerance by maintaining energy homeostasis. Among them, COX11, a copper chaperone responsible for transporting Cu(I) to the CuB site of COX1, is crucial for maintaining respiratory chain function. Studies in Saccharomyces cerevisiae have shown that COX11 deficiency leads to respiratory defects. In addition to participating in complex IV assembly, COX11 also regulates redox homeostasis through its conserved cysteine residues. Studies have shown that COX11 expression is induced by oxidative stress in Arabidopsis and rice, affecting ROS levels. Rice OsSPL10 regulates ROS accumulation and programmed cell death through the OsNAC2-OsAP37 / OsCOX11 module, suggesting that COX11 plays an important role in linking mitochondrial function and oxidative stress responses. However, COX11 has yet to be clearly identified and its function verified in cotton. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to utilize the above-mentioned COX11 and its encoding gene to regulate the drought resistance and low temperature resistance of cotton.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: A first aspect of the present invention provides an application for increasing protein content and / or activity, wherein the application is any one of the following: A1) Application in improving drought tolerance and / or low temperature tolerance of cotton; A2) Use in the preparation of products that improve drought tolerance and / or low temperature tolerance of cotton; A3) Application in breeding drought-tolerant and / or low-temperature-tolerant cotton; A4) Use in the preparation of products for breeding drought-tolerant and / or low-temperature-tolerant cotton; A5) Application in breeding for drought tolerance and / or low temperature tolerance in cotton; The protein is named GhCOX11 and meets the following conditions: B1) a protein having an amino acid sequence of SEQ ID NO. 1; B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

[0006] In the above application, the protein GhCOX11 can be derived from cotton.

[0007] Furthermore, the protein GhCOX11 may be cotton drought tolerance and / or low temperature tolerance-related protein GhCOX11.

[0008] In order to facilitate the purification or detection of the protein in B1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing.

[0009] The tag protein includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0010] The second aspect of the present invention provides an application of a biomaterial related to the protein GhCOX11, wherein the application is any of the following: D1) Application in improving drought tolerance and / or low temperature tolerance of cotton; D2) Use in the preparation of products that improve drought tolerance and / or low temperature tolerance of cotton; D3) Application in breeding drought-tolerant and / or low-temperature-tolerant cotton; D4) Use in the preparation of products for breeding drought-tolerant and / or low-temperature-tolerant cotton; D5) Application in breeding for drought tolerance and / or low temperature tolerance in cotton; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that promotes or increases the expression of the gene encoding the protein GhCOX11; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

[0011] In the above application, the nucleotide sequence of the protein GhCOX11 encoding gene (CDS) is the nucleotide sequence shown in SEQ ID NO. 2.

[0012] The third aspect of the present invention provides a method for cultivating drought-resistant and / or low-temperature-resistant plants, which comprises increasing the content and / or activity of the protein GhCOX11 in the target plant to obtain a drought-resistant and / or low-temperature-resistant plant having higher drought-resistant and / or low-temperature resistance than the target plant, wherein the plant is cotton.

[0013] In the above method, increasing the content and / or activity of the protein GhCOX11 in the target plant is achieved by increasing the expression level of the gene encoding the protein GhCOX11 in the target plant.

[0014] In the above method, increasing the expression level of the gene encoding the protein GhCOX11 in the target plant is to increase the expression level of the gene encoding the protein GhCOX11 in the genome of the target plant using transgenic technology.

[0015] In the above method, the use of transgenic technology to increase the expression level of the gene encoding the protein GhCOX11 in the genome of the target plant is performed by introducing a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

[0016] Beneficial effects of the present invention: The GhCOX11 protein and its encoding gene of the present invention can regulate drought and cold tolerance in cotton. By increasing the content and / or activity of the GhCOX11 protein in target plants, the drought and / or cold tolerance of target plants can be significantly improved. Therefore, the cotton drought and cold tolerance-related protein GhCOX11 and its encoding gene have important theoretical and practical significance in regulating drought and cold tolerance in cotton. The present invention is of great significance for the cultivation of transgenic cotton with drought and cold tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The expression pattern of GhCOX11 and VIGS-mediated GhCOX11 silencing and drought stress treatment.

[0018] Figure 2 This study is about the drought resistance of GhCOX11 in tobacco.

[0019] Figure 3 This study is about the drought resistance of GhCOX11 in tobacco.

[0020] Figure 4 This study is about the cold resistance of GhCOX11 in tobacco. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0022] Example 1 Functional identification of the GhCOX11 gene 1. Materials and Methods 1.1 Plant materials The tobacco receptor variety NC89.

[0023] 1.2 Strains and plasmids The vectors used in this experiment were pCBSG015 and pCAMBIA2301 (stored in our laboratory), the competent E. coli DH5α was purchased from Quanshijin (Beijing) Biological Company, and the Agrobacterium tumefaciens LBA4404 was stored in our laboratory.

[0024] 1.3 Main Reagents The high-fidelity 2× Phanta Max Master Mix used in the experiment was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; KpnⅠ enzyme, SalⅠ enzyme, EcoRⅠ enzyme and T4 ligase were purchased from New England Biolabs, and pEASY-T1 simple cloning vector was purchased from Quanshijin (Beijing) Biotechnology Co., Ltd.

[0025] 1.4 Agrobacterium-mediated genetic transformation of tobacco (1) Pick a single colony and inoculate it into YEB liquid medium containing the corresponding antibiotics. Culture it at 28°C and 200 rpm with shaking until OD600 is 0.6-0.8. Collect the bacteria by centrifugation at 4,000 rpm for 10 min, and resuspend them in MS liquid medium containing AS (without antibiotics) to OD600 ≈ 0.5 for later use.

[0026] (2) Take young leaves from sterile tobacco seedlings and cut leaf discs with a diameter of approximately 0.5–1 cm using a sterile punch (or blade). Immerse the leaf discs in the Agrobacterium suspension (prepared in step 1) for 10–15 minutes, gently shaking. Remove the leaf discs and absorb any excess bacterial suspension with sterile filter paper.

[0027] (3) Place the infected leaf disc on MS solid culture medium (containing AS, without antibiotics) covered with filter paper and culture in the dark at 25°C for 2 to 3 days.

[0028] (4) Transfer the co-cultivated leaf discs to MS differentiation medium containing a selective antibiotic (e.g., kanamycin) and a bacteriostatic antibiotic (e.g., cephalosporin, 500 mg / L). Incubate at 25°C with a 16 h / 8 h photoperiod, changing the medium every 2 weeks until resistant buds emerge (approximately 4–6 weeks).

[0029] (5) Cut resistant buds (≥2 cm) and transfer them to MS rooting medium containing selected antibiotics. Cultivate for 2-3 weeks until the root system is fully developed.

[0030] (6) Open the culture bottle cap and gradually adapt to the external environment (3-5 days). Wash the root agar, transplant to sterilized nutrient soil, maintain high humidity (cover with film) for 1 week, and then manage normally.

[0031] 1.5 Identification of overexpression and silenced strains DNA was extracted from overexpression and silenced tobacco strains. Primers were designed for the overexpression vector (CaMV 35S promoter + target gene fragment) and for the silenced strain (to amplify the hairpin structure on the vector). PCR and electrophoresis were performed to confirm successful integration of the exogenous gene into the tobacco genome. Total RNA was extracted from the overexpression and silenced tobacco strains, and qRT-PCR primers were designed. Data were analyzed to detect target gene expression at the mRNA level.

[0032] 1.6 Plant stress treatment Tobacco plants (wild-type, overexpressing, and silenced tobacco lines) were grown in nutrient soil in an artificial climate greenhouse. Culture conditions were set as follows: a 16-h light / 8-h dark photoperiod, a constant temperature of 28±2°C, and a relative humidity of 70%. Plants were used for experimental treatments after three weeks of growth. Drought stress was simulated using a 4% PEG6000 solution; low-temperature stress was simulated in a 4°C incubator with normal watering. The stress treatments included the wild-type, three COX11-overexpressing lines, and three COX11-silencing lines, with 12 seedlings per line. Phenotypic photographs and physiological parameters were taken after one month of treatment. The soil in the pots was removed, the roots were rinsed with clean water, and aboveground and belowground biomass were counted.

[0033] 1.7 Antioxidant enzyme activity assay First, prepare the plant tissue to be tested into a tissue homogenate. Accurately weigh the plant tissue and add phosphate buffer (0.1 mol / L, pH = 7.0-7.4) at a ratio of weight (g) / volume (mL) = 1 / 9. Mechanically homogenize in an ice-water bath to prepare a 10% plant tissue homogenate. Centrifuge for 10 minutes (3500 rpm) and collect the supernatant for subsequent determination.

[0034] 1.8.1 SOD enzyme activity determination Xanthine and the xanthine oxidase reaction system generate superoxide anion radicals (O2-), which oxidize hydroxylamine to form nitrite. Nitrite, which appears purple-red under the action of a color developer, is measured by a visible light spectrophotometer. When the sample being tested contains SOD, it specifically inhibits superoxide anion radicals, reducing the formation of nitrite. During colorimetry, the absorbance of the test tube is lower than that of the control tube. The SOD activity in the sample being tested can be calculated using a formula.

[0035]

[0036] Vortex to mix thoroughly and incubate in a water bath for 40 min (37°C).

[0037] Add 2 mL of color developer to the test tube and control tube respectively, mix well, and place at room temperature for 10 minutes. At 550 nm, use distilled water to adjust the light path to zero in a 1 cm cuvette, and measure the OD value of each tube sample.

[0038] Calculate the sample protein concentration using the following formula.

[0039]

[0040] The total activity is the SOD amount corresponding to the SOD inhibition rate of 50% per milligram of tissue protein in 1 mL of reaction solution, which is one SOD activity unit (U).

[0041] 1.8.2 CAT enzyme activity determination The reaction of catalase decomposing H2O2 can be quickly terminated by adding ammonium molybdate. The remaining H2O2 reacts with ammonium molybdate to produce a light yellow complex. The change in the complex is measured at 405nm, and the activity of CAT can be calculated.

[0042] Preheat reagents 1 and 2 at 37°C

[0043] Mix thoroughly, and measure the OD value of each tube of sample at 405 nm using a 0.5 cm optical path cuvette, adjusted to zero with distilled water.

[0044]

[0045] Note: * 271 is the reciprocal of the slope 1.9 VIGS silencing experiment 1.9.1 Construction and transformation of pTRV2-GhCOX11 plasmid and injection of cotton The CDS fragment of GhCOX11 was amplified, electrophoresed on agarose gel, and recovered. Amplification primers: VIGS-COX11-F: SEQ ID NO. 3: gtgagtaaggttaccgaattTCGAAGAATCTACGGATTTTGTCAC; VIGS-COX11-R: SEQ ID NO. 4: cgtgagctcggtaccggatGTTGGAACAAATTTCCAGGGC. A 50 µL PCR reaction system consisted of 25 µL Superstar Mix, 1 µL template cDNA, 1 µL forward primer, 1 µL reverse primer, and 22 µL ddH2O, mixed thoroughly. PCR protocol: 94°C initial denaturation for 5 min; 94°C denaturation for 30 s; 54°C annealing for 30 s; 72°C extension for 40 s (35 cycles); 72°C extension for 10 min, then storage at 16°C.

[0046] The amplified fragment was ligated to a T-vector using the following reaction system: 4 µL of recovered fragment; 1 µL of T-vector. The reaction was performed at 25°C for 10 minutes, followed by transformation into E. coli, and single clones were selected for sequencing. For VIGs experiments, the pTRV2 vector was used. The target fragment and pTRV2 vector were digested with EcoRI and BamHI, respectively. The digested fragment and vector were ligated using the following system: 1 µL of 1XT4 DNA ligase reaction buffer; 1 µL of T4 DNA ligase; 2 µL of recovered fragment; and 1 µL of pTRV2 vector. The reaction was performed at 16°C for 10 minutes. The resulting recombinant plasmid, pTRV2::GhCOX11, and the empty plasmids (pTRV2 and pTRV1) were transferred into Agrobacterium tumefaciens GV3101 by electroporation.

[0047] Positive single clones were identified by PCR using the following primers: COX11-F: SEQ ID NO. 5: TCGAAGAATCTACGGATTTTGTCAC; COX11-R: SEQ ID NO. 6: GTTGGAACAAATTTCCAGGGC. A 50 µL PCR reaction consisted of 25 µL Superstar Mix, 1 µL template cDNA, 1 µL forward primer, 1 µL reverse primer, and 22 µL ddH2O, mixing thoroughly. The PCR protocol was as follows: 94°C initial denaturation for 5 min; 94°C denaturation for 30 s; 54°C annealing for 30 s; 72°C extension for 40 s (35 cycles); 72°C extension for 10 min, and storage at 16°C. Positive isolates were identified by electrophoresis and stored.

[0048] (1) Activation of strains: Add the Agrobacterium culture containing pTRV2 (empty), pTRV2-GhCOX11, pTRV2-CLA1, and 192 stored at -80 °C to LB liquid culture medium containing 50 μg / mL Kan and 50 μg / mL Rif, and activate the strains in a shaker (28 °C, 200 rpm).

[0049] (2) The activated bacterial solution was aspirated and added to LB liquid medium (this medium contains 10 mM MES pH = 6.5 and 20 μM AS) containing 50 μg / mL Kan and 50 μg / mL Rif. The culture was expanded at 28 °C and 200 rpm until OD600 = 1.2.

[0050] (3) Centrifuge at 5500 rpm for 10 min at 4°C.

[0051] (4) Discard the supernatant and retain the precipitated bacteria, resuspend them in sterile water, and centrifuge and wash them twice.

[0052] (5) Resuspend the Agrobacterium cells in infiltration buffer (containing 10 mM MgCl2, 10 mM MES pH = 5.6, 20 μM AS) to OD600 = 1.2.

[0053] (6) Let stand at room temperature for 3 h.

[0054] (7) Before infection, the pTRV2 (empty), pTRV2-GhCOX11, and pTRV2-CLA1 strain suspensions resuspended in buffer were mixed evenly with the pTRV1 (192) strain suspension in equal volumes.

[0055] (8) Inoculation of Agrobacterium: Use the leaf syringe infiltration method to select cotton seedlings that are in good growth condition and have only two cotyledons. First, use the syringe needle to gently puncture the back of the cotyledon to create a micro-wound, but do not pierce the leaf. Then use a syringe without the needle to inject the bacterial solution from the wound on the back, so that both cotyledons are completely soaked. Plants without treatment serve as controls. The types of plants to be injected are as follows: pTRV1+pTRV2 (empty): negative control for the experiment.

[0056] pTRV1+CLA1: The appearance of an albino phenotype indicates that the VIGS results are reliable: this serves as a positive control for the experiment.

[0057] pTRV1+ pTRV2-GhCOX11: experimental group materials.

[0058] (9) Cultivation of plants after gene silencing: After gene silencing inoculation, the plants were first cultured in the dark at 23 °C for 24 h, and then cultured at 23 °C with a 16 h / 8 h light / dark cycle for 3-4 weeks to observe the phenotype and detect the gene silencing efficiency.

[0059] 1.10 qRT-PCR analysis After VIGS silencing GhCOX11 gene expression, qRT-PCR was used to analyze gene silencing efficiency. The qRT-PCR primer sequences were: qRT-COX11-F: SEQ ID NO. 7: TGCATTAGTGTTTGCAATGGTGG; qRT-COX11-R: SEQ ID NO. 8: CCTCAAAGCAAAAGCACTGG. The RT-qPCR reaction system consisted of 10 µL 2x ChamQ Universal SYBR qPCR Master Mix; 0.4 µL forward primer; 0.4 µL reverse primer; 1 µL template cDNA; and 8.2 µL ddH2O, mixed thoroughly. The RT-qPCR protocol was as follows: Step 1: 95°C pre-denaturation for 30 s; Step 2: 95°C denaturation for 5 s; 60°C annealing for 20 s; Step 3: Melting curve calculation (95°C for 15 s; 60°C for 60 s; and 95°C for 15 s). Real-time quantitative PCR was performed using an ABI 7500 real-time fluorescence quantitative PCR system. Three plants were selected and mixed at each time, and the results were repeated three times.

[0060] 2. Results Analysis 2.1 Analysis of GhCOX11 expression patterns To characterize the expression pattern of GhCOX11, the present inventors detected the expression levels of GhCOX11 in different cotton tissues (roots, stems, leaves, petals, stigmas, pistils, anthers, and young buds) by qRT-PCR. The results showed that GhCOX11 was expressed in all tissues of cotton, with the highest relative expression levels in anthers and buds ( Figure 1 To determine whether GhCOX11 responds to environmental stress, cotton seedlings were subjected to drought, salt, and low temperature treatments. qRT-PCR analysis showed that the expression level of GhCOX11 in cotton seedlings was significantly higher under drought, salt, and low temperature treatments than in the control, and the expression level under drought and low temperature treatments was higher than that under salt treatment, suggesting that it may be involved in the stress response of cotton ( Figure 1 To this end, the present inventors cloned the promoter of GhCOX11 and constructed the GhCOX11-GUS vector driven by it ( Figure 1 c), infected Arabidopsis thaliana through Agrobacterium-mediated genetic transformation. GUS staining results showed that blue precipitates appeared in the roots, stems and leaves of the transgenic lines at the seedling stage of Arabidopsis thaliana ( Figure 1 d in the figure), which is consistent with the qRT-PCR results of GhCOX11 in cotton tissue. A subcellular localization vector was further constructed in which GhCOX11 was fused with enhanced green fluorescent protein (eGFP). Subcellular localization results showed that GhCOX11 protein was localized in mitochondria ( Figure 1 e in the above example).

[0061] 2.2 VIGS-mediated GhCOX11 silencing and drought stress treatment To further determine the biological function of the GhCOX11 gene, VIGS experiments were performed to silence GhCOX11. Three weeks after inoculation with Agrobacterium tumefaciens, the transcript levels of GhCOX11 were significantly reduced in TRV::COX11-1, TRV::COX11-2, and TRV::COX11-3 plants compared with TRV::00 cotton plants ( Figure 1 f). The results indicate that the GhCOX11 gene is effectively silenced in cotton plants. Based on this, the three lines were treated with 4% PEG6000. Drought tolerance was assessed by leaf wilting one week later. The results showed that the leaves of the drought-treated TRV::COX11 plants exhibited significant wilting compared to TRV::00 cotton, accompanied by a reduced plant height and more leaf drop ( Figure 1 g in the figure). The relative water content and H2O2 content of leaves of TRV::00 and TRV::COX11 cotton plants treated with drought were further measured. The water content of leaves of TRV::COX11 was significantly lower than that of TRV::00 ( Figure 1 h), while the H2O2 content was significantly higher than that of the control ( Figure 1 (i) indicates that silencing of GhCOX11 leads to leaf water loss and increased free ROS under drought stress. These results suggest that the GhCOX11 gene plays a role in drought tolerance in cotton by possibly participating in oxidative metabolism.

[0062] 2.3 GhCOX11 improves drought tolerance in cotton In order to further determine the drought tolerance of GhCOX11, the present inventors cloned the GhCOX11 gene and constructed an overexpression vector and an RNAi vector for GhCOX11 ( Figure 2 A total of three positive GhCOX11 transgenic tobacco strains (OE-COX11-1, OE-COX11-2, and OE-COX11-3) were obtained through Agrobacterium-mediated genetic transformation and PCR identification ( Figure 2 b). Three RNAi-COX11 materials (RNAi-COX11-4, RNAi-COX11-9, and RNAi-COX11-11) were obtained. qRT-PCR analysis showed that the expression level of GhCOX11 in overexpressed tobacco was significantly higher than that in WT, while the expression level of GhCOX11 in RNAi-COX11 tobacco was significantly lower than that in WT ( Figure 2(c) indicates that GhCOX11 was effectively overexpressed and silenced. To further determine whether GhCOX11 could enhance drought resistance in tobacco, seedlings of WT, OE-COX11, and RNAi-COX11 were treated with a 4% PEG6000 solution. The results showed that after drought treatment, the lower leaves of all three RNAi-COX11 tobacco lines dried up and turned yellow. The yellowing was milder in the WT than in the RNAi-COX11 lines, while the overexpressing lines only experienced leaf wilting. These results further demonstrate that GhCOX11 can enhance drought tolerance in plants.

[0063] The present inventors measured plant height, aboveground biomass and relative water content (RWC) under drought stress and found that plant height, aboveground biomass and relative water content of leaves of OE-COX11 tobacco were significantly higher than those of WT, while the three physiological indicators of RNAi-COX11 tobacco were significantly lower than those of WT ( Figure 2 e in Figure 2 f in Figure 2 g in the figure). Further observation of the root phenotype under drought treatment showed that the roots of the three OE-COX11 lines were longer and denser compared with RNAi-COX11 tobacco and WT ( Figure 3 By measuring the length, the roots of OE-COX11 tobacco were significantly longer than those of the wild type, while the roots of RNAi-COX11-9 and RNAi-COX11-11 tobacco were significantly shorter than those of the wild type ( Figure 3 Similarly, surface area measurements also showed that OE-COX11 roots had an advantage under stress, with the root surface area of OE-COX11 being significantly larger than that of the control and RNAi-COX11 ( Figure 3 c) in the above example.

[0064] In addition, after drought treatment for one week, trypan blue staining was used to qualitatively observe the number of dead cells based on the staining intensity. After drought treatment, WT and RNAi-COX11 tobacco leaves showed more blue precipitate after trypan blue staining, while OE tobacco leaves showed less blue ( Figure 3(d) indicates that OE-COX11 tobacco materials suffered less damage under drought conditions. Under drought stress, CAT content in the leaves of OE-COX11 lines increased significantly compared to the control and RNAi-COX11 lines. Specifically, CAT content in the OE-COX11 lines was approximately 1.2-fold higher than the control and 1.4-fold higher than the control. Similarly, SOD content in the leaves of OE-COX11 lines was approximately 1.4-fold higher than the control and 1.8-fold higher than the RNAi-COX11 lines under drought stress. Analysis of H2O2 content revealed that H2O2 content in the three overexpressing materials was significantly lower than that in the WT, while H2O2 content in the three RNAi-COX11 tobacco materials was significantly higher than that in the WT. These results suggest that GhCOX11 may mediate plant responses to drought stress by regulating intracellular ROS levels by affecting ROS-related scavenging mechanisms.

[0065] 2.4 GhCOX11 improves cotton's low temperature tolerance Based on the response of COX11 promoter to low temperature, WT, OE-COX11 and RNAi-COX11 seedlings were treated at 4°C. After two weeks of stress, they were transferred to room temperature for 3 days. RNAi-COX11 seedlings showed obvious dehydration, and most seedlings wilted or even died. Since tobacco itself has good tolerance to low temperatures. The control material did not show significant death, and some plants wilted due to water loss. The three overexpressed OE-COX11s performed better overall, and only some plants showed slight wilting of leaves ( Figure 4 The SOD content was measured. Under low temperature stress, the SOD content in the leaves of the RNAi-COX11 line was significantly lower than that of the control and OE-COX11 lines. The SOD content in the RNAi-COX11 line was about 2 times lower than that of the OE-COX11 line ( Figure 4 (b) The rupture of plant cell membranes or the loss of selective permeability is the cytological cause of freezing damage. The electrolyte leakage rate of plant cells is often used to characterize plant cold resistance. Measurements revealed that the electrolyte leakage rate of leaves in RNAi-COX11 strains was approximately 1.5 times higher than that of the control and nearly 2 times higher than that of the OE-COX11 strain ( Figure 4 c). This indicates that the cells were severely damaged by freezing. H2O2 content analysis showed that the H2O2 content of the three OE-COX11 materials was significantly lower than that of the WT, while the H2O2 content of the three RNAi-COX11 tobacco materials was significantly higher than that of the WT ( Figure 4 The results indicate that COX11-mediated plant cold tolerance is also achieved by regulating intracellular ROS levels through ROS-related scavenging mechanisms.

[0066] In summary: This study focuses on analyzing the expression pattern and biological function of the GhCOX11 gene. VIGS experiments showed that silencing this gene significantly reduced plant drought tolerance. Using Agrobacterium-mediated genetic transformation, tobacco lines overexpressing GhCOX11 and RNAi-interference (RNAi) knockout lines were generated. Treatment with 4% PEG and 4°C revealed that leaves of the overexpressing lines wilted less severely than those of wild-type leaves, and their roots were also more robust. Trypan blue staining confirmed that leaves of the GhCOX11-overexpressing lines had fewer dead cells, less damage, and higher expression of antioxidant enzymes (SOD and CAT), confirming these results. In contrast, leaves of the RNAi-interference lines wilted more severely after drought and low-temperature treatment, and their roots were more sparse. Trypan blue staining also confirmed that leaves of the RNAi-interference lines had more dead cells, greater damage, and lower expression of antioxidant enzymes (SOD and CAT), confirming these results. The results showed that GhCOX11 had better drought and low temperature tolerance.

[0067] The present invention has been described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0068] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0069] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0070] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0071] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, can be equivalent parameters, concentration and conditions, implement the present invention in a wide range. Although the present invention provides special embodiments, it should be understood that the present invention can be further improved. In a word, by the principle of the present invention, the application is intended to include any variation, purposes or improvements to the present invention, including departing from the disclosed range in the application, and the changes performed with conventional techniques known in the art.

Claims

1. Application of increasing protein content and / or activity, characterized in that, The application is any of the following: A1) Application in improving the low temperature resistance of cotton; A2) Application in the preparation of products that improve the low-temperature resistance of cotton; A3) Application in breeding cotton with low temperature tolerance; A4) Use in the preparation of products for cultivating cotton that is resistant to low temperatures; A5) Application in breeding for low temperature tolerance in cotton; The protein meets the following conditions: B1) a protein having an amino acid sequence of SEQ ID NO. 1; B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

2. Use of a biomaterial related to the protein according to claim 1, characterized in that: The application is any of the following: D1) Application in improving the low temperature resistance of cotton; D2) Application in the preparation of products that improve the low-temperature resistance of cotton; D3) Application in breeding cotton with low temperature tolerance; D4) Use in the preparation of products for cultivating cotton that is resistant to low temperatures; D5) Application in breeding of cotton for low temperature tolerance; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that promotes or increases the expression of the gene encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

3. The use according to claim 2, characterized in that The CDS sequence of the gene encoding the protein is shown in SEQ ID NO.

2.

4. A method for cultivating low-temperature tolerant plants, characterized in that: The method comprises increasing the content and / or activity of the protein of claim 1 in a target plant to obtain a low-temperature tolerant plant having higher low-temperature tolerance than the target plant, wherein the plant is cotton.

5. The method according to claim 4, characterized in that The increasing of the content and / or activity of the protein of claim 1 in the target plant is achieved by increasing the expression level of the gene encoding the protein in the target plant.

6. The method according to claim 5, characterized in that The method of increasing the expression level of the gene encoding the protein in the target plant is to increase the expression level of the gene encoding the protein according to claim 1 in the genome of the target plant using transgenic technology.

7. The method according to claim 6, characterized in that The use of transgenic technology to increase the expression level of the gene encoding the protein of claim 1 in the genome of the target plant is carried out by introducing a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

Images