PCR (Polymerase Chain Reaction) primer for sex identification of yellow-feather broilers or laying hens and identification method

By providing PCR primers and SNP molecular markers for yellow-feathered broilers or laying hens, combined with gene chips, the problem of gender identification in chicken breeding is solved, rapid and accurate gender identification is achieved, and breeding efficiency and genome selection accuracy is improved.

CN120442772APending Publication Date: 2025-08-08INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510621394.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify the gender of yellow-feathered broiler and laying hen in chicken breeding, which affects the accuracy of genome selection and breeding efficiency.

Method used

PCR primers and SNP molecular markers for gender identification of yellow-feathered broiler or laying hens are provided, combined with gene chips, and gender identification is achieved through PCR amplification and agarose gel electrophoresis detection.

Benefits of technology

Accurate identification of the gender of yellow-feathered broiler and laying hens has been achieved, the accuracy of genome selection has been improved, the cost of invalid phenotype determination and feeding has broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442772A_ABST
    Figure CN120442772A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biological detection, in particular to PCR primers for sex identification of yellow feather broilers or laying hens and an identification method. The invention provides the PCR primer and the identification method for identifying the sex of the yellow-feather broiler chicken or the laying hen, the PCR primer and the identification method are suitable for different varieties of yellow-feather broiler chicken and laying hen, the sex of the yellow-feather broiler chicken and laying hen can be identified only by collecting blood and extracting DNA, the genetic potential of individuals can be evaluated more comprehensively by adding the sex identification site into a chip, and the identification method is suitable for the identification of the sex of the yellow-feather broiler chicken or laying hen. The accuracy of genome selection is further improved, and the method has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological detection, in particular to PCR primers and an identification method for sex identification of yellow-feathered broilers or laying hens. Background Art

[0002] In recent years, the Jingxin No. 1 chip has been widely used in chicken breeding. Compared with traditional breeding, the application of the chip reduces dependence on traditional phenotypic measurements, especially in the early breeding stage. It can quickly screen out individuals with excellent genetic potential, avoiding a large number of ineffective phenotypic measurements and breeding costs.

[0003] Sex-related traits are economically important in chicken production. Incorporating sex identification loci into microarrays can improve the accuracy of hen and hen trait assessments, such as egg production in hens and growth rate in roosters. The inclusion of sex identification loci allows for a more comprehensive assessment of individual genetic potential and further improves the accuracy of genomic selection, which plays a crucial role in supporting comprehensive chicken breeding goals. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention first provides PCR primers for sex identification of yellow-feathered broilers or laying hens, and the sequences of the PCR primers are as follows: F: GAATGGAGCAAGAGCAGATG; (SEQ ID No. 1) R: TTCAGGCACCGTAACACA (SEQ ID No.2) Furthermore, the present invention provides a SNP molecular marker for sex identification of yellow-feathered broilers and laying hens, wherein the SNP molecular marker is obtained by amplification of the PCR primers.

[0005] Preferably, the SNP molecular marker is shown as SEQ ID No.3.

[0006] Preferably, when the 98th position of the sequence shown in SEQ ID No. 3 is "G", it is determined to be a hen.

[0007] Furthermore, the present invention provides a gene chip containing the SNP molecular marker.

[0008] Furthermore, the present invention provides a kit comprising the PCR primers, the SNP molecular markers or the gene chip.

[0009] Furthermore, the present invention provides the use of the PCR primers, the SNP molecular markers, the gene chip or the kit in sex identification of yellow-feathered broilers or laying hens.

[0010] Furthermore, the present invention provides a method for sex identification of yellow-feathered broilers or laying hens, comprising: performing a PCR amplification reaction using the PCR primers described in claim 1.

[0011] Preferably, after the PCR amplification reaction, agarose gel electrophoresis is used to detect specific bands. If no specific band appears, the strain is male, and if a 274 bp band appears, the strain is female.

[0012] Preferably, the PCR amplification reaction conditions are as follows: pre-denaturation at 98°C for 2 min, 1 cycle; denaturation at 98°C for 30 s; annealing at 53°C for 15 s, extension at 72°C for 15 s, for a total of 35 cycles; and final extension at 72°C for 5 min, 1 cycle.

[0013] Preferably, the PCR amplification reaction adopts a 25 μl system.

[0014] Preferably, the PCR amplification reaction system includes: 22 μl of SuperPCRMix, 1 μl of upstream and downstream primers, and 1 μl of genomic DNA.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides PCR primers and identification methods for sex identification of yellow-feathered broilers or laying hens. The methods are applicable to different breeds of yellow-feathered broilers and laying hens. The sex of yellow-feathered broilers and laying hens can be identified simply by collecting blood and extracting DNA. Incorporating the sex identification site into a chip allows for a more comprehensive assessment of the genetic potential of individuals, further improving the accuracy of genome selection, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the electrophoresis diagram of PCR products.

[0017] Figure 2 This is the sequencing result of C6 hen.

[0018] Figure 3 This is the sequencing result of C7 hen.

[0019] Figure 4 This is the sequencing result of C8 hen.

[0020] Figure 5 This is the sequencing result of C9 hen.

[0021] Figure 6 This is the sequencing result of C10 hen.

[0022] Figure 7 This is the sequencing result of D6 hen.

[0023] Figure 8 This is the sequencing result of D7 hen.

[0024] Figure 9 This is the sequencing result of D8 hen.

[0025] Figure 10 This is the sequencing result of D9 hen.

[0026] Figure 11 This is the sequencing result of D10 hen. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of embodiments of the present invention, rather than all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. In the embodiments provided in this specification, those without specifying specific techniques or conditions are described in accordance with the techniques or conditions described in the literature in this area, or are carried out according to product specifications. Reagents or instruments used are not specified by manufacturer and are conventional products that can be purchased through regular channels.

[0028] The present invention relates to molecular biology experiments. Unless otherwise noted, reference can be made to the book Molecular Cloning (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used reference books for those skilled in the art when conducting molecular biology experiments. Furthermore, depending on the purpose of the experiment, those skilled in the art can perform the corresponding experiments under the guidance of the operating manuals provided with various commercial kits or outsource the experiments to specialized companies, such as those for gene sequencing.

[0029] Example 1 This embodiment provides a method for chicken sex identification, the steps are as follows: (1) The blood genomic DNA extraction kit (Tian Gen) was used to extract DNA from the chicken samples.

[0030] (2) PCR amplification of the chicken sample DNA: the primers used are shown in Table 1, the PCR system is shown in Table 2, and the PCR reaction conditions are shown in Table 3.

[0031] Table 1 Primers

[0032] Table 2 PCR system

[0033] Table 3 PCR reaction conditions

[0034] (3) Agarose gel electrophoresis: Glue concentration: 1%, voltage 100V, time 25min.

[0035] Marker: DL5000; the marker consists of eight DNA fragments: 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Take 5 μL of the amplified product for electrophoresis.

[0036] (4) Result judgment: If no specific band appears, it is male; if a 274 bp band (sequence as shown in SEQ ID No. 3) appears, it is female.

[0037] (5) Descriptive statistics of the results: 20 samples were collected from 29-week-old yellow-feathered broiler chickens of two strains (C) and (D). Samples 1-5 were roosters, and samples 6-10 were hens. The electrophoresis of the PCR products is shown in Figure 1 , male samples had no target band, female samples had a 274bp target band, and it was consistent with the actual identification results. The sequencing results of all hens were as follows Figures 2 to 11 As shown, the results show that the SNP sites of hens are all G. The above results show that the specific primers screened by the present invention can achieve the purpose of accurately identifying the sex of yellow-feathered broiler chickens.

[0038] Example 2 This example uses the method of Example 1 to identify the sex of a large number of chicken samples of different breeds to be tested, and compares and verifies the sequencing results of the PCR amplification products with the actual identification results.

[0039] The test results of yellow-feathered broilers are shown in Table 4, the test results of laying hens are shown in Table 5, and the test results of white-feathered broilers are shown in Table 6.

[0040] Table 4 Test results of yellow-feathered broilers

[0041] Resequencing results from yellow-feathered broiler chickens showed that this locus can effectively identify the sex of chickens, with the genotyping results and the actual results being consistent with each other at over 99%. This indicates that this locus is suitable for sex identification of yellow-feathered broiler chickens.

[0042] Table 5 Test results of laying hen strains

[0043] Resequencing results from laying hens showed that this locus can effectively identify the sex of chickens. The genotyping results were completely consistent with the actual results, with an accuracy rate of 100%, indicating that this locus is suitable for sex identification of laying hens.

[0044] Table 6 Test results of white-feathered broiler chickens

[0045] The results of resequencing of white-feathered broiler chickens showed that this locus could not effectively identify the sex of chickens, and the genotyping results did not match the actual results. This indicates that this locus is not suitable for sex identification of white-feathered broiler chickens.

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A PCR primer for sex identification of yellow-feathered broiler chickens or laying hens, characterized in that: The PCR primer sequences are as follows: F:GAATGGAGCAAGAGCAGATG; R:TTCAGGCACCGTAACACA.

2. A SNP molecular marker for sex identification of yellow-feathered broilers and laying hens, characterized in that: The SNP molecular marker is obtained by amplification using the PCR primers described in claim 1.

3. The SNP molecular marker according to claim 2, characterized in that The SNP molecular marker is shown as SEQ ID No.

3.

4. A gene chip, characterized in that It contains the SNP molecular marker according to claim 2 or 3.

5. A kit, characterized in that It contains the PCR primers according to claim 1, the SNP molecular markers according to claim 2 or 3, or the gene chip according to claim 4.

6. Use of the PCR primers according to claim 1, the SNP molecular markers according to claim 2 or 3, the gene chip according to claim 4, or the kit according to claim 5 in sex identification of yellow-feathered broilers or laying hens.

7. A method for sex identification of yellow-feathered broilers or laying hens, characterized in that: include: The PCR amplification reaction is carried out using the PCR primers described in claim 1.

8. The method according to claim 7, characterized in that After PCR amplification, agarose gel electrophoresis was used to detect specific bands. If no specific bands appeared, it was male, and if a 274 bp band appeared, it was female.

9. The method according to claim 7, characterized in that The PCR amplification reaction conditions were as follows: pre-denaturation at 98°C for 2 min, one cycle; denaturation at 98°C for 30 s; annealing at 53°C for 15 s, extension at 72°C for 15 s, for a total of 35 cycles; and final extension at 72°C for 5 min, one cycle.

10. The method according to claim 7, characterized in that The PCR amplification reaction adopts a 25 μl system.