Esophageal squamous cell carcinoma biomarker and application thereof as well as construct and treatment product based on esophageal squamous cell carcinoma biomarker

Abstract

The invention belongs to the technical field of esophageal squamous-cell carcinoma biomarkers, and particularly relates to an esophageal squamous-cell carcinoma biomarker, application thereof, a construct based on the esophageal squamous-cell carcinoma biomarker and a treatment product based on the esophageal squamous-cell carcinoma biomarker. Comprising an lncRNA SOX21-AS1 with a nucleotide sequence as shown in SEQ ID NO.3, and / or a translation product lncRNA SOX21-AS1-84aa with an amino acid sequence as shown in SEQ ID NO.4. The invention further discloses a preparation method of the translated product lncRNA. The invention finds that the lncRNA SOX21-AS1 is related to proliferation and migration of esophageal squamous cell carcinoma cells, and the lncRNA SOX21-AS1 and the translation product lncRNA SOX21-AS1-84aa of the lncRNA SOX21-AS1 both have the effect of promoting the proliferation activity of the esophageal squamous cell carcinoma, are beneficial to monitoring and treatment of esophageal squamous cell carcinoma patients, and have an application prospect in treatment of the esophageal squamous cell carcinoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of esophageal squamous cell carcinoma biomarkers, and in particular relates to an esophageal squamous cell carcinoma biomarker and its application, as well as a construct and therapeutic product based thereon. Background Art

[0002] Esophageal cancer is a common malignant tumor of the digestive tract. my country has a high incidence of esophageal cancer. Esophageal squamous cell carcinoma is the main subtype of esophageal cancer, with a high incidence and extremely invasiveness. Although new treatment technologies such as targeted therapy are widely used in clinical practice, the 5-year survival rate of patients is still less than 20%, and the postoperative recurrence and metastasis rates remain high. This is because esophageal cancer is highly heterogeneous at the molecular level and its pathogenesis is still unclear, resulting in a lack of highly specific molecular markers for early diagnosis, treatment and prognosis, and a lack of precision treatment. Therefore, it is necessary to conduct in-depth molecular analysis of the molecular mechanisms of the occurrence and development of esophageal squamous cell carcinoma.

[0003] Recent studies have shown that the micropeptide YY1BM encoded by lncRNA LINC00278 is a potential therapeutic target for male esophageal cancer. However, the functions of lncRNA translation products in most esophageal cancers remain unknown. Summary of the Invention

[0004] The purpose of the present invention is to provide an esophageal squamous cell carcinoma biomarker and its application, as well as a construct and therapeutic product based thereon, to solve the problems existing in the prior art.

[0005] The technical solution adopted by the present invention to solve its technical problem is:

[0006] A biomarker for esophageal squamous cell carcinoma comprises lncRNA SOX21-AS1, whose nucleotide sequence is shown in SEQ ID NO. 3, and / or its translation product lncRNA SOX21-AS1-84aa, whose amino acid sequence is shown in SEQ ID NO. 4.

[0007] Furthermore, lncRNA SOX21-AS1 also includes other nucleic acid substances that can be translated to obtain lncRNA SOX21-AS1-84aa.

[0008] Furthermore, it also includes derivative polypeptides and fusion proteins of lncRNA SOX21-AS1-84aa.

[0009] Furthermore, the derivative polypeptide is generated by adding, substituting or deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO. 4 of lncRNA SOX21-AS1-84aa, and / or a derivative prepared by chemical modification, genetic modification or molecular modification of lncRNA SOX21-AS1-84aa and its immobilized product, and / or an immobilized product of lncRNA SOX21-AS1-84aa. The immobilization method of the immobilized product includes but is not limited to fixation or modification by physical adsorption, carrier, or nanomaterial, and retains the function of promoting the proliferation or migration of esophageal squamous cell carcinoma cells.

[0010] Furthermore, the fusion protein is a chimeric expression product of lncRNA SOX21-AS1-84aa and a functional tag constructed by gene recombination technology and its immobilized product. The immobilization method of the immobilized product includes but is not limited to fixation or modification by physical adsorption, carrier, or nanomaterial, and retains the function of promoting the proliferation or migration of esophageal squamous cell carcinoma cells.

[0011] An esophageal squamous cell carcinoma biomarker is used in the treatment of esophageal squamous cell carcinoma to determine the effectiveness of cancer treatment by detecting the expression level of the marker in patient samples, where the samples are normal / cancerous cells or tissues of the patient's esophagus.

[0012] A construct of a biomarker for esophageal squamous cell carcinoma, comprising a nucleic acid sequence encoding lncRNA SOX21-AS1-84aa and derived polypeptides and fusion proteins, wherein the vector of the construct includes but is not limited to a bacterial plasmid and adenovirus.

[0013] A therapeutic product for detecting a biomarker of esophageal squamous cell carcinoma comprises a substance for detecting the marker. The therapeutic product includes but is not limited to a nucleic acid probe or amplification primer that specifically recognizes lncRNA SOX21-AS1.

[0014] A use of an esophageal squamous cell carcinoma biomarker in the preparation of a therapeutic drug for esophageal squamous cell carcinoma, wherein a substance comprising a targeted inhibitory agent for marker expression or activity is used in the preparation of the therapeutic drug for esophageal squamous cell carcinoma, wherein the substance comprising a targeted inhibitory agent for marker expression or activity includes but is not limited to siRNA, shRNA, or antisense oligonucleotide that inhibits the expression or activity of lncRNA SOX21-AS1.

[0015] The present invention has the following beneficial effects:

[0016] The present invention found that lncRNA SOX21-AS1 is related to the proliferation and migration of esophageal squamous cell carcinoma cells. Both lncRNA SOX21-AS1 and its translation product lncRNA SOX21-AS1-84aa have the effect of promoting the proliferation activity of esophageal squamous cell carcinoma, which is helpful for the monitoring and treatment of patients with esophageal squamous cell carcinoma and has application prospects in the treatment of esophageal squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Figure 3 is a scatter plot of differentially expressed genes between esophageal squamous cell carcinoma cells and normal esophageal epithelial cells.

[0018] Figure 2 The figure shows the comparative expression of lncRNA SOX21-AS1 in various esophageal squamous cell carcinoma cell lines.

[0019] Figure 3 This is a diagram of the qRT-PCR validation results.

[0020] Figure 4 The location map of the open reading frame (ORF) in lncRNA SOX21-AS1 predicted by ORF-Finder, SmProt, CPAT 2.0, and HMPA.

[0021] Figure 5 To predict the location of the open reading frame (ORF) in lncRNA SOX21-AS1.

[0022] Figure 6 Schematic diagram of the construction of the EGFP-tagged ORF vector (ORF-EGFPmut) and the control empty vector. After transfection into 293T cells, EGFP fluorescence was observed under a fluorescence microscope.

[0023] Figure 7 The expression of proteins in the ORF-EGFPmut and empty vector control groups and the internal reference protein β-actin after 293T cells were transfected.

[0024] Figure 8 These are the results of fluorescence microscopy and Western blot detection of KYSE-30 and KYSE-180 cells after transfection.

[0025] Figure 9 This is the endogenous expression map of the marker lncRNA SOX21-AS1-84aa identified by mass spectrometry.

[0026] Figure 10 The figure shows the results of the clone formation experiment after knocking down the expression of lncRNA SOX21-AS1 in KYSE-180 and KYSE-30 cells.

[0027] Figure 11 This is the CCK-8 experimental result after knocking down the expression of lncRNA SOX21-AS1 in KYSE-30 cells.

[0028] Figure 12 The figure shows the results of the scratch experiment after KYSE-180 knocked down the expression of lncRNA SOX21-AS1.

[0029] Figure 13 This is the CCK-8 assay result after KYSE-180 cells were transfected with ORF-EGFPmut fusion plasmid.

[0030] Figure 14 This is the CCK-8 assay result after KYSE-30 cells were transfected with ORF-EGFPmut fusion plasmid. DETAILED DESCRIPTION

[0031] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to specific embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to illustrate the present invention and are not intended to limit the present invention. Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs.

[0032] Example 1:

[0033] like Figure 1-9 As shown, lncRNA SOX21-AS1 is upregulated in esophageal squamous cell carcinoma and has coding function.

[0034] lncRNA SOX21-AS1 is upregulated in many cancers, but its expression in esophageal squamous cell carcinoma has not been reported, nor has any related research shown that lncRNA SOX21-AS1 has a coding function. First, RNA-seq sequencing was performed on 10 human esophageal squamous cell carcinoma cell lines (COLO 680N, EC8712, KYSE-30, KYSE-140, KYSE-150, KYSE-180, KYSE-510, KYSE-200, TE-10, TE-1) and 2 normal esophageal epithelial cell lines (NE2-hTERT, NE3-E6E7-hTERT). Fold change>3 and p<0.05 were used as screening conditions. Through cluster analysis, 1081 differentially expressed genes were obtained, such as Figure 1 As shown in Figure 2, lncRNA SOX21-AS1 was found to be significantly upregulated in esophageal squamous cell carcinoma. Figure 2As shown in Figure 2, RNA-seq analysis showed that lncRNA SOX21-AS1 was highly expressed in multiple esophageal squamous cell carcinoma cell lines. qRT-PCR validation was used to further confirm that lncRNA SOX21-AS1 was significantly more expressed in esophageal squamous cell carcinoma than in normal esophageal epithelial cells. Figure 3 The qPCR primer sequences used are as follows:

[0035] lncRNA SOX21-AS1-F:CTGCACCGGCTCAGGTTTAG, SEQ ID NO.1

[0036] lncRNA SOX21-AS1-R:GGGTGAGTCTCCCCTTCTCC, SEQ ID NO.2

[0037]

[0038] ORFfinder, SmProt, CPAT2.0, and HMPA were used to predict the ORF sequence in lncRNA SOX21-AS1. The intersection of the four datasets yielded an ORF encoding a polypeptide chain with a length of 84 amino acid residues. This ORF is located in the first exon of lncRNA SOX21-AS1. Figure 5-6 shown.

[0039] The amino acid sequence of lncRNA SOX21-AS1-84aa is:

[0040] SEQ ID NO.4

[0041] To confirm the initiation codon activity of lncRNA SOX21-AS1-84aa and the coding capacity of lncRNA SOX21-AS1, a Kozak sequence (GCCACC) was added before ATG using the pcDNA3.1 plasmid. NheI / BamHI restriction sites were used to construct a fusion protein plasmid ORF-EGFPmut consisting of an ORF and an enhanced green fluorescent protein (EGFP, ATGGTG mutated to ATTGTT) with a mutated initiation codon. Wild-type EGFP plasmid was used as a control. Forty-eight hours after transient transfection into 293T cells, green fluorescence was observed in both groups. Figure 6 At the same time, 48 hours after transfection into 293T cells, EGFP protein expression was detected by Western blot. Compared with the wild-type EGFP group (control empty vector group), the band of the fusion protein expression group migrated upward by about 9.2 kDa, which is consistent with the theoretical prediction value of lncRNA SOX21-AS1-84aa, as shown in Figure 2. Figure 7 shown.

[0042] The coding ability of lncRNA SOX21-AS1 in esophageal squamous cell carcinoma cell lines was further tested. KYSE-30 cells and KYSE-180 cells were transiently transfected with EGFP plasmid and ORF-EGFPmut plasmid, respectively. After 48 hours, green fluorescence was observed in all groups, and the expression of lncRNA SOX21-AS1-84aa was verified by Western blot. Figure 8As shown. In KYSE-30 cells and KYSE-180 cells transfected with ORF-EGFPmut fusion plasmid, the fusion protein was mainly expressed in the cell nucleus, suggesting that the product encoded by lncRNA SOX21-AS1 has nuclear localization ability. At the same time, by mass spectrometry analysis, the polypeptide sequence corresponding to lncRNA SOX21-AS1-84aa was obtained in the whole protein lysates of multiple ESCC cell lines, verifying the endogenous expression of lncRNA SOX21-AS1-84aa, as shown. Figure 9 shown.

[0043] Example 2:

[0044] like Figure 10-14 As shown, lncRNA SOX21-AS1 and its encoded product lncRNA SOX21-AS1-84aa promote the occurrence and development of esophageal squamous cell carcinoma.

[0045] The results of the clone formation experiment and CCK-8 experiment consistently showed that after knocking down the expression of lncRNASOX21-AS1 in esophageal squamous cell carcinoma cells, the cell activity decreased, that is, after inhibiting the expression of lncRNASOX21-AS1, the proliferation ability of esophageal squamous cell carcinoma cells was reduced. Figure 10 、 11 The scratch assay results showed that compared with the control group, the migration ability of KYSE-180 cells was significantly reduced after knocking down the expression of lncRNASOX21-AS1. Figure 12 The siRNA sequences used are as follows:

[0046] si-SOX21-AS1#1-S:GUCCGCCAGAACCAUCUAUATT, SEQ ID NO.5

[0047] si-SOX21-AS1#1-AS:UAUAGAUGGUUCUGGCGACTT, SEQ ID NO.6

[0048] si-SOX21-AS1#2-S:AACAGAAACAGAGGCUUCUCGCATT, SEQ ID NO.7

[0049] si-SOX21-AS1#1-AS:AAUGCGAGAAGCCUCUGUUUCUGTT, SEQ ID NO.8

[0050] KYSE-30 cells and KYSE-180 cells were transiently transfected with EGFP plasmid and ORF-EGFPmut plasmid, respectively. CCK-8 assay showed that compared with the EGFP plasmid transfection group, KYSE-180 cells ( Figure 13 ) and KYSE-30 cells ( Figure 14 ), indicating that lncRNA SOX21-AS1-84aa promotes the proliferation of esophageal squamous cell carcinoma cells.

[0051] The above embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the concept and scope of the present invention. Without departing from the design concept of the present invention, various modifications and improvements made by ordinary persons in the art to the technical solution of the present invention should fall within the scope of protection of the present invention.

[0052] The technology, shape, and structure not described in detail in the present invention are all well-known technologies.

Claims

1. A biomarker for esophageal squamous cell carcinoma, characterized in that: It includes lncRNA SOX21-AS1 with a nucleotide sequence as shown in SEQ ID NO.3, and / or a translation product lncRNA SOX21-AS1-84aa with an amino acid sequence as shown in SEQ ID NO.

4.

2. The esophageal squamous cell carcinoma biomarker according to claim 1, characterized in that The lncRNASOX21-AS1 also includes other nucleic acid substances that can be translated to obtain the lncRNA SOX21-AS1-84aa.

3. The esophageal squamous cell carcinoma biomarker according to claim 1, characterized in that It also includes derivative polypeptides and fusion proteins of the lncRNASOX21-AS1-84aa.

4. The esophageal squamous cell carcinoma biomarker according to claim 3, characterized in that The derivative polypeptide is generated by adding, substituting or deleting one or more amino acids in the amino acid sequence of the lncRNA SOX21-AS1-84aa shown in SEQ ID NO. 4, and / or a derivative prepared by chemical modification, genetic modification or molecular modification of the lncRNA SOX21-AS1-84aa and its immobilized product, and / or an immobilized product of the lncRNA SOX21-AS1-84aa. The immobilization method of the immobilized product includes but is not limited to fixation or modification by physical adsorption, carrier, or nanomaterial, and retains the function of promoting the proliferation or migration of esophageal squamous cell carcinoma cells.

5. The esophageal squamous cell carcinoma biomarker according to claim 3, characterized in that The fusion protein is a chimeric expression product of the lncRNA SOX21-AS1-84aa and a functional tag constructed by gene recombination technology, and its immobilized product. The immobilization method of the immobilized product includes but is not limited to fixation or modification by physical adsorption, carrier, or nanomaterial, and retains the function of promoting the proliferation or migration of esophageal squamous cell carcinoma cells.

6. Use of a biomarker for esophageal squamous cell carcinoma according to any one of claims 1 to 5 in the treatment of esophageal squamous cell carcinoma, characterized in that: The effect of cancer treatment is determined by detecting the expression level of the marker in the patient sample, wherein the sample is the patient's esophageal normal / cancer cell or tissue.

7. A construct of a biomarker for esophageal squamous cell carcinoma according to any one of claims 1 to 5, characterized in that: The construct comprises a nucleic acid sequence encoding the lncRNA SOX21-AS1-84aa and the derived polypeptide and fusion protein, and the vector of the construct includes but is not limited to a bacterial plasmid and adenovirus.

8. A therapeutic product for detecting biomarkers of esophageal squamous cell carcinoma according to any one of claims 1 to 5, characterized in that: The therapeutic product comprises a substance for detecting the marker, and includes but is not limited to a nucleic acid probe or amplification primer that specifically recognizes the lncRNA SOX21-AS1.

9. Use of a biomarker for esophageal squamous cell carcinoma according to any one of claims 1 to 5 in the preparation of a drug for treating esophageal squamous cell carcinoma, characterized in that: A substance containing a targeted inhibitory effect on the expression or activity of the marker is applied to the preparation of a drug for treating esophageal squamous cell carcinoma. The substance containing a targeted inhibitory effect on the expression or activity of the marker includes but is not limited to siRNA, shRNA or antisense oligonucleotide that inhibits the expression or activity of the lncRNA SOX21-AS1.

Images