LAMP (loop-mediated isothermal amplification) detection primer group of flavobacterium psychrophilum and application thereof

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) detection primer group for flavobacterium psychrophilum and application of the LAMP detection primer group, and belongs to the technical field of molecular biology. The method comprises the following steps: firstly, searching a specific sequence which is completely not matched with other genomes according to a whole genome sequence of flavobacterium psychrophilum, and designing a specific LAMP detection primer group according to the specific sequence; the LAMP detection primer group comprises a pair of outer primers and a pair of inner primers, and the sequence compositions of the outer primers and the inner primers are respectively shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The primer group is used for constant-temperature fluorescent LAMP detection of flavobacterium psychrophilum, and the result shows that the LAMP detection primer group designed by the invention has a good amplification effect on detection of target flavobacterium psychrophilum, and has the advantages of strong specificity, high sensitivity, convenience and rapidness in operation and the like when being used for detecting flavobacterium psychrophilum. The method is suitable for early screening, accurate diagnosis and epidemic situation detection of freshwater fish bacterial diseases caused by flavobacterium psychrophilum.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a LAMP detection primer set of psychrophilic Flavobacterium and an application thereof. Background Art

[0002] Flavobacterium psychrophilum is a cold-adapted pathogen belonging to the phylum Bacteroidetes and genus Flavobacterium. Its optimal growth temperature is 15-18°C, but it can thrive in temperatures between 4 and 23°C. First discovered in sick coho salmon in the United States in the 1940s, Flavobacterium psychrophilum is the primary cause of bacterial coldwater disease. In recent years, this pathogen has caused a new outbreak known as "overwintering syndrome" in major freshwater fish farming areas in my country.

[0003] Detection of pathogenic nucleic acid molecules is the gold standard for disease diagnosis. PCR technology, based on which various novel PCR techniques have been developed according to different needs, includes nested PCR, real-time fluorescence quantitative PCR, and loop-mediated isothermal amplification (LAMP). LAMP is particularly popular due to its significant advantages. It uses four or six specific primers designed for six or eight loci of the pathogen's target gene. Under the action of a strand-displacing DNA polymerase (Bst DNA polymerase), the DNA is self-amplified at a constant temperature, enabling high-volume, efficient amplification of the target gene in a short period of time. In addition to its high sensitivity, high specificity, and short reaction time, this technology does not require gel electrophoresis or complex, high-end instrumentation like PCR, thus meeting the needs of rapid, on-site pathogen diagnosis.

[0004] Therefore, applying LAMP technology to the detection of psychrophilic bacterium and establishing a detection technology with more advantages than conventional PCR methods for the early screening of aquatic diseases caused by psychrophilic bacterium are technical issues that need to be solved. Summary of the Invention

[0005] The purpose of the present invention is to provide a set of LAMP detection primers for psychrophilic Flavobacterium to make up for the shortcomings of the existing technology in detection specificity, sensitivity, rapid detection performance and convenient on-site applicability, and has great application potential; another purpose of the present invention is to provide an application of psychrophilic Flavobacterium; another purpose of the present invention is to provide a LAMP detection kit for psychrophilic Flavobacterium; another purpose of the present invention is to provide a method for detecting psychrophilic Flavobacterium for non-disease diagnosis purposes.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention provides a LAMP detection primer set for Flavobacterium psychrophilum. The primer set consists of an outer primer and an inner primer. The sequences of the outer primers are shown in SEQ ID NO: 1 to SEQ ID NO: 2, and the sequences of the inner primers are shown in SEQ ID NO: 3 to SEQ ID NO: 4.

[0008] On the other hand, the present invention also provides the use of the above primer set in preparing a detection kit for Psychrophilic Flavobacterium.

[0009] On the other hand, the present invention also provides a LAMP detection kit for psychrophilic Flavobacterium, comprising the above-mentioned LAMP detection primer set, 2× reaction buffer and fluorescent dye.

[0010] Preferably, the fluorescent dye is at least one of SYBR Green I, EvaGreen and Syto;

[0011] The 2× reaction buffer comprises: 10 mM dNTP, 2×ThermoPol buffer, 150 mM MgSO 4 aqueous solution and Bst DNA polymerase.

[0012] On the other hand, the present invention also provides a method for detecting psychrophilic Flavobacterium for non-disease diagnosis purposes, comprising the following steps:

[0013] Extracting genomic DNA of the sample to be tested;

[0014] Performing a constant temperature amplification reaction on the extracted DNA using the primer set described in claim 1;

[0015] Determine whether the sample contains psychrophilic bacterium based on the amplification results.

[0016] Furthermore, the reaction system of the isothermal amplification is: 0.05 μl of each inner primer, 0.4 μl of each outer primer, 12.5 μl of 2× reaction buffer, 0.5 μl of SYBR Green I, 1 μl of the DNA template to be tested, and the volume is made up to 25 μl with sterile ultrapure water.

[0017] Furthermore, the reaction conditions of the isothermal amplification reaction system are: 63° C. for 60 seconds, and 40 cycles.

[0018] Furthermore, the method for judging the result is: placing the reaction tube in a real-time fluorescence quantitative PCR instrument or a constant temperature fluorescence detector for reaction, and according to the amplification curve displayed by the instrument, if an "S"-shaped curve appears, it is positive, and if there is no "S"-shaped curve, it is negative.

[0019] The present invention uses nucleic acid isothermal amplification technology to establish a rapid detection method for psychrophilic Flavobacterium, which is proven to have high specificity, high sensitivity and repeatability, and is applicable to the early screening, accurate diagnosis and epidemic monitoring of aquatic diseases caused by psychrophilic Flavobacterium.

[0020] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0021] (1) Good specificity: The target gene used for primer design in the present invention is a specific fragment of psychrophilic bacterium. Four specific primers are designed for amplification of the target fragment, which has strong specificity and does not amplify other common pathogens of fish.

[0022] (2) High sensitivity: For DNA containing the target gene of Flavobacterium psychrophilum, the minimum detection limit can reach 10 fg / μl;

[0023] (3) Simple operation and direct and objective results: The operation steps are simple. While maintaining the advantages of traditional PCR technology, this technology further enhances the specificity of the reaction and shortens the detection time. In particular, it can eliminate the need for expensive thermal cyclers, gel electrophoresis, and UV detection equipment, thereby reducing costs. The technical solution of the present invention does not require complex instruments, special reagents, or tedious steps such as pre-denaturation of double-stranded DNA. The positive and negative results can be directly determined by observing the amplification curve. No other analytical steps such as tedious electrophoresis are required. The operator's experience is not high, and it is suitable for rapid and accurate detection of pathogens in aquaculture sites. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the amplification results of the loop-mediated isothermal amplification primer set for the Flavobacterium psychrophilum sample in Example 2, Flavobacterium psychrophilum: psychrophilum, Negative Control: negative control.

[0025] Figure 2 Schematic diagram of the specific amplification results of the loop-mediated isothermal amplification primer set for detecting the psychrophilic Flavobacterium sample in Example 3, Flavobacterium psychrophilum: psychrophilic Flavobacterium, Vibrio parahaemolyticus: Vibrio parahaemolyticus, Aeromonas allosaccharophila: Aeromonas allosaccharophila, Vibrio alginolyticus: Vibrio alginolyticus, Aeromonas veronii: Aeromonas veronii, Negative Control: negative control.

[0026] Figure 3This is a graph showing the sensitivity amplification results of the loop-mediated isothermal amplification primer set for detecting Flavobacterium psychrophilum samples in Example 4. Negative Control: negative control. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The following examples are only intended to more clearly illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0028] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0030] Example 1: Specific primer design

[0031] Based on the published sequences of Flavobacterium psychrophilum strains in the NCBI database, a large number of sequence alignments were performed to obtain specific nucleic acid fragments. An isothermal amplification primer set was designed targeting the conserved sequences of the pathogenic nucleic acid and experimentally verified. This specific primer set for LAMP was obtained. This specific primer set consists of outer primers F3 and B3, and inner primers FIP and BIP. The sequences of the outer primers are shown in SEQ ID NOs: 1 to 2, the sequences of the inner primers are shown in SEQ ID NOs: 3 to 4, and the detection target sequence is shown in SEQ ID NO. 5.

[0032] LAMP primer set for detecting Flavobacterium psychrophilum:

[0033] Outer primer F3 (SEQ ID NO: 1): 5'-CGGTTCAAGTATTTATGTAAATGAC-3'

[0034] Outer primer B3 (SEQ ID NO: 2): 5'-CCATACACTAATAAAGTAGGGATT-3'

[0035] Internal primer FIP (SEQ ID NO: 3): 5'-CGGTAAACTCAGAAACGATAACTCCGCTCAAGTTGTAGAAAAAGGA-3'

[0036] Inner primer BIP (SEQ ID NO: 4): 5'-TGCTTACGAAGATTTAGAACAAGGACAGAAATTACTTTTTCTTGGAAACC-3'.

[0037] Target sequence for detection of Flavobacterium psychrophilum:

[0038] SEQ ID NO.5:

[0039] CGGTTCAAGTATTTATGTAAATGACGCTCAAGTTGTAGAAAAAGGAGATGT

[0040] TATTTGTAAATGGGATCCATATAATGGAGTTATCGTTTCTGAGTTTACCGGAA

[0041] AAATTGCTTACGAAGATTTAGAACAAGGACAATCGTTTATGGTCGAAATCG

[0042] ATGAGCAAACTGGTTTCCAAGAAAAAGTAATTTCTGAAGGAAGAAATAAAAAATTAATCCCTACTTTATTAGTGTATGG.

[0043] Example 2: Primer amplification effect detection

[0044] Bacterial DNA extraction: 2 ml of psychrophilic Flavobacterium bacterial solution was centrifuged in a high-speed refrigerated centrifuge at 12,000 rpm and 4°C for 5 min. The supernatant was discarded to collect the bacteria, and DNA was extracted using a commercial bacterial DNA extraction kit (Novozymes, DC103-01).

[0045] LAMP reaction system (25 μl): 0.05 μl each of inner primers F3 / B3, 0.4 μl each of outer primers FIP / BIP, 12.5 μl of 2× reaction buffer, 0.5 μl of SYBR Green I, 1 μl of DNA template to be tested, and make up to 25 μl with sterile ultrapure water.

[0046] LAMP reaction conditions: 63℃ for 60 seconds, 40 cycles. The PCR was performed in a 96 fluorescent quantitative PCR instrument.

[0047] The fluorescence curve of LAMP reaction is as follows Figure 1 As shown, only the test bacteria has an "S"-shaped amplification curve, while sterile water has no amplification curve.

[0048] Example 3: Primer specificity detection

[0049] The test strains were: Flavobacterium psychrophilum, Vibrio parahaemolyticus, Aeromonas allosaccharophila, Vibrio alginolyticus, and Aeromonas veronii.

[0050] DNA template preparation: The DNA template preparation method of the test strain is the same as that in Example 2.

[0051] Perform LAMP detection: the detection primers, reaction system and conditions are the same as in Example 2.

[0052] The fluorescence curve of LAMP reaction is as follows Figure 2 As shown, the psychrophilic Flavobacterium sample had an "S" amplification curve, showing a positive result, while the other test bacteria had no amplification curves, showing negative results. The results showed that the specific primer set provided by the present invention did not produce cross-false positive amplification and had high specificity.

[0053] Example 4: Primer sensitivity detection

[0054] The genomic DNA of Flavobacterium psychrophilum was diluted in TE buffer in a series of dilutions, and eight gradient concentrations of DNA were used as templates, namely 10 ng / μl, 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, 100 fg / μl, 10 fg / μl, and 1 fg / μl; the diluted DNA was detected using the detection method of Example 2. The fluorescence curve of the LAMP reaction is shown in FIG. Figure 3 As shown, 10 fg / μl to 10 ng / μl of template DNA can generate a fluorescence amplification curve. The results show that the detection sensitivity of the specific primers provided by the present invention to psychrophilic bacterium is 10 fg / μl.

[0055] The embodiments described above are merely preferred embodiments of the present invention and do not constitute any formal or substantial limitation to the present invention. Any person skilled in the art who is familiar with the present invention can, without departing from the scope of the technical solution of the present invention, make some changes, modifications and evolutions of the technical contents disclosed above, and these changes are all equivalent embodiments of the present invention. At the same time, any changes, modifications and evolutions of any equivalent changes made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A set of LAMP detection primers for psychrophilic Flavobacterium, characterized in that: The primer set consists of an outer primer and an inner primer. The sequences of the outer primers are shown in SEQ ID NO: 1 to SEQ ID NO: 2, and the sequences of the inner primers are shown in SEQ ID NO: 3 to SEQ ID NO:

4.

2. Use of the LAMP detection primer set according to claim 1 in preparing a detection kit for psychrophilic Flavobacterium.

3. A LAMP detection kit for psychrophilic Flavobacterium, characterized in that: The kit comprises the LAMP detection primer set according to claim 1.

4. The LAMP detection kit for psychrophilic Flavobacterium according to claim 3, characterized in that The kit also includes a reaction buffer and a fluorescent dye.

5. The LAMP detection kit for psychrophilic Flavobacterium according to claim 3, characterized in that The reaction buffer includes: dNTP, ThermoPol buffer, MgSO4 aqueous solution and Bst DNA polymerase.

6. The LAMP detection kit for psychrophilic Flavobacterium according to claim 3, characterized in that The fluorescent dye is at least one of SYBR Green I, EvaGreen and Syto.

7. A method for detecting psychrophilic Flavobacterium for non-disease diagnosis purposes, characterized in that: The following steps are involved: Extracting genomic DNA of the sample to be tested; Performing a constant temperature amplification reaction on the extracted DNA using the primer set described in claim 1; Determine whether the sample contains psychrophilic bacterium based on the amplification results.

8. The method for detecting psychrophilic Flavobacterium according to claim 7, characterized in that The reaction system of the isothermal amplification is as follows: 0.05 μl of each inner primer, 0.4 μl of each outer primer, 12.5 μl of 2× reaction buffer, 0.5 μl of SYBR Green I, 1 μl of the DNA template to be tested, and the mixture is made up to 25 μl with ultrapure water.

9. The method for detecting psychrophilic Flavobacterium according to claim 7, characterized in that: The reaction conditions of the isothermal amplification reaction system are: 63° C. for 60 seconds, and 40 cycles.

10. The method for detecting psychrophilic Flavobacterium according to claim 7, characterized in that: The method for judging the results is: place the reaction tube in a real-time fluorescence quantitative PCR instrument or a constant temperature fluorescence detector for reaction. According to the amplification curve displayed by the instrument, if an "S"-shaped curve appears, it is positive, and if there is no "S"-shaped curve, it is negative.

Images