Method for identifying sorghum head smut resistance

Abstract

The invention discloses a method for identifying sorghum head smut resistance. The method comprises the following steps: detecting whether a genotype of sorghum to be detected based on an InDel-12 site is a genotype I or a genotype II; the sorghum of the genotype II has head smut resistance, and the sorghum of the genotype I does not have head smut resistance; and / or, head smut resistance gt of sorghum of genotype II; resistance to head smut of sorghum of genotype I; the sorghum of the genotype I is the sorghum of which the genotype is inserted based on the InDel-12 site; the sorghum of the genotype II is sorghum of which the genotype is deleted based on an InDel-12 site; the InDel-12 site is the 196th-207th site nucleotide from the 5'tail end of SEQ ID NO.1 in a sorghum genome, experiments prove that the sorghum head smut resistance can be identified by detecting the genotype of sorghum to be detected based on the InDel-12 site, and the method has important application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for identifying sorghum head smut resistance. Background Art

[0002] Sorghum (Sorghum bicolor L. Moench., 2n = 2x = 20) is the fifth largest cereal crop in the world, after corn, wheat, rice, and barley. It possesses unique stress resistance and wide adaptability. Sorghum is widely used as a raw material for food, brewing, and feed, and plays a vital role in food production in arid and semi-arid regions of the world. China grows approximately 0.6 million sorghum sorghum sorghum annually. 7 hm 2 , with a total annual output of 0.3×10 7 ton.

[0003] Sorghum head smut is a major disease affecting sorghum-producing areas in China. In severe cases, yield losses can reach over 80%. Controlling head smut is a key priority for safe sorghum production in China. This soil-borne fungal disease, caused by the fungus Sporisorium reilianum (Kühn) Langdon and Fullerton, primarily infects the mesocotyl, coleoptile, and radicle of sorghum seedlings between seed germination and bud length of 1.5 cm. The infection reaches the growing point cells or intercellular spaces, and progresses to the apical meristem as the plant grows. After the plant enters the flowering stage, the hyphae grow to the panicle, forming the "black rice" of the sorghum. Furthermore, the fungus can still cause disease through the root system even after the sorghum has 9-10 leaves, with an infection period of over 45 days. This is a major reason why sorghum head smut is difficult to control.

[0004] In production, breeding sorghum varieties with resistance to head smut remains the most economical and effective method for controlling head smut. Compared to traditional techniques, molecular marker-assisted breeding technology will greatly improve the breeding efficiency of improved head smut-resistant varieties. Molecular markers are genetic markers based on nucleotide sequence variation within the genetic material of individuals and reflect polymorphism at the nucleotide sequence level. The new generation of molecular marker technologies based on whole genome sequences mainly include single nucleotide polymorphisms (SNPs) and insertion-deletion polymorphisms (InDels). InDels are insertions or deletions of genomic base sequences at the same site between different individuals of the same species, generally referring to small insertions or deletions with a length of 1-50 base pairs. InDels, which are large insertions or deletions of more than 50 base pairs, also exist in organisms and are a very important type of genomic structural variation. Many studies have shown that these large deletions or insertions InDels play an important role in explaining phenotypic differences that affect a range of important agronomic and quality characteristics of crops. InDels are widely distributed, densely distributed, and numerous across the genome, second only to single-nucleotide polymorphisms (SNPs). InDel markers are simple and straightforward to perform, using agarose gel electrophoresis to identify insertion / deletion sites. InDel markers are widely used in crop genetic diversity analysis, gene mapping, and variety identification.

[0005] Currently, the genetic loci for resistance to sorghum head smut are unclear, which limits the application of molecular marker-assisted breeding for head smut resistance in sorghum. Summary of the Invention

[0006] The purpose of the present invention is to identify or assist in identifying sorghum head smut resistance.

[0007] The present invention firstly protects a method for identifying or assisting in identifying resistance to head smut in sorghum.

[0008] The method for identifying or assisting in identifying resistance to sorghum head smut protected by the present invention may specifically be method 1, which may include the following steps:

[0009] (1) Detect whether the genotype of the sorghum to be tested based on the InDel-12 locus is genotype I or genotype II;

[0010] (2) After completing step (1), the following judgment is made: the sorghum of genotype II has head smut resistance, and the sorghum of genotype I does not have head smut resistance; and / or, the head smut resistance of sorghum of genotype II is greater than the head smut resistance of sorghum of genotype I;

[0011] The sorghum of genotype I is a sorghum having an insertion genotype based on the InDel-12 locus;

[0012] The sorghum of genotype II is a sorghum whose genotype is deleted based on the InDel-12 site;

[0013] The InDel-12 site is nucleotides 196 to 207 from the 5' end of SEQ ID NO: 1 in the sorghum genome.

[0014] The method for identifying or assisting in identifying resistance to sorghum head smut protected by the present invention may specifically be method 2, which may include the following steps in sequence:

[0015] (A1) Using genomic DNA of the sorghum to be tested as a template, PCR amplification was performed using a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R to obtain a PCR amplification product;

[0016] Primer 6JSmt418F is the single-stranded DNA molecule shown in SEQ ID NO: 3;

[0017] Primer 6JSmt418R is the single-stranded DNA molecule shown in SEQ ID NO: 4;

[0018] (A2) evaluating the PCR amplification product as follows: if the PCR amplification product contains only a 260 bp DNA fragment, the genotype of the sorghum to be tested based on the InDel-12 locus is genotype I; if the PCR amplification product contains only a 248 bp DNA fragment, the genotype of the sorghum to be tested based on the InDel-12 locus is genotype II;

[0019] Genotype II sorghum is resistant to head smut, while genotype I sorghum is not resistant to head smut;

[0020] and / or, the head smut resistance of genotype II sorghum is greater than the head smut resistance of genotype I sorghum.

[0021] The method for identifying or assisting in identifying resistance to sorghum head smut protected by the present invention may specifically be method three, which may include the following steps in sequence:

[0022] (B1) Using the genomic DNA of the sorghum to be tested as a template, PCR amplification was performed using a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R to obtain a PCR amplification product;

[0023] Primer 6JSmt418F is the single-stranded DNA molecule shown in SEQ ID NO: 3;

[0024] Primer 6JSmt418R is the single-stranded DNA molecule shown in SEQ ID NO: 4;

[0025] (B2) sequencing the PCR amplification product, and then making the following assessment: if the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 1, the genotype of the sorghum to be tested based on the InDel-12 site is genotype I; if the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the genotype of the sorghum to be tested based on the InDel-12 site is genotype II;

[0026] Genotype II sorghum is resistant to head smut, while genotype I sorghum is not resistant to head smut;

[0027] and / or, the head smut resistance of genotype II sorghum is greater than the head smut resistance of genotype I sorghum.

[0028] The present invention also protects a kit for identifying or assisting in identifying resistance to head smut in sorghum. The kit may include a substance for detecting whether the genotype of the sorghum to be tested is genotype I or genotype II based on the InDel-12 locus;

[0029] The genotype I is based on the genotype of InDel-12 site, which is an insertion;

[0030] The genotype II is based on the genotype of InDel-12 locus being deleted;

[0031] The InDel-12 site is nucleotides 196 to 207 from the 5' end of SEQ ID NO: 1 in the sorghum genome.

[0032] In the above-mentioned kit, the substance for detecting whether the genotype of the sorghum to be tested is genotype I or genotype II based on the InDel-12 site may include a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R;

[0033] Primer 6JSmt418F is the single-stranded DNA molecule shown in SEQ ID NO: 3;

[0034] Primer 6JSmt418R is a single-stranded DNA molecule represented by SEQ ID NO:4.

[0035] In the above-mentioned kit, the substance for detecting whether the genotype of the sorghum to be tested is genotype I or genotype II based on the InDel-12 site can specifically be a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R.

[0036] The kit may specifically be composed of substances for detecting whether the genotype of the sorghum to be tested based on the InDel-12 site is genotype I or genotype II.

[0037] The molecular marker A shown in SEQ ID NO: 1 or the molecular marker B shown in SEQ ID NO: 2 also fall within the scope of protection of the present invention.

[0038] The present invention also protects the use of any of the above-mentioned kits, which may be at least one of (z1) to (z4):

[0039] (z1) Identifying or assisting in identifying resistance to sorghum head smut;

[0040] (z2) screening or assisting in screening sorghum for different resistances to head smut;

[0041] (z3) identifying or assisting in identifying the genotype of sorghum based on the InDel-12 locus; the InDel-12 locus is nucleotides 196-207 from the 5' end of SEQ ID NO: 1 in the sorghum genome;

[0042] (z4) Sorghum breeding.

[0043] The present invention also protects the use of any of the above-mentioned molecular markers A or B, which may be at least one of (z1)-(z4):

[0044] (z1) Identifying or assisting in identifying resistance to sorghum head smut;

[0045] (z2) screening or assisting in screening sorghum for different resistances to head smut;

[0046] (z3) identifying or assisting in identifying the genotype of sorghum based on the InDel-12 locus; the InDel-12 locus is nucleotides 196-207 from the 5' end of SEQ ID NO: 1 in the sorghum genome;

[0047] (z4) Sorghum breeding.

[0048] In any of the above applications, in (z3), the genotype of sorghum based on the InDel-12 locus may be genotype I or genotype II;

[0049] The sorghum of genotype I is a sorghum having an insertion genotype based on the InDel-12 locus;

[0050] The sorghum of genotype II is a sorghum whose genotype based on the InDel-12 site is deleted.

[0051] In the above example, if the genotype at the InDel-12 locus is an insertion, the sorghum is identified as genotype I; if the genotype at the InDel-12 locus is a deletion, the sorghum is identified as genotype II. Genotype II sorghum is resistant to head smut, while genotype I sorghum is not. Genotype II sorghum has greater head smut resistance than genotype I sorghum.

[0052] Any of the above-mentioned ">" may specifically be a statistical >.

[0053] Experiments have shown that the method provided by the present invention can be used to detect the genotype of the sorghum to be tested based on the InDel-12 locus, and can identify or assist in identifying sorghum head smut resistance. The present invention has important application value in the process of molecular marker-assisted breeding of sorghum. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 The results of genotyping of the sorghum varieties shown in Table 1 based on the InDel-12 locus are shown.

[0055] Figure 2 The results of genotyping of the sorghum varieties shown in Table 2 based on the InDel-12 locus are shown.

[0056] Figure 3 The results of genotyping of the sorghum varieties shown in Table 3 based on the InDel-12 locus are shown. DETAILED DESCRIPTION

[0057] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0058] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0059] The sorghum germplasms in the following embodiments include farm varieties, wild sorghum and cultivated varieties, which are generally assumed to be highly homozygous plant materials, and therefore all have homozygous genotypes.

[0060] Example 1. Discovery of the InDel-12 locus in the sorghum genome and establishment of a sorghum genotyping method based on the InDel-12 locus

[0061] 1. Discovery of InDel-12 in the Sorghum Genome

[0062] The inventors of the present invention discovered an InDel site, named InDel-12, by comparing the genomic DNA of several head smut-resistant and head smut-susceptible sorghum varieties. The InDel-12 site is located at nucleotides 196-207 from the 5' end of SEQ ID NO: 1 in the sorghum genome.

[0063] Sorghum is divided into two genotypes based on the InDel-12 locus: genotype I and genotype II. Genotype I has an insertion at the InDel-12 locus, with the inserted sequence being gcggaggtgccc (shown in SEQ ID NO:1, positions 196-207 from the 5' end). Genotype II has a deletion at the InDel-12 locus, with the deleted sequence being gcggaggtgccc (shown in SEQ ID NO:1, positions 196-207 from the 5' end).

[0064] 2. Synthesis of primer pairs for amplifying target sequences including the InDel-12 site

[0065] A primer pair was designed and synthesized for amplifying the target sequence including the InDel-12 site. The primer pair consisted of primer 6JSmt418F: 5'-aggtcgtcgacagtgacaag-3' (SEQ ID NO: 3) and primer 6JSmt418R: 5'-gttgttgcagcagtcatcct-3' (SEQ ID NO: 4).

[0066] The target sequence amplified by the primer pair is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0067] SEQ ID NO: 1:

[0068] aggtcgtcgacagtgacaagccacaaccctcctcggggcccaagctccttctcacccaggagcaatgggctgccgggcaaggtgacaagaagggggagccttcttctgcagcacccagccgcaagagtgg caagcgcggcaagtcacgcaaaggcacccagggcggggcgcaagggcgtgccgacggaggtgcccgcggaggtgcccagggcgccgccgccgaaaaacccaagccggcacaggatgactgctgcaacaac

[0069] SEQ ID NO: 2:

[0070] aggtcgtcgacagtgacaagccacaaccctcctcggggcccaagctccttctcacccaggagcaatgggctgccgggcaaggtgacaagaagggggagccttcttctgcagcacccagccgcaa gagtggcaagcgcggcaagtcacgcaaaggcacccagggcggggcgcaagggcgtgccgacggaggtgcccagggcgccgccgccgaaaaacccaagccggcacaggatgactgctgcaacaac

[0071] 3. Establishment of a sorghum genotyping method based on the InDel-12 locus

[0072] 1. Use the CTAB method to extract genomic DNA from the sorghum leaves to be tested.

[0073] The quality and concentration of the genomic DNA of the sorghum leaves to be tested must meet the requirements of PCR. The standards for reaching the standards are: 1% agarose gel electrophoresis shows clear DNA bands, no obvious impurities, and no degradation; UV spectrophotometer NanoDrop2000 (ThermoScientifc, Waltham, MA, USA) detects OD 260nm / OD 280nm Between 1.6 and 2.0, the DNA concentration is above 50 ng / μL.

[0074] 2. Using the genomic DNA of the sorghum leaves to be tested in step 1 as a template, PCR amplification was performed using a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R to obtain a PCR amplification product.

[0075] 3. The PCR amplification product obtained in step 2 is subjected to polyacrylamide gel electrophoresis to determine the following: if the size of the PCR amplification product is 260 bp and / or the nucleotide sequence is as shown in SEQ ID NO: 1, the genotype of the sorghum to be tested based on the InDel-12 locus is genotype I; if the size of the PCR amplification product is 248 bp and / or the nucleotide sequence is as shown in SEQ ID NO: 2, the genotype of the sorghum to be tested based on the InDel-12 locus is genotype II.

[0076] Example 2: Analysis of Genotyping and Head Smut Resistance in Sorghum Populations Based on InDel-12

[0077] 1. Genotyping of sorghum populations based on InDel-12 locus

[0078] Genotyping of each sorghum variety in the sorghum population was performed using the method described in step 3 of Example 1. The sorghum population consisted of 241 sorghum varieties (all diploid). The sorghum variety names are detailed in Tables 1, 2, and 3.

[0079] Among the 241 sorghum varieties, sorghum variety BTx623 is American grain sorghum, and sorghum variety Rio is American sweet sorghum. Both sorghum variety BTx623 and sorghum variety Rio are recorded in the following literature: Bai Chunming, Wang Chunyu, Wang Ping, Zhu Zhenxing, Lu Xiaochun. QTL analysis of tannin content and color in sorghum grains. Journal of Plant Genetic Resources. 2017, 18(5): 860-866.; sorghum variety SV1-5 is wild sorghum, and sorghum variety SV1-5 is recorded in the following literature: Zhongwei Lin, Xianran Li, Laura M Shannon, Cheng-Ting Yeh, Ming L Wang, Guihua Bai1, Zhao Peng, Jiarui Li, Harold N Trick, Thomas E Clemente, John Doebley, Patrick S Schnable, Mitchell R Tuinstra, Tesfaye T Tesso, Frank White, Jianming Yu. Parallel domestication of the Shattering 1 genes in cereals. Nature Genetics. 2012. Its name in the literature is Sorghum virgatum (SV); other sorghum varieties are from the Sorghum Research Institute of Liaoning Academy of Agricultural Sciences and the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) germplasm resources bank. The corresponding national numbers are detailed in Tables 1, 2, and 3.

[0080] Table 1

[0081]

[0082]

[0083]

[0084]

[0085] Note: “-” indicates not recorded.

[0086] Table 2

[0087]

[0088]

[0089]

[0090] Note: “-” indicates not recorded.

[0091] Table 3

[0092]

[0093]

[0094]

[0095] Note: “-” indicates not recorded.

[0096] The test results of the sorghum variety names shown in Table 1 are shown in Figure 1 (The marker on the far left is the pBR322 DNA / MspⅠ molecular weight standard with product catalog number MD206 from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the numbers from bottom to top are 26, 34, 67, 76, 90, 110, 123, 147, 160, 180, 190, 201, 217, 238, 242, 309, 404, 527, and 622).

[0097] The test results of the sorghum variety names shown in Table 2 are shown in Figure 2 (The marker on the far left is the pBR322 DNA / MspⅠ molecular weight standard with product catalog number MD206 from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the numbers from bottom to top are 26, 34, 67, 76, 90, 110, 123, 147, 160, 180, 190, 201, 217, 238, 242, 309, 404, 527, and 622).

[0098] The test results of the sorghum variety names shown in Table 3 are shown in Figure 3 (The marker on the far left is the pBR322 DNA / MspⅠ molecular weight standard with product catalog number MD206 from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the numbers from bottom to top are 26, 34, 67, 76, 90, 110, 123, 147, 160, 180, 190, 201, 217, 238, 242, 309, 404, 527, and 622).

[0099] The genotyping of 241 sorghum varieties based on the InDel-12 locus is shown in Tables 1 , 2 , and 3 .

[0100] 2. Identification of resistance to head smut in sorghum

[0101] The experiment adopted a randomized block design with 3 replicates, 5 rows per replicate, 3 meters in row length, 0.4 meters in row spacing, and 0.2 meters in plant spacing. The specific steps are as follows:

[0102] (1) One week before sowing sorghum, the winter spore powder of sorghum head smut fungus (Sporisorium reilianum) No. 3 physiological subspecies was thoroughly mixed with sieved sterile field soil to obtain a fungus soil with a concentration of 0.6% of sorghum head smut fungus No. 3 physiological subspecies. After that, an appropriate amount of sterile water was sprayed on the fungus soil to keep it moist. The fungus soil was piled up and covered with plastic sheeting to keep it moist to obtain an inoculated fungus soil.

[0103] Sorghum head smut pathogen (Sporisorium reilianum) race 3 is described in the following literature: Zou Jianqiu, Li Yaoying, Zhu Kai, Wang Yanqiu. Inheritance of resistance to sorghum head smut pathogen race 3 and molecular markers of resistance genes. Chinese Agricultural Science, 2010, 43(4): 713-720.

[0104] (2) 241 sorghum varieties from the sorghum population were planted in the field by hole sowing, and the inoculated soil prepared in step (1) was used for inoculation. Approximately 200 g of the inoculated soil was applied to each hole at the same time as the sowing.

[0105] When inspecting seedlings, leave two plants in each hole and plant 100 seedlings of each sorghum variety.

[0106] (3) In the late flowering stage of sorghum, after the diseased plants have fully shown symptoms, the disease condition is investigated and the resistance of sorghum varieties to head smut is identified (recorded in the following literature: Jiang Yu. Study on pathogenicity differentiation of sorghum head smut pathogens and disease resistance gene markers of varieties. Doctoral dissertation, 2015). The details are as follows: each variety is investigated plant by plant, and the total number of investigated plants and the number of diseased plants are counted respectively. Finally, the incidence rate is calculated, and the incidence rate (%) = (number of diseased plants / total number of investigated plants) × 100%; and then the head smut resistance of sorghum is counted. The identification standard of head smut resistance is: if the incidence rate is less than 5%, the sorghum variety has head smut resistance and is recorded as resistant; if the incidence rate is greater than 20%, the sorghum variety does not have head smut resistance and is recorded as susceptible.

[0107] The statistical results of head smut resistance of 241 sorghum varieties are shown in Tables 1, 2, and 3.

[0108] 3. Genotyping at the InDel-12 locus and head smut resistance in 241 sorghum varieties within a sorghum population were analyzed. The results showed that all sorghum varieties genotyped as genotype II at the InDel-12 locus were resistant to head smut, while all sorghum varieties genotyped as genotype I at the InDel-12 locus were not resistant to head smut. The head smut resistance of all sorghum varieties genotyped as genotype II at the InDel-12 locus was greater than the head smut resistance of all sorghum varieties genotyped as genotype I at the InDel-12 locus, with the ">" indicating a statistically significant difference. This study of sorghum populations demonstrated that genotype II is a superior genotype for head smut resistance.

[0109] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A method for identifying or assisting in identifying resistance to sorghum head smut, comprising the following steps: (1) Detect whether the genotype of the sorghum to be tested based on the InDel-12 locus is genotype I or genotype II; (2) After completing step (1), the following judgment is made: the sorghum of genotype II has head smut resistance, and the sorghum of genotype I does not have head smut resistance; and / or, the head smut resistance of sorghum of genotype II is greater than the head smut resistance of sorghum of genotype I; The sorghum of genotype I is a sorghum having an insertion genotype based on the InDel-12 locus; The sorghum of genotype II is a sorghum whose genotype is deleted based on the InDel-12 site; The InDel-12 site is nucleotides 196 to 207 from the 5' end of SEQ ID NO: 1 in the sorghum genome.

2. A method for identifying or assisting in identifying resistance to sorghum head smut, comprising the following steps in sequence: (A1) Using genomic DNA of the sorghum to be tested as a template, PCR amplification was performed using a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R to obtain a PCR amplification product; Primer 6JSmt418F is the single-stranded DNA molecule shown in SEQ ID NO: 3; Primer 6JSmt418R is the single-stranded DNA molecule shown in SEQ ID NO: 4; (A2) evaluating the PCR amplification product as follows: if the PCR amplification product contains only a 260 bp DNA fragment, the genotype of the sorghum to be tested based on the InDel-12 locus is genotype I; if the PCR amplification product contains only a 248 bp DNA fragment, the genotype of the sorghum to be tested based on the InDel-12 locus is genotype II; Genotype II sorghum is resistant to head smut, while genotype I sorghum is not resistant to head smut; and / or, the head smut resistance of genotype II sorghum is greater than the head smut resistance of genotype I sorghum.

3. A method for identifying or assisting in identifying resistance to sorghum head smut, comprising the following steps in sequence: (B1) Using the genomic DNA of the sorghum to be tested as a template, PCR amplification was performed using a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R to obtain a PCR amplification product; Primer 6JSmt418F is the single-stranded DNA molecule shown in SEQ ID NO: 3; Primer 6JSmt418R is the single-stranded DNA molecule shown in SEQ ID NO: 4; (B2) sequencing the PCR amplification product, and then making the following assessment: if the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 1, the genotype of the sorghum to be tested based on the InDel-12 site is genotype I; if the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the genotype of the sorghum to be tested based on the InDel-12 site is genotype II; Genotype II sorghum is resistant to head smut, while genotype I sorghum is not resistant to head smut; and / or, the head smut resistance of genotype II sorghum is greater than the head smut resistance of genotype I sorghum.

4. A kit for identifying or assisting in identifying resistance to head smut in sorghum, comprising a substance for detecting whether the genotype of the sorghum to be tested is genotype I or genotype II based on the InDel-12 locus; The genotype I is based on the genotype of InDel-12 site, which is an insertion; The genotype II is based on the genotype of InDel-12 locus being deleted; The InDel-12 site is nucleotides 196 to 207 from the 5' end of SEQ ID NO: 1 in the sorghum genome.

5. The kit according to claim 4, wherein: The material for detecting whether the genotype of the sorghum to be tested is genotype I or genotype II based on the InDel-12 site includes a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R; Primer 6JSmt418F is the single-stranded DNA molecule shown in SEQ ID NO: 3; Primer 6JSmt418R is a single-stranded DNA molecule represented by SEQ ID NO:

4.

6. The kit according to claim 4, wherein: The material for detecting whether the genotype of the sorghum to be tested is genotype I or genotype II based on the InDel-12 site is a primer pair consisting of primer 6JSmt418F and primer 6JSmt418R.

7. Molecular marker A shown in SEQ ID NO: 1 or molecular marker B shown in SEQ ID NO:

2.

8. Use of the kit according to any one of claims 4 to 6, comprising at least one of (z1) to (z4): (z1) Identifying or assisting in identifying resistance to sorghum head smut; (z2) screening or assisting in screening sorghum for different resistances to head smut; (z3) identifying or assisting in identifying the genotype of sorghum based on the InDel-12 locus; the InDel-12 locus is nucleotides 196-207 from the 5' end of SEQ ID NO: 1 in the sorghum genome; (z4) Sorghum breeding.

9. The use of the molecular marker A or molecular marker B according to claim 7, wherein the molecular marker A or B is at least one of (z1) to (z4): (z1) Identifying or assisting in identifying resistance to sorghum head smut; (z2) screening or assisting in screening sorghum for different resistances to head smut; (z3) identifying or assisting in identifying the genotype of sorghum based on the InDel-12 locus; the InDel-12 locus is nucleotides 196-207 from the 5' end of SEQ ID NO: 1 in the sorghum genome; (z4) Sorghum breeding.

10. The use according to claim 8 or 9, characterized in that: In (z3), the genotype of sorghum based on the InDel-12 locus is genotype I or genotype II; The sorghum of genotype I is a sorghum having an insertion genotype based on the InDel-12 locus; The sorghum of genotype II is a sorghum whose genotype based on the InDel-12 site is deleted.

Images