Method for identifying dragon fruit varieties

Abstract

The invention discloses a method for identifying the variety of pitaya, which is used for identifying the variety of pitaya according to the existence of a molecular marker with a nucleotide sequence shown as SEQ ID No.: 1 in the genome of pitaya to be detected. The method can be used for identifying'cubilose fruit 'and'Peru cubilose fruit', germplasm identification of dragon fruit can be effectively carried out only by using nutritive organs or seeds, and the method has important practical significance in genetic breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of pitaya, and more particularly to a method for identifying pitaya varieties. Background Art

[0002] Common pitayas include red-skinned, red-fleshed pitaya, red-skinned, white-fleshed pitaya, and yellow-skinned, white-fleshed pitaya. They belong to the genus Hylocereus in the Cactaceae family. Their flowers bloom at night and wither at sunrise. Pitaya is beloved not only for its beautiful appearance but also for its rich nutritional value and diverse ways of eating. Selenicereus is also one of four night-flowering cacti in the family. Some species are even considered among the world's largest cactus flowers, attracting gardeners and cultivated as ornamentals for their stunning blooms. Their fruit, with its distinctive, bright red skin and white flesh, represents a new type of cactus fruit.

[0003] Both Hylocereus and Ophiocordyceps belong to the Cactaceae family. Both have climbing fleshy stems that are triangular or multi-prismatic, with areoles on the ridges. Their leaves are reduced to spines, and photosynthesis is carried out through the fleshy stems. Their seeds are numerous and small, black or dark brown, with a smooth or slightly rough surface. Without flowers or fruiting, it's difficult to distinguish them with the naked eye. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and to provide a method for identifying pitaya varieties.

[0005] The first object of the present invention is to provide a method for identifying dragon fruit varieties.

[0006] The second object of the present invention is to provide a reagent for detecting the presence of a molecular marker such as the nucleotide sequence shown in SEQ ID No.: 1 in the pitaya genome.

[0007] The third object of the present invention is to provide a set of primers for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' pitaya.

[0008] A fourth object of the present invention is to provide a kit for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' pitaya.

[0009] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0010] The present invention claims a method for identifying pitaya varieties, which is based on the presence or absence of a molecular marker with a nucleotide sequence such as SEQ ID No.: 1 in the pitaya genome to be tested, to identify the pitaya variety.

[0011] Preferably, if the molecular marker is present, the pitaya to be tested is 'bird's nest fruit' or 'Peruvian bird's nest fruit'; if the molecular marker is not present, the pitaya to be tested is not 'bird's nest fruit' or 'Peruvian bird's nest fruit'.

[0012] Preferably, the method for detecting whether the molecular marker with the nucleotide sequence shown in SEQ ID No.: 1 exists in the pitaya genome to be tested is: using primers with nucleotide sequences shown in SEQ ID No.: 2 and 3 to perform PCR amplification on the pitaya genomic DNA to be tested.

[0013] As a specific embodiment, the PCR amplification program is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 30 seconds, 35 cycles; extension at 72°C for 5 minutes.

[0014] The present invention also claims protection for the use of a reagent for detecting the presence of a molecular marker such as a nucleotide sequence shown in SEQ ID No.: 1 in the pitaya genome, wherein the use is in identifying pitaya varieties or preparing a kit for identifying pitaya varieties.

[0015] Preferably, the reagent is a primer having a nucleotide sequence as shown in SEQ ID No.: 2 and 3.

[0016] The present invention also claims a set of primers for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' pitaya, said primers are shown as SEQ ID No.: 2 and 3.

[0017] The present invention also claims a kit for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' pitaya, comprising a reagent for detecting the presence of a molecular marker having a nucleotide sequence such as SEQ ID No.: 1 in the pitaya genome,

[0018] Preferably, the reagent is a primer having a nucleotide sequence as shown in SEQ ID No.: 2 and 3.

[0019] More preferably, it further contains a PCR amplification reagent.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a method for identifying pitaya varieties. The method can be used to identify 'bird's nest fruit' and 'Peruvian bird's nest fruit'. The germplasm of pitaya can be effectively identified using only nutritional organs or seeds, which has important practical significance in genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1Figure 3 is the transcriptome and quantitative analysis of cDOPA5GT1-2; A is the expression of cDOPA5GT1-2 in the peel transcriptome of pitaya at the 'HHQL' and 'GHB' ripening stages; B is the expression analysis of cDOPA5GT1-2 in the peel of pitaya at the 'HHQL', 'GHB' and 'WCHL' ripening stages, with 'HHQL' as the standard for normalization, 'HHQL' is the green-skinned and white-fleshed pitaya 'Honghua Qinglong', 'GHB' is the red-skinned and white-fleshed pitaya 'Guanhua Bai', and 'WCHL' is the yellow-skinned and white-fleshed pitaya 'Wuxi Huanglong'.

[0023] Figure 2 The figure shows the electrophoresis diagram of the HucDOPA5GT1-2 proximal promoter cloning of four pitaya varieties (lines); M is a 2000bp DNA marker, and lanes 1 to 4 are the electrophoresis diagrams of the DNA template cloning results of four pitaya germplasm resources, 'Yanwoguo', 'Wuci Huanglong', 'Guanhuabai', and 'SCAU-QPZR'.

[0024] Figure 3 The figure shows the alignment of the specific sequences of the proximal promoter of HucDOPA5GT1-2 of different pitaya varieties; 'YW' stands for 'Yanwoguo', 'WCHL' stands for 'Wuxihuanglong', 'GHB' stands for 'Guanhuabai', and 'QPZR' stands for 'SCAU-QPZR'.

[0025] Figure 4 The HucDOPA5GT1-2 promoter is specifically inserted into 19 pitaya germplasm resources; M is a 2000bp DNA marker, and lanes 1 to 19 are 'Bird's Nest Fruit', 'Peruvian Bird's Nest Fruit', 'Thornless Yellow Dragon', 'Taiwan Red', 'Guanhua Red', 'Red Crown No. 1', 'Red Crown No. 2', 'Red Crystal', 'Guanhua White', 'SCAU-FJW', 'White Crystal', 'SCAU-YSLRW', 'Red Bird's Nest Fruit', 'SCAU-BHQL', 'SCAU-YS', 'SCAU-QPZR', 'Black Dragon Fruit', 'SCAU-S5', and 'SCAU-S8', 19 pitaya germplasm resources. DETAILED DESCRIPTION

[0026] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0027] The pitaya varieties (lines) used in the present invention are all preserved in the pitaya germplasm resource garden of South China Agricultural University. Among them, 'SCAU-FJW', 'SCAU-YSLRW', 'SCAU-S5', 'SCAU-S8', 'SCAU-QPZR', 'SCAU-BHQL', and 'SCAU-YS' are all collected pitaya germplasm resources. 'Guanhua Bai', 'Honghua Qinglong', 'Yanwoguo', 'Peru Yanwoguo', 'Spineless Huanglong', 'Taiwan Dahong', 'Guanhua Hong', 'Hongguan No. 1', 'Hongguan No. 2', 'Hongjingjing', 'Baijingjing', 'Hongyanwoguo', and 'Heilongguo' are all common pitaya varieties (lines).

[0028] Example 1 Transcriptome Analysis of Green-Skin White-Flesh Pitaya and Red-Skin White-Flesh Pitaya

[0029] 1. Experimental Methods

[0030] The ripe peels of pitaya 'Honghuaqinglong', a green-skinned, white-fleshed dragon fruit, and 'Guanhuabai', a red-skinned, white-fleshed dragon fruit, were collected from the pitaya germplasm resource nursery of South China Agricultural University for transcriptome sequencing.

[0031] 2. Experimental Results

[0032] Sequencing results showed that the expression levels of HucDOPA5GT1-2 (HU07G00240.1, PGMD, http: / / www.pitayagenomic.com / ), a structural gene related to betaine synthesis, were significantly different between the two dragon fruit germplasm resources of 'Honghua Qinglong' and 'Guanhua Bai' ( Figure 1 A).

[0033] Example 2 HucDOPA5GT1-2 affects betaine accumulation and peel color differences in pitaya

[0034] 1. Experimental Methods

[0035] The peels of mature fruits of 'Honghuaqinglong', 'Guanhuabai' and 'Wushihuanglong' were collected, and the expression of HucDOPA5GT1-2 was detected by RT-qPCR.

[0036] The method is as follows:

[0037] RNA from pitaya cultivars 'Honghua Qinglong', 'Guanhua Bai', and 'Wushi Huanglong' was extracted using a polysaccharide and polyphenol plant RNA extraction kit (Huayueyang, Beijing). TM The first strand of cDNA was synthesized using the RT reagent kit with gDNA Eraser (Perfect RealTime) (TaKaRa, Japan). Specific primers were designed based on the obtained full-length cDNA sequence:

[0038] F(5'-3'):TCCACCATCCAAATTGCCGA;

[0039] R(5'-3'):GAGCTTGTCGGTGTTCTCGA.

[0040] ChamQ SYBR Color qPCR Master Mix (Norwegian, Nanjing) was used to perform fluorescence quantitative analysis of the target gene. -△△CT The data were processed by the method, and the experiments were repeated three times.

[0041] 2. Experimental Results

[0042] The results are shown in Figure 1 B in the figure found that HucDOPA5GT1-2 was expressed at a lower level in green-skin pitaya (basically no betalain accumulation), but at a higher level in red-skin pitaya (mainly accumulating betalain red pigment) and yellow-skin pitaya (mainly accumulating betalain xanthocyanin). It is believed that HucDOPA5GT1-2 is a key gene affecting the accumulation of betalains and the difference in skin color of pitaya.

[0043] Example 3 Cloning of the HucDOPA5GT1-2 proximal promoter

[0044] 1. Experimental Methods

[0045] The HucDOPA5GT1-2 promoter sequence was obtained from the pitaya genome database PGMD (http: / / www.pitayagenomic.com / ) and primers were designed to clone the HucDOPA5GT1-2 proximal promoter sequences of four pitaya germplasm resources, namely, 'Yanwoguo', 'Wushihuanglong', 'Guanhuabai' and 'SCAU-QPZR'.

[0046] The specific method is as follows:

[0047] 1. Extraction of total DNA

[0048] Young shoots of ‘Yanwoguo’, ‘Wuthorn Huanglong’, ‘Guanhuabai’ and ‘SCAU-QPZR’ were collected from the pitaya germplasm resource nursery of South China Agricultural University for DNA extraction (details are shown in Table 1 ).

[0049] DNA was extracted using a plant genomic DNA rapid extraction kit (Adlai, Beijing). Since pitaya is a polysaccharide material, a step of Tris-saturated phenol / chloroform (1:1) extraction was added during DNA extraction. 2The concentration, purity and integrity of the DNA were detected by nucleic acid detector (Analytikjena, Germany) and 1.2% agarose gel electrophoresis, and the DNA was stored in a -20°C refrigerator until use.

[0050] Table 1

[0051]

[0052] 2. PCR amplification and electrophoresis

[0053] The cloning primer proGT-KL is as follows:

[0054] proGT-KL-F: TTGACTTGGTCAAAACGTTAAG;

[0055] proGT-KL-R:TCTCTCTTTCTCACTTTCTCTTT.

[0056] PCR amplification used a 50 μL reaction system: 2× Phanta Max Master Mix (Dye Plus) (Novozymes, Nanjing) 25.0 μL, genomic DNA (concentration 80 ng / μL) 2.0 μL, upstream and downstream primers 2.0 μL each, and ddH2O 19.0 μL.

[0057] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min, 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s, followed by extension at 72°C for 5 min. PCR products were detected by electrophoresis on 1.2% agarose gels and visualized and photographed using a UV gel imaging system (Bio-Rad, USA).

[0058] 2. Experimental Results

[0059] The electrophoresis results are shown in Figure 2 The results showed that using proGT-KL as the cloning primer and 'Bird's Nest Fruit' DNA as the template, a product of about 1600bp in length could be obtained; while using 'Spinless Huanglong', 'Guanhuabai' and 'SCAU-QPZR' DNA as templates, the amplified product was about 1200bp.

[0060] The sequencing results were compared using DNAMAN software, and it was found that there was a 458 bp insertion in the promoter of HucDOPA5GT1-2 of 'Yanwoguo' about 160 bp away from the transcription start site. The nucleotide sequence is shown in SEQ ID No.: 1 ( Figure 3 ).

[0061] The specific sequence is:

[0062] CGAAAACCATTCTTTGATTGGTAATAAATTGTTCGTTAATTATATTAGTTGTT

[0063] CACTATCAATTATTTGTATTAATATTTTTCATTAATTGTTTCTAACAAAAGTAC

[0064] TTGATAGAATTAATTATTTAAAAAAAAAAAAGACTAATTATCAAAACTTCAT

[0065] AGTGGGAACTTTTTTACTCTTGCTTTTTAGAACAAACAAACATGAGTATTTC

[0066] AAAAGACTAATATACAAACACGCATTGATCGAAGTGGTTTGACATTTATTTA

[0067] TTTTAAACAAGACTTCAGGTTCCAGTTATAAATAAAAAAAAATCTATAATGA

[0068] ACAAATATTATCCCTTATTAAATCAACAGTAATTTGAATTCAATAAAATGGAG

[0069] GAATCAAGACACCAAAAAAAAAAAATCCAAATTCTTTATTCTCACCCATCGACCTCTTTAATCGTACATAATACAAGTGTATAGTCCCAC.

[0070] Example 4 Detection of pitaya germplasm resources

[0071] 1. Experimental Methods

[0072] 19 pitaya germplasms were randomly collected from the pitaya germplasm resource garden of South China Agricultural University (see Table 2), and total DNA was extracted according to the method of Example 3.

[0073] The 458 bp (SEQ ID No.: 1) insert fragment in the HucDOPA5GT1-2 promoter in Example 3 was amplified, and the primers were designed based on its sequence as follows:

[0074] proGT-JD-F:CGAAAACCATTCTTTGATTGGTA(SEQ ID No.:2);

[0075] proGT-JD-R: GTGGGACTATACACTTGTATTATGTACG (SEQ ID No.: 3).

[0076] The total DNA of pitaya germplasm in Table 2 was amplified by PCR using the proGT-JD primer. The PCR reaction system and amplification procedure were the same as those in Example 3.

[0077] Table 2

[0078]

[0079]

[0080] 2. Experimental Methods

[0081] The results are as follows Figure 4 As shown, the results showed that when PCR amplification was performed using proGT-JD-F and proGT-JD-R primers, only the amplified product with the 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit' pitaya DNA as templates was 458 bp in length, while no amplified product was found with other pitaya DNAs. This marker was named YW-BJ1 ( Figure 4 ). Therefore, primers proGT-JD-F and proGT-JD-R can be used to identify 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit' pitaya.

[0082] Example 5 A method for detecting 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit'

[0083] Extract the DNA of the sample to be tested, and amplify the sample DNA using the sequence shown in SEQ ID No.: 2 and 3.

[0084] The PCR amplification procedure used a 50 μL reaction system, which included: 25.0 μL of 2× Phanta Max Master Mix (DyePlus) (Norvozymes, Nanjing), 2.0 μL of genomic DNA (concentration 80 ng / μL), 2.0 μL of upstream and downstream primers, and 19.0 μL of ddH2O.

[0085] The amplification procedure was as follows: pre-denaturation at 95°C for 3 min, 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s, followed by extension at 72°C for 5 min. PCR products were detected by electrophoresis on a 1.2% agarose gel and photographed using a UV gel imaging system.

[0086] If there is a 458bp amplification product, the sample to be tested is 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' dragon fruit; otherwise, the sample to be tested is neither 'Bird's Nest Fruit' nor 'Peruvian Bird's Nest Fruit' dragon fruit.

Claims

1. A method for identifying pitaya varieties, characterized in that, The pitaya variety is identified based on whether a molecular marker such as the nucleotide sequence shown in SEQ ID No.: 1 exists in the pitaya genome to be tested.

2. The method according to claim 1, characterized in that The molecular marker of claim 1 is present, and the pitaya to be tested is 'bird's nest fruit' or 'Peruvian bird's nest fruit' pitaya; the molecular marker of claim 1 is not present, and the pitaya to be tested is not 'bird's nest fruit' or 'Peruvian bird's nest fruit' pitaya.

3. The method according to claim 1 or 2, characterized in that The method for detecting whether the molecular marker with the nucleotide sequence shown in SEQ ID No.: 1 exists in the pitaya genome to be tested is as follows: using primers with the nucleotide sequences shown in SEQ ID No.: 2 and 3 to perform PCR amplification on the pitaya genome DNA to be tested.

4. The method according to claim 3, characterized in that The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.

5. The application of a reagent for detecting whether a nucleotide sequence such as a molecular marker shown in SEQ ID No.: 1 exists in the pitaya genome, characterized in that, The application is an application in identifying the variety of pitaya or preparing a kit for identifying the variety of pitaya.

6. The use according to claim 3, characterized in that The reagents are primers whose nucleotide sequences are shown as SEQ ID No.: 2 and 3.

7. A set of primers for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' pitaya, characterized in that: The primers are shown in SEQ ID No.: 2 and 3.

8. A kit for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' pitaya, characterized in that: The invention contains reagents for detecting whether a molecular marker with a nucleotide sequence such as SEQ ID No.: 1 exists in the dragon fruit genome.

9. The kit according to claim 8, characterized in that The reagents are primers whose nucleotide sequences are shown as SEQ ID No.: 2 and 3.

10. The kit according to claim 9, characterized in that Also contains PCR amplification reagents.

Images