Molecular marker closely linked with pepper fruit length regulation gene CaFL1 and application thereof

Abstract

The invention relates to a molecular marker closely linked with a pepper fruit length regulation gene CaFL1 and application of the molecular marker. The molecular marker is insertion / deletion of three basic groups GAC at 223149123-223149125th positions of chromosome 10 of a pepper genome, and the position of the molecular marker in the genome is determined according to a Qieme reference genome. Specifically, when the genotype of the molecular marker is InGAC: InGAC, the pepper has a long fruit phenotype, when the genotype is InGAC: DelGAC, the pepper has an intermediate phenotype, and when the genotype is DelGAC: DelGAC, the pepper has a short fruit phenotype. Through verification, the accuracy rate of the molecular marker reaches 100%, early, massive and accurate prediction and directional improvement of the pepper fruit length can be realized, and a new way is provided for screening and identifying the pepper fruit length and breeding the pepper fruit length.

Description

Technical Field

[0001] The invention belongs to the field of molecular markers, and particularly relates to a molecular marker tightly linked to a pepper fruit length regulating gene CaFL1 and an application thereof. Background Art

[0002] Pepper (Capsicum annuum L.) is the most widely cultivated and valued vegetable crop in my country, widely used for fresh consumption, processing, seasoning, and medicinal purposes. Improving pepper quality and yield to continuously meet the needs of diverse consumers has long been a common goal pursued by pepper breeders. Pepper fruit length is a key appearance quality trait, directly affecting yield, mechanized harvesting efficiency, and end-use applications. Genetic variation in fruit length is significant among pepper germplasm resources, and the demand for fruit length in commercial varieties is highly segmented. Therefore, genetic improvement of pepper fruit length is a core goal for enhancing cultivar competitiveness. However, conventional breeding methods suffer from long phenotypic selection cycles and low efficiency, necessitating breakthroughs in molecular breeding technologies. Therefore, cloning key regulatory genes for pepper fruit length and developing corresponding functional markers are crucial for the precise and efficient breeding of pepper varieties with varying fruit lengths.

[0003] At present, researchers have conducted genetic and positioning studies on pepper fruit length in several different populations over many years and in many places, and found that pepper fruit length is controlled by multiple QTL loci, and identified multiple QTL loci controlling pepper fruit length, such as FL-2.1, FL-3.1, FL-3.2, FL-3.3, FL-3.4, FL-4.1, FL-6.1, FL-7.1, and FL-8 (Rao, GU et al., 2003. Mapping of yield-related QTLs in pepper in an interspecific cross of Capsicum annuum and C. frutescens. Theoretical and Applied Genetics, 106(8):1457-1466; Barchi, L. et al., 2009. QTL analysis of plant development and fruit traits in pepper and performance of selective phenotyping. Theoretical and Applied Genetics, 118(6):1157-1171; Han, K. et al., 2009. QTL analysis of plant development and fruit traits in pepper and performance of selective phenotyping. Theoretical and Applied Genetics, 118(6):1157-1171; al.,2016.An ultra-high-density bin map facilitates high-throughput QTL mapping of horticultural traits in pepper(Capsicum annuum).DNA Research,23(2):81-91;Chunthawodtiporn,J.et al.,2018.Capsicum annuum quantitative trait locicontrolling fruit size and other horticultural traits in bell pepper.ThePlant Genome,11(1);Cao,Y.et al.,2022.Pepper variome reveals the history and key loci associated with fruit domestication and diversification.MolecularPlant,15(11):1744-1758). Among them, FL-3.2 was shown to be the main effect locus controlling pepper fruit length in multiple different hybrid populations.In addition, the QTL loci identified in some studies on the regulation of pepper fruit shape also affect the fruit length of pepper. For example, Cao et al. used 347 pepper germplasm resources to construct a whole-genome variation map of annual cultivated pepper species, and identified that the genetic regulatory loci Fs3.1 and FL-3.2 of fruit shape highly overlap. This locus may affect the fruit length and transverse diameter of pepper during flowering and early fruit development, regulating the development of the fruit into a slender type, which is suitable for genetic improvement of pepper varieties (Cao, Y. et al., 2022. Pepper variome reveals the history and key loci associated with fruit domestication and diversification. Molecular Plant, 15(11): 1744-1758). In their study of fruit shape regulation, Borovsky et al. found that the fs10.1 locus inhibits cell growth within two weeks of pollination to ovary development, thereby affecting the length of pepper fruit (Borovsky, Y. et al., 2011. Characterization of fs10.1, a major QTL controlling fruit elongation in Capsicum. Theoretical and Applied Genetics, 123(4): 657-665); in subsequent studies, the candidate gene CaOFP20 of fs10.1 was cloned, and its encoded protein is homologous to tomato SIOFP20. After silencing CaOFP20, it was found that the fruit would significantly elongate and become thinner (Borovsky, Y. et al., 2021. Pepper fruit elongation is controlled by Capsicum annuum Ovate Family Protein 20. Frontiers in Plant Science, 12: 815589).

[0004] Although multiple regulatory loci have been identified through genome-wide association studies (GWAS) and QTL mapping, key progress remains limited. Currently, only two pleiotropic loci (FL-3.2 and fs10.1) that simultaneously regulate fruit length and width have been cloned. No loci that independently regulate pepper fruit length have been cloned, making it difficult to precisely manipulate a single trait. Furthermore, existing marker development is often based on linkage disequilibrium (e.g., SSRs and SNPs) rather than targeting functional variation, resulting in unstable marker-phenotype associations and poor cross-population applicability. To achieve precise and efficient cultivation of pepper fruit length, the present invention is hereby proposed. Summary of the Invention

[0005] To address the existing challenges of a lack of functional markers and the difficulty of targeting pleiotropic loci in regulating pepper fruit length, this study identified the pepper fruit length-specific regulatory locus FL-10.1 and cloned its candidate gene, CaFL1. Based on sequence variation in its coding region, molecular markers tightly linked to CaFL1 were developed.

[0006] One of the purposes of the present invention is to provide a reagent for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulating gene CaFL1, and its application in pepper fruit length breeding or identification.

[0007] A second object of the present invention is to provide a primer set for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulating gene CaFL1.

[0008] A third object of the present invention is to provide a reagent or kit for detecting the genotype of the above-mentioned molecular markers.

[0009] A fourth object of the present invention is to provide a method for identifying the length of pepper fruit to be measured.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] The first aspect of the present invention provides a reagent for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulating gene CaFL1 in the following aspects (a) or (b):

[0012] (a) Application in the selection or cultivation of pepper varieties with different fruit lengths;

[0013] (b) Application in identifying fruit length of pepper varieties;

[0014] The molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 of chromosome 10 of the pepper genome. The position of the molecular marker in the genome is determined based on the Qiemen reference genome (http: / / www.bioinformaticslab.cn / files / genomes / pepper_pan / genome_v1 / Canb / ).

[0015] Specifically, when the genotype of the molecular marker is InGAC:InGAC, the pepper has a long-fruit phenotype; when the genotype of the molecular marker is InGAC:DelGAC, the pepper has an intermediate phenotype; when the genotype of the molecular marker is DelGAC:DelGAC, the pepper has a short-fruit phenotype.

[0016] More specifically, a pepper plant with a fruit length of 12 cm ± 4 cm is defined as a pepper variety with a short fruit phenotype, a pepper plant with a fruit length of 26 cm ± 4 cm is defined as a pepper variety with a long fruit phenotype, and a pepper plant with a fruit length greater than 16 cm and less than 22 cm is defined as a pepper variety with an intermediate phenotype.

[0017] The loci (FL-3.2 and fs10.1) found in the prior art to regulate pepper fruit shape simultaneously regulate both fruit length and fruit width, altering pepper width while regulating elongation (FL-3.2 regulates slender fruits, while fs10.1 regulates short, thick fruits). However, given widespread market demand, it would be more desirable to be able to regulate pepper fruit length alone, making it longer without affecting fruit width. The present invention uses whole-genome association analysis combined with BSA sequencing of an F2 segregating population to analyze the gene loci that control pepper fruit length, identifying FL-10.1, a locus that can independently regulate pepper fruit length (without regulating fruit width). Through precise mapping of FL-10.1, CaFL1 was identified as a key candidate gene. Based on sequence variations in the CaFL1 coding region, molecular markers closely linked to it were developed, and these markers have been verified to have a 100% accuracy rate in predicting pepper fruit length.

[0018] In the genotype description of this article, "InGAC" means that there are three nucleotides with the base GAC (also called the insertion of the nucleotide GAC) at positions 223149123-223149125 on chromosome 10 of the pepper genome; "DelGAC" means that there are no nucleotides or the GAC nucleotide is missing at positions 223149123-223149125 on chromosome 10 of the pepper genome.

[0019] The genotype InGAC:InGAC indicates that the nucleotide GAC is inserted at positions 223149123-223149125 of a pair of alleles on chromosome 10 of the pepper genome; the genotype InGAC:DelGAC indicates that the nucleotide GAC is inserted at positions 223149123-223149125 of one gene in a pair of alleles on chromosome 10 of the pepper genome, and the nucleotide GAC is missing in the other gene; the genotype DelGAC:DelGAC indicates that the nucleotide GAC is missing at positions 223149123-223149125 of a pair of alleles on chromosome 10 of the pepper genome.

[0020] The molecular marker developed in the present invention, which is tightly linked to the pepper fruit length regulatory gene CaFL1, provides a practical molecular marker for the precise and efficient breeding or identification of pepper varieties with different fruit lengths.

[0021] The molecular markers developed by the present invention enable early, large-scale, and accurate prediction and targeted improvement of pepper fruit length. Applications of these molecular markers in pepper fruit length prediction, targeted improvement, screening, identification, and pepper fruit length breeding are all encompassed within the scope of the present invention.

[0022] In the application of the first aspect of the present invention, the reagent for detecting the genotype of the molecular marker tightly linked to the pepper fruit length regulating gene CaFL1 can be any reagent in the art that can determine the genotype of the molecular marker.

[0023] As a preferred embodiment, the reagent includes a primer set, which can be a primer set designed for high-throughput genotyping based on KASP technology, a primer set designed for genotyping based on conventional PCR and PCR product sequencing, or a primer set designed for genotyping based on conventional PCR, enzyme digestion, and electrophoresis of enzyme digestion products.

[0024] Considering aspects such as genotyping efficiency and ease of operation, the primer set of the present invention is preferably a primer set designed based on KASP technology.

[0025] In an optional embodiment of the present invention, the primer set includes:

[0026] A first forward primer comprising the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing;

[0027] A second forward primer comprising the nucleotide sequence shown in SEQ ID No. 4 in the sequence listing;

[0028] The nucleotide sequence of the universal reverse primer is shown in SEQ ID No. 5 in the sequence listing.

[0029] SEQ ID No. 3 in the sequence table is specifically:

[0030] 5'-AGCCCAAATTCTAAGGAAAAGTCTG-3'.

[0031] SEQ ID No. 4 in the sequence table is specifically:

[0032] 5'-GAGCCCAAATTCTAAGGAAAAGTCTA-3'.

[0033] SEQ ID No.5 in the sequence table is specifically:

[0034] 5'-GCTAGAGAAGTACTAGTATATGATTATTTCAAC-3'.

[0035] Furthermore, the 5' ends of the first forward primer and the second forward primer are respectively connected with fluorescent linker sequences of different colors, for example, the fluorescent linker sequence is selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.

[0036] Furthermore, the nucleotide sequence of the first forward primer is shown in the sequence listing as SEQ ID No. 6, and the nucleotide sequence of the second forward primer is shown in the sequence listing as SEQ ID No. 7.

[0037] SEQ ID No.6 in the sequence table is specifically:

[0038] 5'-GAAGGTGACCAAGTTCATGCTAGCCCAAATTCTAAGGAAAAGTCTG-3'.

[0039] SEQ ID No.7 in the sequence table is specifically:

[0040] 5'-GAAGGTCGGAGTCAACGGATTGAGCCCAAATTCTAAGGAAAAGTCTA-3'.

[0041] Of course, other primer sets designed based on the molecular marker and KASP technology using existing primer design methods are also within the scope of protection of the present invention.

[0042] In an optional embodiment of the first aspect of the present invention, the reagents further include at least one of a PCR auxiliary reagent, a reagent for DNA extraction, and a reagent for PCR amplification product analysis, such as a buffer, a DNA polymerase, dNTPs, etc. All or part of the reagents may be provided in the form of a kit.

[0043] In summary, the primer sets designed by prior art methods for detecting the above-mentioned molecular markers, the reagents comprising the primer sets, and the kits formed by these reagents are all within the scope of the present invention.

[0044] The second aspect of the present invention provides a primer set for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulatory gene CaFL1, wherein the molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome, and the position of the molecular marker in the genome is determined based on the Qiemen reference genome.

[0045] As a preferred embodiment, the primer set is designed based on KASP technology, specifically comprising:

[0046] A first forward primer comprising the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing;

[0047] A second forward primer comprising the nucleotide sequence shown in SEQ ID No. 4 in the sequence listing;

[0048] The nucleotide sequence of the universal reverse primer is shown in SEQ ID No. 5 in the sequence listing.

[0049] Furthermore, the 5' ends of the first forward primer and the second forward primer are respectively connected to fluorescent linker sequences of different colors, for example, the fluorescent linker sequence is selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.

[0050] Furthermore, the nucleotide sequence of the first forward primer is shown in the sequence listing as SEQ ID No. 6, and the nucleotide sequence of the second forward primer is shown in the sequence listing as SEQ ID No. 7.

[0051] The third aspect of the present invention provides a reagent or kit for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulating gene CaFL1, wherein the reagent or kit comprises the primer set of the second aspect.

[0052] Furthermore, the reagent or kit may also include other auxiliary reagents, such as reagents for DNA extraction, reagents for PCR amplification, and reagents for PCR amplification product analysis.

[0053] A fourth aspect of the present invention provides a method for identifying the length of a pepper fruit to be tested, comprising the following steps:

[0054] (1) extracting genomic DNA from the pepper sample to be tested;

[0055] (2) using the genomic DNA of the pepper sample to be tested as a template, performing PCR amplification using the primer set of the second aspect or the reagent or kit of the third aspect to obtain a PCR amplification product;

[0056] (3) Analyze the PCR amplification product, determine the genotype of a molecular marker tightly linked to the pepper fruit length regulatory gene CaFL1 based on the analysis results, and predict the fruit length phenotype of the pepper sample to be tested based on the genotype of the molecular marker; the molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 of chromosome 10 of the pepper genome, and the position of the molecular marker in the genome is determined based on the Qiemen reference genome.

[0057] Specifically, the method for predicting the fruit length phenotype of the pepper sample to be tested by the genotype of the molecular marker in step (3) is as follows:

[0058] When the genotype of the molecular marker is InGAC:InGAC, it is predicted that the pepper has a long fruit phenotype; when the genotype of the molecular marker is InGAC:DelGAC, it is predicted that the pepper has an intermediate phenotype; when the genotype of the molecular marker is DelGAC:DelGAC, it is predicted that the pepper has a short fruit phenotype.

[0059] As an optional embodiment, the method for determining the genotype of the molecular marker described in the first aspect according to the analysis results in step (3) includes: using an instrument to detect the fluorescent signal of the PCR product, and judging the genotype of the pepper to be tested according to the color of the fluorescent signal of the PCR product; preferably, the specific principle of the judgment is as follows: if the fluorescent signal of the PCR product of the pepper to be tested shows the fluorescence of the first forward primer, then the genotype of the pepper to be tested is InGAC:InGAC; if the fluorescent signal of the PCR product of the pepper to be tested shows the fluorescence of the second forward primer, then the genotype of the pepper to be tested is DelGAC:DelGAC; if the fluorescent signal of the PCR product of the pepper to be tested shows the fluorescence of the first forward primer and the fluorescence of the second forward primer at the same time, then the genotype of the pepper to be tested is DelGAC:InGAC.

[0060] As an optional embodiment, the pepper sample to be tested is obtained at the pepper seedling stage.

[0061] As an optional embodiment, the pepper sample to be tested is the fourth to sixth true leaf grown by the pepper.

[0062] The chili pepper growth cycle is generally divided into four stages: germination, seedling, flowering and fruiting, and fruiting. The seedling stage refers to the time from the first true leaf to the first flower bud. After a chili seedling emerges from the soil, the first two leaves that appear at the germinal point are called cotyledons, while all subsequent leaves are true leaves.

[0063] The method for identifying pepper fruit length to be measured provided by the fourth aspect of the present invention is used to screen or identify pepper varieties with the desired fruit length phenotype for further pepper variety selection or cultivation. Methods for selecting or cultivating pepper varieties using the method of the fourth aspect are also within the scope of protection of the present invention.

[0064] The beneficial effects of the present invention are as follows:

[0065] The molecular markers developed in the present invention, which are tightly linked to the fruit length-specific regulatory gene CaFL1, solve the problem of direct breeding of pepper varieties with different fruit lengths or the problem of identifying pepper fruit length. They can break through the limitations of traditional markers and have the following advantages: (1) precision: the pepper fruit length can be regulated independently (without regulating the pepper fruit width), that is, the single trait of pepper fruit length can be precisely manipulated, causal variation can be directly targeted, "designed breeding" can be achieved, and the phenotype-genotype disconnection can be avoided; and (2) efficiency: the backcross breeding process can be accelerated through KASP marker typing.

[0066] The molecular markers developed in the present invention can accurately predict the fruit length phenotype of the pepper germplasm or variety to be tested with an accuracy rate of 100%. It can realize the early, large-scale, and precise prediction and targeted improvement of pepper fruit length, providing a new approach for the prediction, targeted improvement, screening, identification and pepper fruit length breeding of peppers. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] In order to more clearly illustrate the technical solutions of the specific embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the specific embodiments. Obviously, the drawings described below do not limit the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0068] Figure 1 Figure 3 shows the construction of RIL populations and the association analysis of fruit length. (a) Schematic diagram of the RIL population construction process, in which an F2 segregating population was constructed by hybridizing two high-generation inbred lines, and then a stable RIL population was constructed by single-seed transmission. (b) The bin marker genotype clustering of 216 RIL lines. (c) The Manhattan plot of the results of genome-wide association analysis based on the genotype data and fruit length data of the 216 RIL lines. The major effect locus FL-3.2 was identified on chromosome 3.

[0069] Figure 2 Phenotypic data for RILs-20 and RILs-126. (a) Describes lines within the RIL population that carry the FL-3.2 long-fruit genotype (AA) but exhibit significant differences in fruit length. (b) Statistical analysis results show significant differences in fruit length but no significant differences in fruit width between RILs-20 and RILs-126. (c) Graph showing changes and differences in fruit length between RILs-20 and RILs-126 at different developmental stages.

[0070] Figure 3 This is the fine mapping map of the new fruit length regulatory site FL-10.1 on chromosome 10.

[0071] Figure 4This is the sequence difference analysis of the fruit length regulatory gene CaFL1 between the parental lines RILs-20 and RILs-126, where A is the nucleotide sequence difference analysis of RILs-20 and RILs-126 on this gene, and B is the difference analysis of the protein sequence encoded by RILs-20 and RILs-126 on this gene; q94.sequence refers to the pepper Qiemen reference sequence, and consensus is the consensus sequence.

[0072] Figure 5 The following are the typing results of KASP70-72 markers for parents (RILs-20 and RILs-126), F1 and 48 F2 plants. Among them, the blue circle represents the genotype InGAC:InGAC, and the fruit length of the corresponding plant is predicted to be a long fruit phenotype; the green circle represents the genotype InGAC:DelGAC, and the fruit length of the corresponding plant is predicted to be an intermediate phenotype; the red circle represents the genotype DelGAC:DelGAC, and the fruit length of the corresponding plant is predicted to be a short fruit phenotype; the black circle represents the blank control, and the pink circle represents the sample that was not measured. DETAILED DESCRIPTION

[0073] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0074] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0075] Example 1. Obtaining a primer set for detecting molecular marker genotypes tightly linked to the pepper fruit length regulating gene CaFL1

[0076] The materials numbered "BVRC-" in the test materials are high-quality inbred lines bred by the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences (provided by Beijing Crop Germplasm Resources Bank), and the materials numbered "RILs-" are recombinant inbred line populations constructed with BVRC1 and BVRC25 as parents. For the specific construction process, see Figure 1 a. BVRC1 and BVRC25 were used as parents, and the F1 generation was obtained by hybridization. The F2 generation was then self-pollinated. From the F2 generation, single seed propagation was performed until the F10 generation was obtained. That is, a stable population was obtained by continuous selfing to the F10 generation (216 RIL lines, n = 216).

[0077] The new F2 population mentioned in Section 1.5 below was obtained by crossing two independent RIL lines (RILs-20 and RILs-126), totaling about 300 plants.

[0078] 1.1 Material planting

[0079] Seeds were disinfected by soaking in a 4% sodium hypochlorite solution for 3–5 minutes, then rinsed 3–4 times with sterile water and soaked at 55°C for 5 minutes. The disinfected seeds were wrapped in moist gauze, placed in a Petri dish, and incubated in the dark at 25°C for 7–10 days. When most seeds appeared white, they were immediately sown in a 72-well tray containing a 2:1 ratio of peat to vermiculite by volume. The trays were maintained at 28°C with a 14-hour light intensity. When the plants had two leaves, a new leaf was removed for DNA extraction using the CTAB method. Seedlings were cultured in the seedling medium for 30–40 days before being transplanted to the field. For the fruit length phenotyping, six plants were planted from each line of the RIL population. Fruit length was measured on four to five fruit that had changed color from each plant, and the average results were used.

[0080] 1.2 Resequencing of parental and RIL lines

[0081] Leaf samples from the parental lines and all RIL lines were sent to Major Biotech (https: / / www.majorbio.com / ) for DNA library construction and paired-end 150bp sequencing on the Illumina platform. Raw data were processed using Trimmomatic v0.33 to remove adapter sequences to generate high-quality clean reads. These clean reads were then aligned to the pepper (Qiemen) reference genome (http: / / www.bioinformaticslab.cn / files / genomes / pepper_pan / genome_v1 / Canb / ) using BWA 0.7.17 to generate SAM files. SAM files were converted to BAM format and sorted using SAMtools. Duplicate sequences were marked and removed using the MarkDuplicates function in GATK (v4.1.7). Variant detection was performed using the GATK HaplotypeCaller to generate raw VCF files, which were then annotated using ANNOVAR.

[0082] 1.3 High-density binmap construction

[0083] The SNPs of 216 RIL lines were genotyped (AA, BB or heterozygous). A sliding window method containing 15 consecutive SNPs was used, and the parental type was determined when at least 9 SNPs in the window showed the same genotype. The recombination bin was defined as the genomic region with the same parental genotype in the RIL line. The interval region with inconsistent genotypes between adjacent SNPs was excluded, and the bin length was less than 250kb. The genotype fuzzy region was marked as "not available". The recombination bin information and recombination breakpoint analysis of all RIL lines were integrated to construct a population recombination bin map (see Figure 1 b) Principal component analysis and genotype cluster analysis were performed on 216 RIL lines based on the recombination bin information.

[0084] 1.4 Genome-wide association analysis of fruit length

[0085] GWAS analysis was performed using GEMMA software. First, the kinship matrix was calculated to correct for population structure. Then, the fruit length trait was analyzed based on the linear mixed model (LMM) to obtain the p-values of all bins. The p-value of each associated bin was subjected to FDR analysis, with the negative logarithm of the p-value to the base 10 as the ordinate and the physical position of the bin as the abscissa. A Manhattan plot was drawn using R software ( Figure 1 c). In the Manhattan plot, a significant association threshold of -Log10 (0.1 / bin) was set. A pleiotropic locus regulating fruit shape and length was located on chromosome 3. This locus overlaps with the previously reported FS3.1 / FL-3.2, whose candidate gene encodes a TRM25 protein (Han et al., 2016; Colona et al., 2019; Cao et al., 2022).

[0086] 1.5 Construction of new F2 population and BSA analysis

[0087] By detecting the genotype of the FL-3.2 locus of each RIL line, we found that there were 5 lines carrying the FL-3.2 long-fruit genotype (AA) but with short-fruit phenotype (see Figure 2 a), indicating the presence of other loci regulating pepper fruit length. Furthermore, our amplification and sequencing of parental materials revealed no differences at the fs10.1 locus. Therefore, based on the identification of the known major locus for fruit length, FL-3.2, using the RIL population and excluding the influence of the known pleiotropic locus for fruit length and width, fs10.1, we further explored other minor loci for fruit length.

[0088] We screened out two lines from the RILs population that carried the long-fruit genotype (AA) at the FL-3.2 locus but had significant differences in fruit length but no significant differences in fruit width—RILs-20 and RILs-126 (see Figure 2 a and Figure 2 b) The changes and differences in fruit length of RILs-20 and RILs-126 at different developmental stages can be found in Figure 2 c.

[0089] Using RILs-20 as the short-fruiting parent, the fruit length was approximately 14 cm; using RILs-126 as the long-fruiting parent, the fruit length was approximately 26 cm. The short-fruit phenotype is a fruit length of 12 cm ± 4 cm, the long-fruit phenotype is a fruit length of 26 cm ± 4 cm, and the intermediate-fruit phenotype is a fruit length greater than 16 cm but less than 22 cm.

[0090] A new F2 population was constructed using RILs-20 and RILs-126 as parents. Extreme individual plants were selected from these pools for BSA sequencing. Illumina paired-end sequencing data were quality-controlled using Trimmomatic v0.33 and aligned to the Qiemen reference genome using BWA v0.7.17 to generate SAM files. These files were then converted to BAM format using SAMtools. Duplicates were removed using GATK MarkDuplicates. SNPs were detected using HaplotypeCaller and a VCF file was generated. SNP indexes were calculated using OcBSA software and plotted. The genomic distribution of SNP loci between the two pools was analyzed, and regions associated with fruit length traits were located. A candidate interval for FL-10.1, a novel regulatory locus for pepper fruit length, was mapped on chromosome 10.

[0091] 1.6 Fine mapping of the novel fruit length regulatory locus FL-10.1

[0092] See also Figure 3 First, the initial positioning interval was locked between 221-224Mb on chromosome 10 through BSA and polymorphic marker verification. Then, by screening and exchanging individual plants and constructing F2:3 and F3:4 families, the FL-10.1 locus was finely positioned between 222.8-223.2Mb, narrowing the locus interval to 400kb. This interval contains 10 genes. Combining sequence difference analysis, expression analysis and functional annotation, we listed CaFL1 as an important candidate gene for FL-10.1 and cloned the gene sequence, which is located at 223149054-223151590 on chromosome 10 of the Qiemen reference genome, see Figure 3 .

[0093] See also Figure 4There are 7 differences in the CDS sequences of the fruit length regulatory gene CaFL1 between RILs-20 and RILs-126, including 1 InDel and 6 SNPs. One InDel caused a non-frameshift mutation in the amino acid sequence, and the 6 SNPs caused 4 synonymous mutations and 2 non-synonymous mutations. Finally, the inventors focused on 3 of the mutations, see for details. Figure 3 and 4 , including: 1 non-frameshift mutation (deletion of 3 bases), located at positions 70-72 of the open reading frame of the gene, wherein the three nucleotides GAC exist or are inserted at positions 70-72 of the RILs-126 strain, while the three nucleotides GAC are missing at positions 70-72 of the RILs-20 strain; and 2 non-synonymous mutations, one located at position 443 of the open reading frame of the gene, wherein the nucleotide base at position 443 of the RILs-126 strain is C, while the nucleotide base at position 443 of the RILs-20 strain is A, and the other located at position 1349 of the open reading frame of the gene, wherein the nucleotide base at position 1349 of the RILs-126 strain is C, while the nucleotide base at position 1349 of the RILs-20 strain is T. KASP marker primers were designed for the three variants and found to be highly effective in distinguishing long-fruited and short-fruited parents, as well as the F1 population. Ultimately, the most effective marker, KASP70-72, was selected for genotyping 96 random individuals from the new F2 population. Marker KASP70-72 identifies a deletion or insertion of three bases, GAC, at positions 223149123-223149125 on pepper chromosome 10.

[0094] The genomic nucleotide sequence of the CaFL1 gene is shown in SEQ ID No. 1 in the sequence listing.

[0095] The coding nucleotide sequence of the CaFL1 gene, i.e., the CDS sequence or ORF, is shown in the sequence listing as SEQ ID No. 2. This gene or its encoded protein functions to control the growth of pepper fruit. The coding nucleotide sequence of the CaFL1 gene of the RILs-126 strain is shown in the sequence listing as SEQ ID No. 2.

[0096] 1.7 Primer design for fruit length-linked marker KASP70-72

[0097] The insertion / deletion site of three bases, GAC, at bp 70-72 of the CaFL1 gene corresponds to the marker KASP70-72. Primers were designed and synthesized to determine the genotype of this marker. Two of the primers are allele-specific forward primers, and one is a universal reverse primer. The allele-specific forward primers produce distinct fluorescent signals in a competitive PCR reaction.

[0098] The sequences of the KASP70-72 primer set are as follows:

[0099] KASP70-72-X:

[0100] 5'- GAAGGTGACCAAGTTCATGCT AGCCCAAATTCTAAGGAAAAGTCTG-3' (SEQ ID No. 6), wherein the underlined portion is the fluorescent linker sequence FAM.

[0101] KASP70-72-Y:

[0102] 5'- GAAGGTCGGAGTCAACGGATT GAGCCCAAATTCTAAGGAAAAGTCTA-3' (SEQ ID No. 7), wherein the underlined portion is the fluorescent linker sequence HEX.

[0103] KASP70-72-C:

[0104] 5'-GCTAGAGAAGTACTAGTATATGATTATTTCAAC-3' (SEQ ID No. 5).

[0105] Example 2 Application of molecular markers developed in Example 1

[0106] (1) Forty-eight pepper plants that had not been genotyped or phenotyped were randomly selected from the new F2 population constructed in Section 1.5 of Example 1, as well as the parental RILs-20 and RILs-126, and the F1 generation plants. Leaves were taken according to the method described in Example 1.1, and genomic DNA of each plant was extracted using the CTAB method.

[0107] (2) The 51 DNA samples extracted in step (1) were amplified using the KASP70-72 primer sequences designed in Section 1.7 of Example 1 (SEQ ID No. 6, SEQ ID No. 7, and SEQ ID No. 5, synthesized by Sangon Biotech (Shanghai) Co., Ltd.). The typing system is shown in Table 1.

[0108] Table 1 Typing system

[0109] Element Addition amount 2X Master Mix (LGC Biosearch Technologies, USA) 5ul KASP70-72-X(10uM) 0.2ul KASP70-72-Y(10uM) 0.2ul KASP70-72-C(10uM) 0.5ul DNA template 10ng <![CDATA[ddH2O]]> Make up to 10ul

[0110] The PCR reaction program is:

[0111] Step 1: Pre-denaturation at 95°C for 10 min; Step 2: Touchdown PCR, 95°C for 15 s, 61→55°C, -0.6°C / cycle for 60 s, for 10 cycles; Step 3: Amplification, 95°C for 15 s, 55°C for 60 s, for 28 cycles; Step 4: Read the plate at 30°C for 30 s.

[0112] The PCR amplification products are subjected to fluorescence signal detection and analysis, the genotype of the molecular marker KASP70-72 of each individual plant is counted, and the phenotype of the pepper fruit length of each individual plant is predicted according to the genotype of each individual plant. When the fluorescent signal is blue, the genotype of the molecular marker KASP70-72 is InGAC:InGAC (i.e., the nucleotide GAC is inserted at positions 223149123-223149125 of a pair of alleles on chromosome 10), and the pepper to be tested is predicted to have a long-fruit phenotype; when the fluorescent signal is green, the genotype is InGAC:DelGAC (i.e., the nucleotide GAC is inserted at positions 223149123-223149125 of one gene in a pair of alleles on chromosome 10, and the nucleotide GAC is missing in the other gene), and the pepper has an intermediate phenotype; when the fluorescent signal is red, the genotype is DelGAC:DelGAC (i.e., the nucleotide GAC is missing at positions 223149123-223149125 of a pair of alleles on chromosome 10), and the pepper has a short-fruit phenotype.

[0113] Genotype test results such as Figure 5 shown. Figure 5 The following are the typing results of KASP70-72 markers for parents (RILs-20 and RILs-126), F1, and 48 F2 plants. Among them, the blue circle represents the genotype InGAC:InGAC, which predicts that the fruit length of the corresponding plant is a long fruit phenotype; the green circle represents the genotype InGAC:DelGAC, which predicts that the fruit length of the corresponding plant is an intermediate phenotype; the red circle represents the genotype DelGAC:DelGAC, which predicts that the fruit length of the corresponding plant is a short fruit phenotype.

[0114] (3) The pepper plants in step (1) were planted according to the method described in Section 1.1 of Example 1 and the fruit length phenotype of each pepper plant was investigated. According to Section 1.5 of Example 1, pepper plants with a fruit length of 12 cm ± 4 cm were identified as having a short fruit phenotype, pepper plants with a fruit length of 26 cm ± 4 cm were identified as having a long fruit phenotype, and pepper plants with a fruit length greater than 16 cm and less than 22 cm were identified as having an intermediate phenotype.

[0115] (4) The genotypes obtained in step (2) and the phenotypes obtained in step (3) are listed in Table 2 for comparative analysis. As can be seen from Table 2, the genotype prediction results are 100% consistent with the phenotype identification results.

[0116] Table 2 Genotypes and phenotypes of parental RILs-20 and RILs-126, F1, and 48 F2 individuals

[0117]

[0118]

[0119] In summary, the molecular marker located on the CaFL1 gene on chromosome 10 of pepper provided by the present invention is closely linked to the pepper fruit length phenotype, and different genotypes correspond to different fruit length phenotypes. Specifically, when the genotype of the molecular marker is detected to be InGAC:InGAC in the pepper germplasm to be tested, it can be judged that the pepper germplasm has a long fruit phenotype; when the genotype of the molecular marker is detected to be InGAC:DelGAC, it can be judged that the pepper germplasm has an intermediate phenotype; when the genotype of the molecular marker is detected to be DelGAC:DelGAC, it can be judged that the pepper germplasm has a short fruit phenotype.

[0120] This molecular marker can significantly improve the efficiency of screening for the single trait of pepper fruit length and accelerate the breeding of superior varieties. Furthermore, the molecular marker locus provided by the present invention can be used as a target for genetic engineering breeding. By mutating the locus to the InGAC:InGAC genotype through gene mutation or other methods, it provides a rapid and effective approach for genetic improvement of pepper fruit length, thus having important application value for pepper germplasm innovation.

[0121] Obviously, those skilled in the art may make various changes and modifications to this technical solution without departing from the spirit and scope of this technical solution. Thus, if these modifications and variations of this technical solution fall within the scope of the claims of this technical solution and their equivalents, this technical solution is intended to include these modifications and variations.

Claims

1. Use of a reagent for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulating gene CaFL1 in the following (a) or (b): (a) Application in the selection or cultivation of pepper varieties with different fruit lengths; (b) Application in identifying fruit length of pepper varieties; The molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 of chromosome 10 of the pepper genome. The position of the molecular marker in the genome is determined based on the Qiemen reference genome.

2. The use according to claim 1, characterized in that The reagents include a primer set, and the primer set includes: A first forward primer comprising the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing; A second forward primer comprising the nucleotide sequence shown in SEQ ID No. 4 in the sequence listing; The nucleotide sequence of the universal reverse primer is shown in SEQ ID No. 5 in the sequence listing.

3. The use according to claim 2, characterized in that The 5' ends of the first forward primer and the second forward primer are respectively connected to different fluorescent linker sequences; Particularly, the fluorescent linker sequence is selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.

4. The use according to claim 3, characterized in that The nucleotide sequence of the first forward primer is shown in SEQ ID No. 6 in the sequence listing, and the nucleotide sequence of the second forward primer is shown in SEQ ID No. 7 in the sequence listing; and / or, When the genotype of the molecular marker is InGAC:InGAC, the pepper has a long-fruit phenotype; when the genotype of the molecular marker is InGAC:DelGAC, the pepper has an intermediate phenotype; when the genotype of the molecular marker is DelGAC:DelGAC, the pepper has a short-fruit phenotype.

5. A primer set for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulatory gene CaFL1, wherein the molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome, and the position of the molecular marker in the genome is determined based on the Qiemen reference genome.

6. The primer set according to claim 5, characterized in that The primer set includes: A first forward primer comprising the nucleotide sequence shown in SEQ ID No. 3 in the sequence listing; A second forward primer comprising the nucleotide sequence shown in SEQ ID No. 4 in the sequence listing; The nucleotide sequence of the universal reverse primer is shown in SEQ ID No. 5 in the sequence listing.

7. The primer set according to claim 6, characterized in that The 5' ends of the first forward primer and the second forward primer are respectively connected to fluorescent linker sequences of different colors; Particularly, the fluorescent linker sequence is selected from one of FAM, HEX, FITC, RED, TET, JOE, and R110.

8. The primer set according to claim 7, characterized in that The nucleotide sequence of the first forward primer is shown in the sequence listing as SEQ ID No. 6, and the nucleotide sequence of the second forward primer is shown in the sequence listing as SEQ ID No.

7.

9. A reagent or kit for detecting the genotype of a molecular marker tightly linked to the pepper fruit length regulatory gene CaFL1, the reagent or kit comprising the primer set according to any one of claims 5 to 8.

10. A method for identifying the length of pepper fruit to be tested, comprising the following steps: (1) extracting genomic DNA from the pepper sample to be tested; (2) using the genomic DNA of the pepper sample to be tested as a template, performing PCR amplification using the primer set according to any one of claims 5 to 8 or the reagent or kit according to claim 9 to obtain a PCR amplification product; (3) analyzing the PCR amplification product, determining the genotype of a molecular marker tightly linked to the pepper fruit length regulatory gene CaFL1 based on the analysis results, and predicting the fruit length phenotype of the pepper sample to be tested based on the genotype of the molecular marker; the molecular marker is an insertion / deletion of three nucleotides GAC at positions 223149123-223149125 on chromosome 10 of the pepper genome, and the position of the molecular marker in the genome is determined based on the Qiemen reference genome; in, The method for predicting the fruit length phenotype of the pepper sample to be tested by the genotype of the molecular marker is as follows: When the genotype of the molecular marker is InGAC:InGAC, it is predicted that the pepper has a long fruit phenotype; when the genotype of the molecular marker is InGAC:DelGAC, it is predicted that the pepper has an intermediate phenotype; when the genotype of the molecular marker is DelGAC:DelGAC, it is predicted that the pepper has a short fruit phenotype.

Images