Target gene, PCR detection primer, kit and PCR identification method for identifying gender of populus tomentosa
Sex-specific nucleotide sequences were screened through cluster separation analysis and PCR detection primers were designed, which solved the problem of identifying male and female plants in early stages of Poplar, and achieved efficient and accurate gender identification of seedling-stage gender identification, which was suitable for breeding and management of Poplar.
Patent Information
- Application Number
- CN202510596501.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is difficult to quickly and reliably identify male and female plants in the early stages of the growth of poplar, resulting in long seedling cycles, low efficiency and waste of resources.
Sex-specific nucleotide sequences were screened out by cluster separation analysis method, specific PCR detection primer pairs were designed, PCR identification method was established, and male and female strains were identified through PCR amplification and electrophoresis products.
It has achieved efficient gender identification for the seedling stage of Poplar, with an accuracy rate of 100%, simple operation and good repeatability of experiments. It is suitable for the selection and breeding of Poplar varieties, targeted cultivation management and gender-related gene function research.
Smart Images
Figure CN120442839A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a target gene for identifying plant sex, a PCR detection primer and a PCR identification method, and in particular to a target gene for identifying the sex of Populus tomentosa, a PCR detection primer, a kit and applications thereof, and belongs to the field of molecular identification of the sex of Populus tomentosa. Background Art
[0002] White Poplar (Populus tomentosa Carrière) boasts a straight trunk, excellent wood quality, and strong resistance to stress, combining ecological protection with economic value. As a typical dioecious plant, female white Poplars disperse their seeds through wind during their reproductive maturity, producing large quantities of fluff. These fluff fibers tend to clump and scatter, posing a fire hazard. They are also susceptible to pathogenic microorganisms and can induce allergic respiratory diseases. Replacing female white Poplars with male plants is a fundamental strategy for addressing the fluff problem without compromising the ecological and economic benefits of the tree species.
[0003] In traditional seedling cultivation, it's difficult to distinguish male and female Populus tomentosa seedlings based solely on phenotype. Identification based on floral organ morphology requires waiting for the plants to reach reproductive maturity, which typically takes 6-8 years. This results in a long seedling cultivation cycle, low efficiency, and a waste of resources. Therefore, exploring a method that can quickly and reliably identify male and female Populus tomentosa plants early in their growth cycle not only meets market demand and social benefits, but also significantly improves breeding efficiency and reduces production waste. Summary of the Invention
[0004] One of the purposes of the present invention is to provide a target gene for distinguishing the male and female sexes of Populus tomentosa.
[0005] A second object of the present invention is to provide a PCR detection primer pair designed according to the target gene.
[0006] The third object of the present invention is to provide a PCR kit for distinguishing the sexes of Populus tomentosa.
[0007] The fourth purpose of the present invention is to apply the target gene, PCR detection primer pair or PCR kit to the identification of male and female sex of Populus tomentosa or the screening of male and female sex of Populus tomentosa seedlings.
[0008] In order to achieve the above objectives, the main technical solutions adopted by the present invention include:
[0009] On the one hand, the present invention provides a target gene for distinguishing the male and female sexes of Populus tomentosa. The nucleotide sequence of the target gene in male Populus tomentosa is shown in SEQ ID No. 1, and the nucleotide sequence of the target gene in female Populus tomentosa is shown in SEQ ID No. 2.
[0010] Another aspect of the present invention is to provide a PCR detection primer pair designed according to the target gene.
[0011] In a preferred embodiment of the present invention, the PCR detection primer pair is selected from a primer pair A consisting of two nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4, or a primer pair B consisting of two nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6; the primer pair A or primer pair B is used as a PCR amplification primer, and a PCR amplification system is established with the DNA of the white poplar sample to be detected as a template, and PCR amplification is performed, and the amplification result is used to identify the male and female sex of the white poplar. Therefore, the use of the PCR detection primer pair in identifying the sex of the white poplar is within the scope of protection of the present invention. Moreover, a kit for identifying the sex of the white poplar comprising the above primer set is also within the scope of protection of the present invention.
[0012] Another aspect of the present invention is to provide a PCR kit for identifying the sex of Populus tomentosa, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and a PCR detection primer pair; wherein the PCR detection primer pair is selected from a primer pair A consisting of two nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 or a primer pair B consisting of two nucleotide sequences shown in SEQ ID No.5 and SEQ ID No.6.
[0013] Another aspect of the present invention is to apply the target gene, PCR detection primer pair or PCR kit to the sex identification of Populus tomentosa or sex screening of Populus tomentosa seedlings.
[0014] A preferred specific embodiment of the present invention uses the target gene and PCR detection primer pair to identify the sex of Populus tomentosa or screen the sex of Populus tomentosa seedlings, comprising: designing PCR detection primers with the target gene as the target; using the DNA of the Populus tomentosa sample to be detected as the template and using the designed PCR detection primer pair to establish a PCR amplification system for PCR amplification; and determining whether the Populus tomentosa sample to be detected is female or male according to the PCR amplification result.
[0015] For reference, the present invention provides a PCR identification method for the male and female sex of Populus tomentosa, comprising: (1) using the genomic DNA of Populus tomentosa to be detected as a template and using the primer pair A or the primer pair B as PCR detection primers to establish a PCR amplification system for PCR amplification; (2) using the primer pair A as the PCR detection primer to establish a PCR amplification system for PCR amplification, if a characteristic band of 250-500 bp appears in the amplified product, the Populus tomentosa sample to be detected is male; if no characteristic band of 250-500 bp is amplified, the Populus tomentosa sample to be detected is female; using the primer pair B as the PCR detection primer to establish a PCR amplification system for PCR amplification; if a characteristic band of 250-500 bp appears in the amplified product, the Populus tomentosa sample to be detected is female; if no characteristic band of 250-500 bp is amplified, the Populus tomentosa sample to be detected is male.
[0016] In a preferred specific embodiment of the present invention, primer pair A is used as a PCR detection primer to establish a PCR amplification system for PCR amplification. If a 283bp characteristic band appears in the amplified product, the Populus tomentosa sample to be detected is male; if no 283bp characteristic band is amplified, the Populus tomentosa sample to be detected is female; and primer pair B is used as a PCR detection primer to establish a PCR amplification system for PCR amplification. If a 273bp characteristic band appears in the amplified product, the Populus tomentosa sample to be detected is female; if no 273bp characteristic band is amplified, the Populus tomentosa sample to be detected is male.
[0017] In a preferred embodiment of the present invention, the PCR amplification conditions are: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 68°C for 5 s, and 35 cycles; final extension at 68°C for 10 min, and cooling at 25°C for 1 min.
[0018] Traditional methods for mapping important plant traits rely on the construction of genetic linkage maps, a process that not only requires genotypic information from a large number of segregating populations but is also time-consuming and costly. Michelmore et al. innovatively developed Bulked Segregation Analysis (BSA), which uses a differential phenotypic grouping strategy to rapidly identify markers linked to traits, overcoming the shortcomings of traditional methods and significantly improving research efficiency (Michelmore RW, Paran I, Kesseli R V. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. [J] Proceedings of the National Academy of Sciences, 1991). In BSA analysis, equal samples are randomly selected from plants based on the target trait phenotype and following the principle of single variable distribution, and then divided into two equal groups. Equal amounts of DNA from two groups of sample plants were mixed to construct two gene pools. The genetic differences between the two gene pools theoretically only reflect the variation of sequences related to the target traits.
[0019] The present invention addresses the technical bottleneck of the difficulty in distinguishing the early phenotypes of male and female Populus tomentosa. Based on the differences in nucleotide sequences between the different sexes of Populus tomentosa, equal samples were randomly selected from Populus tomentosa and divided into two groups. Equal amounts of DNA from the two groups of sample plants were mixed to construct two gene pools, and sex-specific nucleotide sequences were obtained. Based on the sequences, specific PCR primer pairs were designed to establish a PCR amplification product detection method for accurately distinguishing male and female plants, thus achieving efficient sex identification of seedling plants. This detection method has high detection accuracy. After large-scale sample validation (including 216 independent male and female samples of Populus tomentosa), the sex identification accuracy rate reached 100%. The detection method is simple to operate, requiring only three steps throughout the experiment: DNA extraction, PCR amplification, and electrophoresis product discrimination. It is also compatible with conventional PCR instruments and electrophoresis systems. The detection results of this detection method are not affected by environmental factors or developmental stages, and have good experimental repeatability. The present invention has application prospects in the selection and breeding of Populus tomentosa, targeted cultivation management, germplasm resource bank construction, and research on the function of sex-related genes. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1Agarose gel electrophoresis diagram for preliminary screening of primer pairs; the arrows point to the PCR products of primer pair A or primer pair B.
[0021] Figure 2 This is a diagram showing the sex identification of Populus tomentosa using specific PCR primer pair A.
[0022] Figure 3 This is a diagram showing the sex identification of Populus tomentosa using specific PCR primer pair B.
[0023] Figure 4 The figure shows the PCR amplification results using specific PCR primer pair A in the natural population of Populus tomentosa.
[0024] Figure 5 The figure shows the PCR amplification results using specific PCR primer pair B in the natural population of Populus tomentosa. DETAILED DESCRIPTION
[0025] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.
[0026] Experimental Example 1 Screening of target genes for sex identification of Populus tomentosa
[0027] Plant materials: 60 male and female clones of Populus tomentosa were collected from Shuozhou, Shanxi and Guanxian, Shandong. Young leaves were quickly frozen in liquid nitrogen and transported to the laboratory for ultra-low temperature storage at -80°C until use.
[0028] Main reagents: M5 HiPer Plant Genomic DNA Kit (Polymer, MF070-04).
[0029] 200 mg of leaves were ground into a fine powder using liquid nitrogen. Genomic DNA was then extracted according to the kit instructions. The OD260 / 280 ratio was between 1.8 and 2.0, and the concentration was ≥50 ng / μL, as measured by a NanoDrop 2000. Equal amounts (500 ng) of DNA from male and female Populus tomentosa were mixed to create female and male pools. A 350 bp sequencing library was constructed and high-throughput paired-end sequencing was performed at 60× depth on a sequencing platform to generate 150 bp raw paired-end reads. High-quality short reads (clean reads) obtained from the raw reads after quality assessment and filtering were aligned to the Populus tomentosa genomic sequence. By comparing the differences in sequencing coverage between male and female mixed pools, genomic intervals with a sequencing depth of 0 (Depth = 0) in one pool and a depth ≥ 10× (Depth = 10) in the other pool were screened out; for the above-mentioned differential intervals, their genomic coordinate sites were intercepted and extended 150 bp each to the 5' and 3' ends, and the DNA sequence within this 300 bp region was extracted as the sex-specific nucleotide sequence (target gene).
[0030] The nucleotide sequence of the target gene in the male strain of Populus tomentosa is shown in SEQ ID No. 1: GGACCTGATCTTTTGAATGGTATAAACATCGGTCTTGAATGCTGTGGCAAGAATTCCACCATCAATTCCTGTGGAAAAGACAGCCAACGGCACAGAAACTGTTCCGGCATTTGCACTACCAAAAGAAGAAATCGCAACAGCTGGTTCGTTGGTTGGGTTGGACTGATAGTGTACCAGACCCTTTGGGAAAATGAACATATCTCCAACTTGGAGTTTTTGGGTGTAAAGCACATTCTTGGTGTCAACAAATCCAACATCCAAGCTGCCATACACAAGGAACAAG (SEQ ID No. 1).
[0031] The nucleotide sequence of the target gene in the female plant of Populus tomentosa is shown in SEQ ID No. 2: TGGAGTTAAACAGCCACCGGCCGGCGGCCATATTGCTTGTATTTTGGGCCACGCCTCTGCTTCCCTTCTGTTGATCCATCAGGACTTCAACTACATTGACCCTTTCCTGTTGTCTTGTGGCGTTTTGGCCTTAGCGGTTTCATCGGCACATAGCAGATTTGACTGAAAGCTCTCTTGAGTTTGCATCAACAAAAGCAATTTTTTTTCATGTAATTCTAGAATCCTTGACATGCTGTTTCCAAGAAAATTGTTTTTTCCTTGGCAGAACTGTTC (SEQ ID No. 2).
[0032] Experimental Example 2 Screening of specific PCR primer pairs for sex identification of Populus tomentosa
[0033] Plant material: DNA samples of Populus tomentosa of known sex.
[0034] Main reagent: KOD One TM PCR Master Mix-Blue (TOYOBO, KMM-201), M5 HiPureAgarose (Polymer, MF103-01), 50×TAE buffer (Solarbio, T1060), M5 HiClear DL2000 plus DNA Marker (Polymer, MF026-01).
[0035] Based on the target sequence in Experimental Example 1, primers were designed using Primer Premier 5. The primers were blasted against the Populus tomentosa genome (tool: TBtools) to exclude those without significant matches. The six candidate primer pairs in Table 1 were configured as follows: 1 mL of Populus tomentosa DNA template of known sex, 0.25 μL of upstream primer, 0.25 μL of downstream primer, KOD One TM PCRMaster Mix-Blue 7.5μL, ddH2O 6μL; PCR conditions: initial denaturation at 94°C for 2 minutes; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 5 seconds; final extension at 68°C for 10 minutes, followed by cooling at 25°C for 1 minute. A 5μL sample of the amplified product was subjected to 1% agarose gel electrophoresis at 150V for 15 minutes, followed by detection.
[0036] The six primer pairs include: primer pair A consists of two primers shown in SEQ ID No.3 and SEQ ID No.4, primer pair B consists of two primers shown in SEQ ID No.5 and SEQ ID No.6, primer pair 1 consists of two primers shown in SEQ ID No.7 and SEQ ID No.8, primer pair 2 consists of two primers shown in SEQ ID No.9 and SEQ ID No.10, primer pair 3 consists of two primers shown in SEQ ID No.11 and SEQ ID No.12, and primer pair 4 consists of two primers shown in SEQ ID No.13 and SEQ ID No.14.
[0037] The electrophoresis test results are as follows Figure 1 As shown, the products of primer pair A and B have the ability to distinguish between males and females ( Figure 1 The remaining four pairs of PCR primers (primer pair 1 to primer pair 4) were not able to discriminate the male and female sexes of Populus tomentosa. Therefore, the specific primer pairs A and B were finally determined as the specific PCR detection primer pairs for distinguishing the male and female sexes of Populus tomentosa.
[0038] Table 1 Specific PCR primer pairs and sequences for sex identification of Populus tomentosa
[0039]
[0040] Experimental Example 3: Application of specific PCR primer pairs to identify the sex of Populus tomentosa
[0041] 1 Test method
[0042] There were 60 male and 60 female DNA samples of Populus tomentosa with known sex, as shown in Table 2; there were 96 DNA samples of Populus tomentosa with unknown sex from natural populations, as shown in Table 3.
[0043] Table 2 Clonal numbers of Populus tomentosa samples of known sex used for sex identification
[0044]
[0045]
[0046] Table 3. Clone numbers of Populus tomentosa samples of unknown sex used for sex identification
[0047]
[0048]
[0049] The two sets of specific PCR primers for sex identification of Populus tomentosa and the specific PCR primers for sex identification of Populus tomentosa in Experimental Example 2 of the present invention were used to perform PCR amplification on the Populus tomentosa DNA samples in Tables 2 and 3; the amplification system was 1 μL of Populus tomentosa DNA template, 0.25 μL of upstream primer, 0.25 μL of downstream primer, KOD One TM PCR Master Mix-Blue (7.5 μL) and ddH₂O (6 μL) were added. PCR conditions were as follows: initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 5 s, and extension at 68°C for 5 s. Finally, a final extension at 68°C for 10 min was performed, followed by a 1-min cooldown at 25°C. A 5 μL sample of the amplified product was analyzed by electrophoresis on a 1% agarose gel at 150 V for 15 min.
[0050] 2 Test results
[0051] The electrophoresis results of DNA samples of white poplar with known sex showed that when the specific PCR primer pair A was used to detect the sex of white poplar, all male white poplars showed a characteristic band of 283 bp, while females did not have this band ( Figure 2 ); When the specific PCR primer pair B was used to detect the sex of Populus tomentosa, all female Populus tomentosa showed a characteristic band of 273 bp, while males did not ( Figure 3 ); According to the test results, the detection efficiency of male and female Populus tomentosa using specific PCR primer pair A or B reached 100%.
[0052] The electrophoresis results of PCR products of unknown sex of Populus tomentosa are as follows Figure 4 、 Figure 5 As shown, all Populus tomentosa samples that showed a band when amplified using specific PCR primer pair A did not show a band in the amplification product using specific PCR primer pair B; and all Populus tomentosa samples that showed a band when amplified using specific PCR primer pair B did not show a band in the amplification product using specific PCR primer pair A. This result can be used to identify the sex of Populus tomentosa. The specific PCR primer pairs of the present invention can verify each other's accuracy.
Claims
1. A target gene for sex differentiation of Populus tomentosa, characterized in that: The nucleotide sequence of the target gene is shown in SEQ ID No. 1 or SEQ ID No.
2.
2. A PCR detection primer pair designed for the target gene according to claim 1.
3. The PCR detection primer pair according to claim 2, characterized in that The PCR detection primer pair is selected from primer pair A consisting of two nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4 or primer pair B consisting of two nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No.
6.
4. Use of the target gene according to claim 1 in sex identification of Populus tomentosa or sex screening of Populus tomentosa seedlings.
5. The use according to claim 4, characterized in that A PCR detection primer pair is designed with the target gene described in claim 1 as the target; a PCR amplification system is established using the DNA of the Populus tomentosa sample to be detected as a template and the designed PCR detection primer pair to perform PCR amplification; and whether the Populus tomentosa sample to be detected is female or male is determined based on the PCR amplification result.
6. A PCR method for identifying the sex of Populus tomentosa, characterized in that: include: (1) using the genomic DNA of the white poplar tomato to be tested as a template and using the primer pair A or the primer pair B described in claim 3 as a PCR detection primer to establish a PCR amplification system for PCR amplification; (2) using the primer pair A as a PCR detection primer to establish a PCR amplification system for PCR amplification; if a characteristic band of 250-500 bp appears in the amplified product, the white poplar tomato sample to be tested is male; if no characteristic band of 250-500 bp is amplified, the white poplar tomato sample to be tested is female; A PCR amplification system is established using primer pair B as a PCR detection primer for PCR amplification; if a 250-500 bp characteristic band appears in the amplified product, the tested Populus tomentosa sample is female; if no 250-500 bp characteristic band is amplified, the tested Populus tomentosa sample is male.
7. The PCR identification method according to claim 6, characterized in that A PCR amplification system was established using primer pair A as a PCR detection primer for PCR amplification. If a 283 bp characteristic band appeared in the amplified product, the tested Populus tomentosa sample was male; if no 283 bp characteristic band was amplified, the tested Populus tomentosa sample was female. A PCR amplification system was established using primer pair B as the PCR detection primer for PCR amplification. If a 273 bp characteristic band appeared in the amplified product, the Populus tomentosa sample to be tested was female. If no 273 bp characteristic band was amplified, the Populus tomentosa sample to be tested was male.
8. The PCR identification method according to claim 7, characterized in that The PCR amplification conditions are as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 68°C for 5 s, 35 cycles; final extension at 68°C for 10 min, and cooling at 25°C for 1 min.
9. A PCR kit for sex identification of Populus tomentosa, comprising Taq enzyme, dNTP, Mg 2+ , ddH2O and a PCR detection primer pair, characterized in that, The PCR detection primer pair is the PCR detection primer pair according to claim 2 or 3.
10. Use of the PCR kit according to claim 9 in sex identification of Populus tomentosa or sex screening of Populus tomentosa seedlings.