SNP (Single Nucleotide Polymorphism) molecular marker for identifying soluble solid content of peach fruit and application of SNP molecular marker
By detecting the A/G mutation of SNP molecular marker at a specific location in the peach genome, the problem of judging the content of soluble solids in the peach fruit during the seedling stage is solved, efficient and accurate fruit quality prediction and screening is achieved, and breeding efficiency and fruit quality are improved.
Patent Information
- Application Number
- CN202510690167.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-27
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-05-27
AI Technical Summary
The prior art is difficult to efficiently and accurately determine the content of soluble solids of peach fruits during the seedling stage, which affects the efficiency of the breeding process and the improvement of the fruit quality.
A SNP molecular marker located at chromosome 16,613,334 bp of Peach Genome 5 is provided. By detecting the A/G mutation site, the content of the soluble solid substance of the fruit is determined. The genotype AA or AG means ≤12%, and GG means >12%.
Early prediction and screening of the content of soluble solids of peach fruits was achieved, with an accuracy rate of 83.23%, supporting fruit quality improvement and breeding optimization.
Smart Images

Figure CN120442850A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a SNP molecular marker for identifying the soluble solid content of peach fruit and application thereof, belonging to the field of biotechnology. Background Art
[0002] Peaches are sweet, juicy, and soft, with a glutinous texture. Different peaches exhibit significant variations in shape, color, and texture. Soluble solids content (SSC) is a key quality trait, closely linked to flavor and a crucial factor in determining the overall taste quality of peaches. SSC levels not only reflect the physiological maturity of the fruit, helping to determine the optimal picking window for flavor, but also show a significant positive correlation with sweetness, making it a key target for enhancing consumer taste. From a postharvest perspective, higher SSC levels enhance cellular osmotic stability and slow fruit softening, thereby improving storage tolerance and logistics losses, providing technical support for commercialization. Furthermore, targeting market preferences, increasing SSC levels through genetic improvement can overcome the bottleneck of varietal homogeneity and cultivate new germplasm with both high sugar content and storage and transportation resistance, thereby strengthening brand competitiveness. Therefore, incorporating SSC into breeding evaluation systems can systematically optimize the edible and commercial value of peaches, driving the industry towards higher quality and higher efficiency. Recent statistics show that global peach consumption has generally declined, and the uneven taste quality is one of the important reasons for the decline in consumption. Therefore, improving taste quality has become an important goal of breeding work.
[0003] Peach is a diploid plant (2n = 16) with a genome size of approximately 230 Mb, approximately twice that of the model species Arabidopsis thaliana. Due to its small genome size and short juvenile period, it is often considered a model species for functional genomic studies in the Rosaceae family. Peach is self-compatible, and its genome heterozygosity is relatively low compared to other fruit tree species. In recent years, with the rapid development of sequencing technology and the continuous reduction in sequencing costs, peach genomics research based on resequencing has rapidly developed. Over a thousand resequences have been completed, and variant types include traditional molecular markers such as simple sequence repeats (SSRs) and next-generation molecular markers such as single nucleotide polymorphisms (SNPs), insertion / deletion (InDels), and structural variation (SVs). Combined with sequencing technology, relevant molecular markers can be developed to determine the soluble solids content of peach fruit at the seedling stage, preliminarily assessing fruit sweetness and accelerating the breeding of high-sugar varieties. Summary of the Invention
[0004] In view of the deficiencies of the prior art, the present invention aims to provide a SNP molecular marker for identifying the soluble solids content of peach fruit and its application.
[0005] In order to achieve the above-mentioned object, the technical solution of the present invention is, on the one hand, to provide a SNP molecular marker for identifying the soluble solids content of peach fruit, and the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1.
[0006] Furthermore, the SNP mutation site is position 201 of the sequence shown in SEQ ID NO. 1, and there is an A / G mutation at this site.
[0007] Furthermore, the SNP molecular marker was located at 16,613,334 bp on chromosome 5 of the peach genome.
[0008] On the other hand, the technical solution of the present invention is to provide an application of the SNP molecular marker in identifying the soluble solids content of peach fruit.
[0009] Furthermore, when the SNP molecular marker genotype is AA or AG, the soluble solid content of peach fruit is ≤12%; when the SNP molecular marker genotype is GG, the soluble solid content of peach fruit is >12%.
[0010] On the other hand, the technical solution of the present invention is to provide a method for identifying the soluble solids content of peach fruit using the SNP molecular marker, comprising the following steps:
[0011] (1) extracting genomic DNA from peach fruit samples to be tested;
[0012] (2) obtaining the genotype of the SNP molecular marker of the peach fruit sample using the genomic DNA;
[0013] (3) Analyze the soluble solids content in peach fruit samples.
[0014] On the other hand, the technical solution of the present invention is to provide an application of the SNP molecular marker in the preparation of a product for identifying the soluble solids content of peach fruit.
[0015] On the other hand, the technical solution of the present invention is to provide a product for identifying the soluble solids content of peach fruit prepared using the SNP molecular marker.
[0016] Beneficial effects:
[0017] The present invention measured the soluble solids content of 417 peach fruits that matured in 2018, 2019, and 2020, and sequenced the 417 peach materials using the Illumina sequencing platform. The "LoveII" peach genome was used as the reference genome for comparison analysis, and a non-synonymous mutation SNP site (A / G) significantly associated with peach SSC was detected at 16,613,334bp on peach chromosome 5. Referring to the "Specifications and Data Standards for Description of Peach Germplasm Resources", the present invention combined the genotype to classify the SSC content into two categories with 12% as the boundary, that is, ≤12% is low SSC content, and >12% is high SSC content, corresponding to the genotypes AA / AG and GG, respectively. The present invention uses the obtained SNP molecular markers to verify the soluble solids content of peach pulp. The results show that the accuracy of low SSC content (AA / AG) is 84.48%, the accuracy of high SSC content (GG) is 81.69%, and the overall accuracy is 83.23%. This shows that the SNP molecular markers of the present invention can be used for early prediction and screening of the soluble solids content of peach fruit, and have good economic and practical value. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is the SSC content distribution diagram.
[0019] Figure 2 Manhattan plot and QQ plot for GWAS analysis results.
[0020] Figure 3 The phenotypic differences of SSC content among different genotypes in the population were significant (P=3.88e-15).
[0021] Figure 4 The SSC content phenotypic differences among different genotypes in the tested hybrid population were significant (P=1.07e-27). DETAILED DESCRIPTION
[0022] The specific embodiments of the present invention are further described in detail below with reference to the examples.
[0023] Example
[0024] 1. Acquisition of phenotypic data:
[0025] The research materials of the present invention are 417 peach germplasm materials with rich polymorphism, which were taken from the National Peach Germplasm Repository of China (NPGRC) (Zhengzhou) (N 34.71°, E113.70°). After the fruits matured in 2018, 2019 and 2020, well-developed fruits were selected to determine their pulp soluble solid content (SSC), with three biological replicates. The phenotypic data were fitted and used for subsequent genome-wide association analysis (GWAS analysis). The SSC distribution results of the association population showed that the SSC trait expression distribution was continuous and normally distributed, proving that this trait is a quantitative trait controlled by micro-effect polygenes ( Figure 1 ).
[0026] 2. Acquisition of SNP molecular markers:
[0027] 417 peach accessions were used as samples. 2 g of fresh young leaves were collected from each sample, and DNA was extracted using the traditional CTAB method. Sequencing was performed on either the Illumina GAII or HiSeq 2500 platforms, with insert libraries of 300 or 500 bp, using paired-end sequencing. Data quality control was performed using FastQC (v0.11.6) (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ). The "LoveII" peach genome (genome version: Prunus persica Genome v2.0.a1;
[0028] Reads were aligned to the reference genome (https: / / www.rosaceae.org / species / prunus_persica / genome_v2.0.a1) using BWA (v0.7.12) with the following parameters: bwa mem -t 4-MR. Aligned reads were sorted using Picard (version 1.136), PCR duplicates were removed, and SAM files were converted to BAM files. Depth and coverage of the final alignment were calculated using GATK (version 3.4-46) software Depth of Coverage and BEDtools (version 2.24.0) software genomecov. SNPs were detected using GATK. To minimize the impact of sequencing errors in gene identification and improve GWAS statistical power, SNPs were filtered to remove low-frequency variants (MAF < 0.05). The final number of SNPs was 342,387. The GWAS used a mixed linear model (MLM) and the software was EMMAX (Version: beta). Using a 5% threshold in the Bonferroni test, a non-synonymous mutation SNP site (A / G) significantly associated with peach SSC was detected at 16,613,334 bp on chromosome 5 of the peach genome ( Figure 2 The nucleotide sequences of 200 bp on each side of position 16613334 of chromosome 5 of the peach genome are as follows (where R represents A or G):
[0029] AGAGCTTGAAAGCTTTGAAGATGATTCATCTTCTCCTGAAAATAAATTTGGGGTAGCCATACTTGTTGTATTAGTACTTCTTTCACCATAAACCTTGCCACTCAATACATCTCTAATTGGATTATTTGAGAAATGTTTGCCCATCATTTCTGGAAAACCCAACTCCCCAAAACCCTGACTTTCAATAGCTTGCTGGCCTG RCACTAAAACATTGCTGCCAAAAGTACAGGGGATTTTCAATTCCCAACCCATCAAAGTATTTCTACTTCTAGAAAATGAATCAGTGTGTGAAATTGTTTCTTCGGAAACAAACCCCTTCCCTTCAGAAATACGGCTCCAAGACTCCATTACAAGTAAAAGGATCACAACTAAAGCCCACTTCAATTCATGGGGAAAACTAT(SEQ ID NO.1)
[0030] With reference to the "Specifications and Data Standards for Peach Germplasm Resource Description" (Table 1), the SSC content was divided into two categories based on the genotype, i.e., ≤12% was classified as low SSC content, corresponding to the genotypes AA or AG, and >12% was classified as high SSC content, corresponding to the genotypes GG ( Figure 3 ).
[0031] Table 1 SSC description specifications in the “Description Specifications and Data Standards for Peach Germplasm Resources”
[0032]
[0033] 3. Verification
[0034] Some common peach varieties in the China National Peach Germplasm Resource Garden were used as experimental materials. From these, 9 hybrid populations with investigated phenotypic traits, totaling 316 individual plants, were selected. See Table 2 for details:
[0035] Table 2 Names and sizes of the tested hybrid populations
[0036]
[0037] Combined with the resequencing data of the research group (all the listed strains have completed resequencing), the genotype and phenotype were analyzed ( Figure 4 ) showed that the Chr5:16613334 allele was highly significantly associated with peach fruit SSC. The results also showed that the accuracy rate for low SSC content (genotype AA / AG) was 84.48%, the accuracy rate for high SSC content (genotype GG) was 81.69%, and the overall accuracy rate was 83.23% (Table 3).
[0038] Table 3 Typing results of SSC traits
[0039]
Claims
1. A SNP molecular marker for identifying the soluble solids content of peach fruit, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.
1.
2. The SNP molecular marker according to claim 1, characterized in that The SNP mutation site is position 201 of the sequence shown in SEQ ID NO.1, and there is an A / G mutation at this site.
3. The SNP molecular marker according to claim 1, characterized in that The SNP molecular marker is located at 16,613,334bp on chromosome 5 of the peach genome.
4. Use of the SNP molecular marker according to any one of claims 1 to 3 in identifying the soluble solids content of peach fruit.
5. The use according to claim 4, characterized in that When the SNP molecular marker genotype is AA or AG, the soluble solid content of peach fruit is ≤12%; when the SNP molecular marker genotype is GG, the soluble solid content of peach fruit is >12%.
6. A method for identifying the soluble solids content of peach fruit using the SNP molecular marker according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) extracting genomic DNA from peach fruit samples to be tested; (2) obtaining the genotype of the SNP molecular marker of the peach fruit sample using the genomic DNA; (3) Analyze the soluble solids content in peach fruit samples.
7. Use of the SNP molecular marker according to any one of claims 1 to 3 in the preparation of a product for identifying the soluble solids content of peach fruit.
8. A product for identifying the soluble solids content of peach fruit, prepared using the SNP molecular marker according to any one of claims 1 to 3.
Citation Information
Patent Citations
Molecular marker closely linked with soluble solid trait QTL site of kiwifruit fruit and application of molecular marker
CN106868199A
SNP markers associated with prunus persica fruit peel fluff character and application thereof
CN107746896A
Cited By
Chinese cherry whole genome liquid phase chip and application thereof
CN121294707A